Skip to content

adriantich/SLIM

 
 

Repository files navigation

SLIM logo

What is it?

SLIM is a web application that aims to facilitate the access to state-of-art bioinfirmatic tools to non-specialist and to command-line reluctant for the processing of raw amplicon sequencing data, i.e. DNA metabarcoding, from illumina paired-end or nanopore FASTQ to annotated ASV/OTU matrix.

SLIM is based on the node.js framework, and provide a Graphical User Interface (GUI) to interact with bioinformatic softwares. It simplifies the creation and deployment of a processing pipeline and is accessible within an internet browser over the internet. It is maintened by Adrià Antich and Tristan Cordier. The application is embedded in a podman.

The full documentation is available here.

Install and deploy the web app

First of all, podman needs to be installed on the machine. You can find instructions here :

To install SLIM, get the last stable release here or, using terminal :

sudo apt-get update && apt-get install git curl
curl -OL https://github.com/trtcrd/SLIM/archive/v1.0.0.tar.gz
tar -xzvf v1.0.0.tar.gz
cd SLIM-1.0.0

As soon as podman is installed and running and the SLIM archive downloaded, it can be deployed by using the two scripts get_dependencies_slim_v1.0.0.sh and start_slim_v1.0.0.sh.

  • get_dependencies_slim_v1.0.0.sh fetches all the bioinformatics tools needed from their respective repositories.
  • start_slim_v1.0.0.sh destroys the current running webserver to replace it with a new one. /!\ All the files previously uploaded and the results of analysis will be detroyed during the process.
bash get_dependencies_slim_v1.0.0.sh
bash start_slim_v1.0.0.sh

The server is configured to use up to 8 CPU cores per job. The amount of available cores will determine the amount of job that can be executed in parallel (1-8 -> 1 job, 16 -> 2 jobs, etc.). The number of cores is defined in the scheduler.js script in the line:

const CORES_BY_RUN = 8;

Accessing the webserver

The execution of the start_slim_v1.0.0.sh script deploys and start the webserver. By default, the webserver is accessible on the 8080 port but can be modified using the -P option:

> bash start_slim_v1.0.0.sh -h
start_slim_v1.0.0.sh destroys the current running webserver to replace it with a new one.
/!\ All the files previously uploaded and the results of analysis will be detroyed during the process.

Syntax: start_slim_v1.0.0.sh [-h] [-p] [-P] [port]
options:
-h --help       Print this Help.

-d --docker     Use docker instead of podman

-P --port       <numeric:numeric> Specify the port that has to be opened for the container. 8080:80 by default
  • To access it on a remote server from your machine, type the server IP address followed by ":8080" (for example 156.241.0.12:8080) from an internet browser (prefer Firefox and Google Chrome).
  • If SLIM is deployed on your own machine, type localhost:8080/

If the server is correctly set, you should see this:

SLIM homepage

Prepare and upload your data

You may check by yourself the files and their required format:

The "file uploader" section allows you to upload all the required files. Usually it consists of:

  • one (or multiple) pair(s) of FASTQ files corresponding to the multiplexed library(ies) (can be zipped)
  • a CSV (Comma-separated values) file containing the correspondance between library, tagged-primers pairs and samples (the so-called tag-to-sample file, see below for an example)
  • alternatively, a list of fastq files that each correspond to a sample (nanopore or illumina)
  • a FASTA file containing the tagged primers sequences and name (see below for an example)
  • a FASTA file containing sequence reference database (see below for an example)

Example of tag-to-sample file: This file must contain at least the four four fields: run, sample, forward and reverse. "Run" corresponds to your illumina library identification; "sample" corresponds to the names of your samples in the library; "forward" and "reverse" corresponds to the names of your tagged primers. Samples names MUST be unique, even for replicates sequenced in multiples libraries

run,sample,forward,reverse
library_1,sample_1,forwardPrimer-A,reversePrimer-B
library_1,sample_2,forwardPrimer-B,reversePrimer-C
library_2,sample_3,forwardPrimer-A,reversePrimer-B
library_2,sample_4,forwardPrimer-B,reversePrimer-C

Example of primers FASTA file: It contains the names of your tagged primers and their sequences, in a conventional FASTA format. Each primer tag consists of 4 variables nucleotides at the 5' side, prior the template specific part. Each primer must contains a specific identifier (by letters in this example). The primers sequences can include IUPAC nucleotide codes, they are taken into account.

>forwardPrimer-A
ACCTGCCTAGCGTYG
>forwardPrimer-B
GAATGCCTAGCGTYG
>reversePrimer-B
GAATCTYCAAATCGG
>reversePrimer-C
ACTACTYCAAATCGG

Example of sequences reference database file

This FASTA file contains reference sequences with unique identifier and taxonomic path in the header. Such database can be downloaded for instance from SILVA for both prokaryotes and eukaryotes (16S and 18S), EUKREF or PR2 for eukaryotes (18S), UNITE for fungi (ITS), MIDORI for metazoan (COI). Each header include a unique identifier (usually the accession), a space ' ', and the taxonomic path separated by a semi-colon (without any space, please use "_" underscore). You should have the same amount of taxonomic rank for each reference sequences

>AB353770 Eukaryota;Alveolata;Dinophyta;Dinophyceae;Dinophyceae_X;Dinophyceae_XX;Peridiniopsis;Peridiniopsis_kevei
ATGCTTGTCTCAAAGATTAAGCCATGCATGTCTCAGTATAAGCTTTTACATGGCGAAACTGCGAATGGCTCATTAAAACAGTTACAGTTTATTTGAA
GGTCATTTTCTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCGCCCAAACCCGACTCCGTGGAAGGGTTGTATTTATTAGTTACAGAACC
AACCCAGGTTCGCCTGGCCATTTGGTGATTCATAATAAACGAGCGAATTGCACAGCCTCAGCTGGCGATGTATCATTCAAGTTTCTGACCTATCAGC
TTCCGACGGTAGGGTATTGGCCTACCGTGGCAATGACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGA
>KC672520 Eukaryota;Opisthokonta;Fungi;Ascomycota;Pezizomycotina;Leotiomycetes;Leotiomycetes_X;Leotiomycetes_X_sp.
TACCTGGTTGATTCTGCCCCTATTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATATATACCGTGAAACTGCGAATGGC
TCATTATATCAGTTATAGTTTATTTGATAGTACCTTACTACT
>AB284159 Eukaryota;Alveolata;Dinophyta;Dinophyceae;Dinophyceae_X;Dinophyceae_XX;Protoperidinium;Protoperidinium_bipes
TGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTCAGTATAAGCTTCAACATGGCAAGACTGTGAATGGCTCATTAAAA
CAGTTGTAGTTTATTTGGTGGCCTCTTTACATGGATAGCCGTGGTAATTCTAGAACTAATACATGCGCTCAAGCCCGACTTCGCAGAAGGGCTGTGT
TTATTTGTTACAGAACCATTTCAGGCTCTGCCTGGTTTTTGGTGAATCAAAATACCTTATGGATTGTGTGGCATCAGCTGGTGATGACTCATTCAAG
CTT

Analyse your data

Metabarcoding

Usually, a typical Metabarcoding workflow would include:

  1. Demultiplexing the libraries (if each file corresponds to a single sample, use the wildcard-creator module, and proceed to the joining step)
  2. Joining the paired-end reads
  3. Chimera removal
  4. ASVs inference / OTUs clustering
  5. Taxonomic assignement

The "Add a new module" section has a drop-down list containing various modules to pick, set and chain. Pick one and hit the "+" button. This will add the module at the bottom of the first section, and prompting you to fill the required fields. For more informations on the modules, you can refer to their manuals on the wiki or by clicking the (i) button on the module interface.

The use of wildcard '*' for file pointing

The chaining between module is made through the files names used as input / output. To avoid having to select mannually all the samples to be included in an analysis, wildcards '*' (meaning 'all') are generated during demultiplexing (or by using the wildcard-creator module, see below) and used by the application. Such wildcards are generated from the compressed libraries fastq files (tar.gz) and by the tag-to-sample file. Users cannot type on their own wildcards in the file names of modules. Instead, the application has an autocompletion feature and will make wildcards suggestions for the user to select within the GUI.

However, when uploading demultiplexed libraries (each fastq correspond to a single sample), the demultiplexing step is not needed and in substitution we need to create this wildcard pattern to proceed throughout the different processing steps. To do so, we have created the module wildcard-creator.

To point to a set of samples (all samples from the tag-to-sample, or all the samples from the library_1 for instance), there will be a '*', and the application adds the processing step as a suffix incrementaly:

  • all samples from the tag-to-sample file that have been demultiplexed: 'tag_to_sample*_fwd.fastq' and 'tag_to_sample*_rev.fastq'
  • all samples from the library_1 that have been demultiplexed: 'tag_to_sample_Library_1*_fwd.fastq' and 'tag_to_sample_Library_1*_rev.fastq'
  • all samples from the tag-to-sample file that have been joined: 'tag_to_sample*_merge-vsearch.fasta'
  • all samples from the tag-to-sample file that have been joined and chimera filtered: 'tag_to_sample*_merge-vsearch_uchime.fasta'

The same principle applies for ASV/OTU matrices, we add the previous processing step as a suffix in the file name.

see below for the demultiplexing

SLIM example

and below for an OTU clustering using vsearch and taxonomic assignement

SLIM example

Once your workflow is set, click on the start button, and bookmark the url to allow returning to the job.

When the job is over, you will have small icons of download on the right of each output field. All the uploaded, intermediate and results files are available to download. Your files will remain available on the server during 24h, after what they will be removed for storage optimisation

Each module status is displayed besides its names:

  • waiting: the execution started, the module is waiting for files input.
  • running: the module is busy.
  • warnings: there was some warnings during the execution, but the module is still running.
  • aborted: the module aborted and the pipeline has stopped its execution.
  • ended: the module has finnished its task.

For more details on the app, you can refer to the wiki pages

Creating your own module

To contribute by adding new softwares, you will have to know a little bit of HTML and javascript. Please refer to the Man pages to learn how to create a module.

Current modules by category

In the manual page you can find a list of the different modules implemented and their help pages.

Version history

v1.0.0

  • Moved to podman container by default (docker kept as an option)
  • Added modules for processing nanopore amplicon data (CHOPPER, MSI, ASHURE, OPTICS)
  • Added module to create wildcard grouping of files
  • Added SWARM3 module
  • Emailing service hidden, until a viable option is identified
  • Documentation moved from the wiki to the tutos folder.
  • Various interface bug fixes

v0.6.2

Dockerfile: updated systeminformation and docker recipe

v0.6.1

Dockerfile: updated to DADA2 v1.16 and DECIPHER v2.16.0, cleaned the docker recipe

v0.6

BUGFIX: resolved issues with the order of module execution when DADA2 is used. BUGFIX: resolved issues with the pipeline.conf file that did not included the checkbox and radio buttons.

v0.5.3

DTD: added an option for trimming the primers at the end of the reads in (for fully overlapping pair-end reads) and a contig length filtering

v0.5.2

DADA2 beta integration, small fix on IDATAXA

v0.5.1

BUGFIX of the IDTAXA module, added wiki for the module

v0.5

Integration of the IDTAXA module

v0.4.1

Fixed the Dockerfile to fetch the latest R version and CASPER util.c file

v0.4

Added timing checkpoints in the logs of the scheduler; Added the third-party software version infos in the email

v0.3

Fixed LULU module and the otu table writing is now done by a python script

v0.2

Updated the get_dependencies script.

v0.1

First release, with third-parties versions handled within the get_dependencies_slim.sh script.

About

A web app for environmental DNA metabarcoding analysis

Resources

License

Stars

1 star

Watchers

0 watching

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • JavaScript 59.1%
  • HTML 11.0%
  • Shell 10.7%
  • Python 9.1%
  • R 4.8%
  • Dockerfile 3.0%
  • Other 2.3%