Skip to content
This repository was archived by the owner on Dec 23, 2024. It is now read-only.

dmildh-absci/seqviz

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

385 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

 

 

GitHub

A DNA sequence viewer supporting custom, GenBank, FASTA, NCBI accession, and iGEM input

Features

SeqViz aims to be a DNA sequence viewer with a simple API and easy customizability. It currently provides:

  • Multiple input formats

    • Sequence
    • Accession (NCBI or iGEM)
    • File (FASTA, GenBank, SBOL, SnapGene)
  • Circular plasmid viewer

    • Annotations with names and colors
    • Index of sequence
    • Name of plasmid
    • Base pair length of sequence
  • Linear sequence viewer

    • Annotations with names and colors
    • Amino acid translations
    • Sequence and complement nucleotide bases
    • Index of sequence
    • Enzyme cut sites
    • Highlighted sequence search results
  • Selections

    • Clicking on an annotation, translation, enzyme or searchElement, or dragging over the sequence, will create a selection
    • Information about selections is available via options.onSelection() (see viewer options)

Usage

Installation

npm

npm install seqviz

CDN

<script src="https://unpkg.com/seqviz"></script>

Instantiation

React

import { SeqViz } from "seqviz";

export default () => (
  <SeqViz
    name="J23100"
    seq="TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC"
    annotations={[{ name: "promoter", start: 0, end: 34, direction: 1, color: "blue" }]}
  />
);

Vanilla-JS

<script>
  window.seqviz
    .Viewer("root", {
      name: "L09136",
      seq: "tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgca",
      style: { height: "100vh", width: "100vw" }
    })
    .render();
</script>

Viewer

The viewer's constructor (Vanilla-JS) accepts two arguments.

var viewer = seqviz.Viewer(element, options)

  • element -- either a string id attribute like "root" or "app-root" or an element; e.g. from document.getElementById()
  • options -- options as documented in greater detail below

viewer.render()

Renders the viewer to the DOM at the node passed in ${element}.

viewer.renderToString()

Renders the viewer and returns as an HTML string.

viewer.setState(options)

Update the viewer's configuration and re-renders.

Options/Props

All the following are usable as props via the React component (seqviz.SeqViz) or as properties of an options object via the JS implementation (seqviz.Viewer()).

Required (one of)

options.seq (='')

The DNA sequence to render.

options.accession (='')

An NCBI accession ID or iGEM part ID. Populates options.name, options.seq, and options.annotations.

options.file (=null)

A File, Blob, or body (string/utf8) from a FASTA, Genbank, SnapGene, or SBOL file. Populates options.name, options.seq, and options.annotations.

Optional

options.viewer (='both')

One of ["linear", "circular", "both", "both_flip"]) the type of viewer to show. "both" by default. "both" means the circular viewer fills the left side of SeqViz and the linear viewer fills the right. "both_flip" is the opposite: the linear viewer is on the left and the circular viewer is on the right.

options.name (='')

The name of the sequence/plasmid.

options.compSeq (='')

The complement sequence. Inferred from seq by default.

options.showComplement (=true)

Whether to show the complement sequence.

options.showIndex (=true)

Whether to show the index line and ticks below the sequence.

options.annotations (=[])

An array of annotation objects for the viewer. Each annotation object requires 0-based start (inclusive) and end (exclusive) indexes. For forward arrows, set the annotation's direction to 1 and -1 for reverse arrows. A direction of 0 or no direction produces annotations without arrows. Names (optional) are rendered on top the annotation.

[
  { start: 0, end: 22, name: "Strong promoter", direction: 1 }, // [0, 22)
  { start: 23, end: 273, name: "GFP" },
  { start: 300, end: 325, name: "Weak promoter", direction: -1, color: "#FAA887" }
];

In the example above, the "Strong promoter" would span the first to twenty-second basepair.

options.translations (=[])

An array of translation objects for rendering ranges of amino acids beneath the DNA sequence. Like annotation's, translation objects requires 0-based start (inclusive) and end (exclusive) indexes relative the DNA sequence. A direction is required (1 (FWD) or -1 (REV)).

[
  { start: 0, end: 90, direction: 1 }, // [0, 90)
  { start: 191, end: 522, direction: -1 }
];

options.enzymes (=[])

An array of restriction enzyme names whose recognition sites should be shown. Example: ["PstI", "EcoRI"]. This is case-insensitive. The list of supported enzymes is in src/utils/enzymes.js.

options.enzymesCustom (={})

Unsupported enzymes can also be passed through an object where the keys are the enzymes' names and the values are the enzymes:

{
  Cas9: {
    rseq: "NGG", // recognition sequence
    fcut: 0, // cut index on FWD strand, relative to start of rseq
    rcut: 1 // cut index on REV strand, relative to start of rseq
  }
}

options.zoom (={ linear: 50, circular: 0 })

How zoomed the viewer(s) should be 0-100. Keyed by viewer type (options.viewer).

options.bpColors (={})

An object mapping bp to color where bp is a nucleotide or 0-based index. Example:

{ "A": "#FF0000", "T": "blue", 12: "#00FFFF" }

options.colors (=[])

An array of color hex codes for annotation coloring. Defaults to:

[
  "#9DEAED", // cyan
  "#8FDE8C", // green
  "#CFF283", // light green
  "#8CDEBD", // teal
  "#F0A3CE", // pink
  "#F7C672", // orange
  "#F07F7F", // red
  "#FAA887", // red-orange
  "#F099F7", // magenta
  "#C59CFF", // purple
  "#6B81FF", // blue
  "#85A6FF" // light blue
];

options.style (={})

Style for seqviz's outer container div. Empty by default. Useful for setting the height and width of the viewer if the element around seqviz lacks a defined height and/or width. For example:

{ height: "100vh", width: "100vw" }

options.onSelection (=null)

Callback function executed after selection events. Should accept a single selection argument: (selection) => {}.

This occurs after drag/drop selection and clicks. If an annotation, translation, enzyme or searchElement was clicked, the selection object will have info on the selected element. The example below is of a selection object following an annotation click.

{
  // selection
  "name": "lacZ fragment",
  "type": "ANNOTATION",
  "seq": "ctatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattcgtaatcatggtcat",
  "gc": 55.3,
  "tm": 85,
  "start": 133,
  "end": 457,
  "length": 324,
  "direction": -1
  "clockwise": true,
  "color": "#8FDE8C",
}

options.search (=null)

A search object for specifying search results to highlight on the viewer. An example is below:

{ "query": "aatggtctc", "mismatch": 1 }

Searching supports the following nucleotide wildcards within the query.

{
  "y": ["c", "t"],
  "r": ["a", "g"],
  "w": ["a", "t"],
  "s": ["c", "g"],
  "k": ["g", "t"],
  "m": ["a", "c"],
  "d": ["a", "g", "t"],
  "v": ["a", "c", "g"],
  "h": ["a", "c", "t"],
  "b": ["c", "g", "t"],
  "x": ["a", "c", "g", "t"],
  "n": ["a", "c", "g", "t"]
}

mismatch is an int denoting the maximum allowable mismatch between the query and a match within the viewer's sequence (see: Hamming distance).

options.onSearch (=null)

Callback executed after a search event. Called once on initial render. Accepts a single searchResults argument: (searchResults) => {}. An example of a searchResults array is below.

[
  {
    start: 728,
    end: 733,
    direction: 1,
    index: 0
  },
  {
    start: 1788,
    end: 1793,
    direction: -1,
    index: 1
  }
];

options.copyEvent (=(KeyboardEvent) => false)

A functions that returns whether to copy the selected range on the viewer(s) to the user's clipboard.

An example of an options.copyEvent function for copying after ctrl+c or meta+c events:

event => event.key === "c" && (event.metaKey || event.ctrlKey);

options.rotateOnScroll (=true)

By default, the circular viewer rotates when scrolling with a mouse over the viewer. That can be disabled by setting rotateOnScroll to false.

options.backbone (='')

This is a feature specific to BioBricks (options.accession). The library currently supports BBa_K1362091, BBa_K823055, pSB1A3, pSB1A7, pSB1AC3, pSB1AK3, pSB1AT3, pSB1C3, pSB1K3, and pSB1T3.

Custom backbones, as DNA strings, are also supported (for example: ATGATATAGAT).

Demo

You can see a demonstration with iGEM BioBricks at: tools.latticeautomation.com/seqviz.

For developers, the demo source code is at seqviz/demo.

You can also check out an example of using SeqViz to view NCBI GenBank entries in our Medium post.

Contact Us

This library is currently being maintained by Lattice Automation.

You can report bugs at Issues or contact us directly at contact@latticeautomation.com

About

DNA sequence viewer supporting custom, GenBank, FASTA, NCBI accession, and iGEM input.

Resources

License

Stars

0 stars

Watchers

0 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • JavaScript 95.5%
  • Gnuplot 3.9%
  • Other 0.6%