Skip to content

DilaDeniz/BioFastq-a

Repository files navigation

BioFastq-A logo

BioFastq-A

The fastest FASTQ/FASTA quality analysis tool — written in Rust

License: MIT Rust Version Bioconda

No Java. No Python. No internet required. Just one binary.

Faster than fastp. Faster than FastQC. Does more than both.


Benchmark

Synthetic benchmark — 1M reads × 150bp, 302 MB FASTQ, 4 threads, cold cache

Tool Time Throughput Language
BioFastq-A 2.1s 469K reads/s · 141 MB/s Rust
fastp 0.23.4 5.0s 200K reads/s · 60 MB/s C++
FastQC 0.12.1 14.3s 70K reads/s · 21 MB/s Java

BioFastq-A is 2.4× faster than fastp and 6.8× faster than FastQC — while running more analyses than either.

Real Illumina data — SRR38033288 (43.5M reads · 6.08 Gbp · ~14 GB · 4 threads · cold cache · WSL2)

Tool Time
BioFastq-A 33s
fastp 58s
FastQC 168s

Browser / WebAssembly Version

BioFastq-A runs entirely in the browser via WebAssembly — no installation, no server, no data upload. Drop a FASTQ file on the page and get the same HTML report back in your tab.

# Build (requires wasm-pack: cargo install wasm-pack)
cd wasm && ./build.sh

# Serve locally
cd wasm/www && python3 -m http.server 8080
# → open http://localhost:8080

The wasm/ directory is a self-contained Cargo project. A deployed version can be hosted on any static file server — GitHub Pages, Netlify, S3, Vercel, etc.

Metrics: identical to the native CLI

Every metric the native binary computes — per-base quality boxplots, GC distribution, adapter detection, k-mer frequency, N50/N90, duplication estimate, overrepresented sequences, long-read scatter — is computed identically in the browser version. The HTML report format is the same file.

Why it is slower than the native binary

Constraint Native WebAssembly
Threads Rayon parallel fold (all cores) Single-threaded (WASM threads are experimental)
I/O memmap2 — OS maps file into address space, zero-copy File API — browser reads file, copies into WASM heap
SIMD AVX2 / SSE4 (256-bit vectors) WebAssembly SIMD (128-bit only)
Allocator System allocator wasm-bindgen default allocator

The net result is approximately 3–8× slower than the native binary. A 200 MB file that takes ~0.7 s natively completes in roughly 5–15 s in the browser. For interactive QC of files you can conveniently open in a browser this is entirely acceptable.

What the browser version does NOT lose

  • All quality metrics — every chart, every statistic is identical to the CLI
  • Offline capability — once loaded the .wasm binary is cached; no internet needed
  • Privacy — your sequencing data never leaves your machine, not even to GitHub's servers

Limitations (browser only)

  • Compressed (.gz) files not supported — decompress first with gunzip
  • No adapter trimming output (QC report only)
  • No paired-end mode — analyse R1 and R2 separately

Installation

Bioconda (recommended)

conda install -c bioconda biofastq-a

Build from source

Requires Rust ≥ 1.80.

git clone https://github.com/DilaDeniz/BioFastq-a.git
cd BioFastq-a
cargo build --release
# binary → target/release/biofastq-a

Enable native CPU optimisations (AVX2/SSE4 — recommended for maximum speed):

mkdir -p .cargo
echo '[build]' > .cargo/config.toml
echo 'rustflags = ["-C", "target-cpu=native"]' >> .cargo/config.toml
cargo build --release

Install system-wide:

bash install.sh          # → /usr/local/bin (may need sudo)
bash install.sh ~/bin    # → ~/bin (no sudo needed)

Docker

docker build -t biofastq-a .
docker run --rm -v "$PWD":/data biofastq-a sample.fastq --headless
docker run --rm -v "$PWD":/data biofastq-a *.fastq.gz --trim --output-dir /data/qc

Quick Start

# Interactive TUI — live dashboard while processing
biofastq-a sample.fastq

# Headless mode — for scripts and CI
biofastq-a sample.fastq --headless --output-dir ./reports

# Trim adapters, quality-filter, and analyse
biofastq-a reads.fastq.gz --trim --poly-g --cut-right --output-dir ./qc

# Paired-end mode
biofastq-a R1.fastq.gz --in2 R2.fastq.gz --headless --output-dir ./qc

# Long-read mode (Oxford Nanopore / PacBio) — auto-detected or forced
biofastq-a ont_reads.fastq --long-read --headless

# Compare two samples side by side
biofastq-a sample1.fastq sample2.fastq --compare --headless

# Fast mode — skip heavy QC modules
biofastq-a *.fastq.gz --fast --headless --output-dir ./reports

# MultiQC-compatible output for pipeline aggregation
biofastq-a sample.fastq.gz --headless --multiqc --output-dir ./qc

# Open the report
xdg-open ./qc/sample_report.html   # Linux
open ./qc/sample_report.html       # macOS

All CLI Flags

Core Options

Flag Description
<file> [<file2> ...] Input FASTQ or FASTA files. Gzip (.gz) handled automatically.
--headless Run without interactive TUI. Use for scripts, CI, HPC.
--output-dir <dir> Directory for reports and trimmed output. Default: current directory.
--threads <N> Number of CPU threads. Default: all available cores.
--in2 <file> R2 file for paired-end mode (R1 is the positional argument).
--strict Abort on first malformed record. Default: skip and warn.
--version, -V Print version and exit.
--help, -h Show help message.

Trimming Options

All trimming steps are applied in the correct biological order: hard trim → sliding window → poly-G → quality trim 3′ → adapter → poly-X → length filter

Flag Description
--trim Trim adapter sequences and write cleaned reads to <stem>_trimmed.fastq.gz.
--adapter <seq> Additional adapter sequence to screen and trim. Repeatable. Combined with 7 built-in adapters.
--quality-trim <Q> Trim 3′ bases with Phred quality below Q (classic per-base trim). Default: off.
--poly-g [N] Trim poly-G tails of ≥ N consecutive G's. Default N=10. Essential for NovaSeq/NextSeq 2-color chemistry data where no-signal cycles produce G's.
--poly-x [N] Trim any homopolymer tail (A/T/C/G) of ≥ N bases. Default N=10.
--cut-right Sliding window 5′→3′: cut the read from the first window where mean quality < threshold to the end. Equivalent to Trimmomatic SLIDINGWINDOW.
--cut-front Sliding window: advance the read start past low-quality 5′ bases.
--cut-tail Sliding window: shrink the read end past low-quality 3′ bases.
--window-size <N> Window size for all sliding window trims. Default: 4.
--window-quality <Q> Phred quality threshold for all sliding window trims. Default: 20.
--trim-front <N> Hard-trim exactly N bases from every read's 5′ end unconditionally.
--trim-tail <N> Hard-trim exactly N bases from every read's 3′ end unconditionally.
--min-length <N> Discard reads shorter than N bp after all trimming. Default: 20.

Per-Read Filtering Options

Applied after all trimming. Reads that fail are counted and reported.

Flag Description
--min-quality <Q> Discard reads whose mean Phred quality (after trimming) is below Q.
--max-n <N> Discard reads containing more than N uncalled (N) bases.

QC Module Toggles

All modules are on by default. Disable expensive modules on constrained systems or when the data type makes them irrelevant.

Flag What it skips When to use
--no-kmer 4-mer frequency analysis When speed matters more than k-mer enrichment
--no-duplication HyperLogLog duplicate estimation Very large files where even HLL overhead matters
--no-per-tile Per-tile Illumina quality Non-Illumina data (ONT, PacBio, Ion Torrent)
--no-overrep Overrepresented sequence detection Non-Illumina or very large files
--no-adapter Adapter content analysis Already-trimmed data
--fast kmer + duplication + per-tile + overrep Quick QC pass, skips all heavy modules

Output Options

Flag Description
--no-html Skip HTML report generation.
--no-json Skip JSON report generation.
--multiqc Write a MultiQC-compatible <stem>_mqc.json file. Drop it next to your multiqc_data/ directory and run multiqc .
--compare When processing two or more files, generate a side-by-side comparison.html report comparing the first two files. Works for both short-read and long-read data.

Long-Read Options

Flag Description
--long-read Force long-read mode. Auto-detected when median read length > 1000 bp or ONT headers (ch=, start_time=) are present.

In long-read mode:

  • Quality thresholds adjusted to ONT ranges (warn < Q10, fail < Q8 vs. Illumina's Q28/Q20)
  • Q10/Q20 stat cards replace Q20/Q30
  • Per-tile quality chart hidden (Illumina-specific)
  • Three additional charts: Quality vs Length scatter, Reads over Time, Channel Occupancy
  • ONT adapters (SQK-LSK, SQK-PCS, SQK-RAD) added to detection

Output Files

<stem>_report.html        Self-contained HTML report with interactive charts.
                           No internet required. Works offline.
<stem>_report.json        Machine-readable JSON for downstream pipelines.
<stem>_mqc.json           MultiQC general stats table (with --multiqc).
<stem>_trimmed.fastq.gz   Adapter-trimmed reads (with --trim).
comparison.html           Side-by-side comparison of two files (with --compare).

For multiple input files: one report per file + a batch_report.html summary.


QC Modules

Short-Read (Illumina)

Module Description
Per-base sequence quality Mean Phred per position with Q25/Q50/Q75 IQR band and median line. Pass/warn/fail traffic light.
Per-sequence quality distribution Histogram of mean Phred scores across all reads.
Per-base sequence content A/C/G/T/N % per position.
Per-sequence GC content Per-read GC % histogram with theoretical normal distribution overlay. Contamination is visible as a secondary peak.
Per-base N content N % per position.
Sequence length distribution Read length histogram with N50 and N90 prominently displayed.
Sequence duplication levels 9-bin histogram (1×, 2×, 3-4×, 5-9×, 10-49×, 50-99×, 100-499×, 500-999×, ≥1000×) via HyperLogLog — O(1) memory regardless of file size.
Overrepresented sequences Top sequences by frequency with adapter source identification. Adaptive threshold.
Adapter content Per-position adapter presence. 7 built-in adapters + custom via --adapter.
Per-tile quality Illumina CASAVA 1.8+ flow cell tile quality. Spot defective tiles visually.
K-mer analysis Parallel 4-mer counting. Top enriched k-mers ranked by observed/expected ratio.

Each module shows a FastQC-style traffic light (✓ Pass / ! Warn / ✗ Fail).

Long-Read (ONT / PacBio) — additional charts

Module Description
Quality vs Length scatter Mean Phred vs read length scatter plot. Sampled up to 2000 points. Reveals whether longer reads are lower quality.
Reads over time Cumulative read output over run duration (5-minute buckets). ONT-only: parsed from start_time= in read headers.
Channel occupancy Distribution of reads across flow cell channels. Reveals clogged or inactive pores. ONT-only: parsed from ch= in read headers.

Automatic Parameter Suggestions

After every analysis, BioFastq-A inspects its own results and prints actionable recommendations — in the terminal output and as an amber card in the HTML report:

Suggestions:
  → Consider --poly-g 10  (high G content at 3' end — likely NovaSeq/NextSeq 2-color data)
  → Consider --trim  (adapter sequences detected in 15.2% of reads)
  → Consider --cut-right --window-quality 20  (mean quality drops below Q20 at position 145)
  → Consider --min-quality 20  (mean read quality Q18.4 is below typical threshold)

No other tool does this. BioFastq-A analyzes your data and tells you exactly what to do next.


Built-in Adapters

Detected automatically via Aho-Corasick multi-pattern search (single pass, all adapters simultaneously):

Name Sequence
TruSeq Read 1 AGATCGGAAGAGCACACGTCT
TruSeq Read 2 AGATCGGAAGAGCGTCGTGTA
Nextera Read 1/2 CTGTCTCTTATACACATCT
Small RNA 3′ TGGAATTCTCGGGTGCCAAGG
Poly-A AAAAAAAAAAAAAAAAAAAAAA
Poly-T TTTTTTTTTTTTTTTTTTTTTT
ONT Ligation (SQK-LSK) AATGTACTTCGTTCAGTTACGTATTGCT
ONT PCR (SQK-PCS) ACTTGCCTGTCGCTCTATCTTC
ONT Rapid (SQK-RAD) GCTTGGGTGTTTAACCTTTTTTCGCAACGGGT

Add custom adapters with --adapter SEQUENCE (repeatable, combined with built-ins).


HTML Report Features

The self-contained HTML report (no CDN, works completely offline) includes:

  • Interactive Canvas.js charts for all QC modules
  • PNG download button on every chart — export publication-ready figures
  • Print / PDF button in the header — @media print CSS optimised for paper
  • FastQC-style traffic lights — instant pass/warn/fail overview
  • Automatic parameter suggestion card (amber) — actionable recommendations
  • Stat cards with colour-coded thresholds (green/yellow/red)
  • Batch summary when multiple files are processed

Comparison with Other Tools

vs FastQC

BioFastq-A FastQC
Language Rust Java (requires JVM)
Speed 6.8× faster baseline
Parallelism Full parallel batch fold Single-threaded per file
Adapter trimming Yes No
Poly-G/X trimming Yes No
Sliding window QC Yes No
Long-read support Yes (ONT/PacBio) Limited
HyperLogLog dedup Yes (O(1) memory) No (HashSet — memory grows)
GC distribution overlay Yes Yes
Per-pos IQR band Yes Yes
N50 / N90 Yes No
Interactive TUI Yes No
Auto-parameter suggestions Yes No
Side-by-side comparison Yes No
Chart PNG download Yes No
MultiQC output Yes Yes
Offline HTML Yes Yes

vs fastp

BioFastq-A fastp
Language Rust C++
Speed 2.4× faster baseline
Per-tile quality Yes No
K-mer analysis Yes No
Overrepresented sequences Yes No
GC distribution chart Yes Yes
Duplication histogram Yes No
N content chart Yes No
Long-read support Yes Partial
Interactive TUI Yes No
N50 / N90 Yes No
Auto-parameter suggestions Yes No
Side-by-side comparison Yes No
HyperLogLog dedup Yes No
Poly-G trimming Yes Yes
Sliding window QC Yes Yes
Paired-end correction No Yes
UMI support No Yes

Why Is It Fast?

BioFastq-A is architecturally different from its counterparts in ways that matter at scale:

Lock-free parallel batch fold — Every rayon worker thread owns its own BatchAccum struct. No shared mutable state, no mutexes, no contention. Workers fold independently and merge at the end. This is the single biggest reason for the speed advantage over fastp.

Memory-mapped I/O — Files are mapped directly into address space with memmap2. The OS kernel manages page caching. No fread() buffer copies. On sequential reads the kernel prefetches pages automatically.

SIMD accelerationmemchr uses AVX2/SSE4 for newline and byte searching. GC counting uses hand-vectorised loops. This is 8-32× faster than scalar code on modern CPUs.

HyperLogLog cardinality estimation — Duplicate rate uses a fixed-size HyperLogLog structure (1% error margin) instead of a growing HashSet. Constant memory regardless of file size, eliminating cache pressure from millions of HashMap insertions.

Aho-Corasick adapter search — All adapter sequences are searched in a single pass over each read via a precompiled automaton. No O(adapters × read_length) loop.

Zero-cost new features — GC distribution, N content, duplication histogram, and quality percentiles are computed from data that was already being collected. They add zero meaningful overhead.

LTO + codegen-units=1 — Link-time optimisation inlines all library code at compile time. The compiler sees the entire program at once and can make global optimisation decisions impossible in separate compilation.

Flat-array accumulators — Per-read statistics (length_histogram, quality_by_length_bin) use flat contiguous arrays instead of HashMaps. Array indexing eliminates hash computation and pointer-chasing on every read. During Rayon's binary-tree reduce, array merges are simple element-wise additions (O(n) memcpy-speed) versus O(n × hash_time) HashMap insertions.


Pipeline Integration

Snakemake

rule fastq_qc:
    input:  "data/{sample}.fastq.gz"
    output:
        html = "qc/{sample}_report.html",
        json = "qc/{sample}_report.json"
    threads: 8
    shell:
        "biofastq-a {input} --headless --threads {threads} --output-dir qc/"

rule fastq_trim:
    input:  "data/{sample}.fastq.gz"
    output:
        trimmed = "trimmed/{sample}_trimmed.fastq.gz",
        html    = "qc/{sample}_report.html"
    shell:
        "biofastq-a {input} --trim --poly-g --cut-right "
        "--min-quality 20 --headless --output-dir qc/"

rule multiqc:
    input:  expand("qc/{sample}_mqc.json", sample=SAMPLES)
    output: "qc/multiqc_report.html"
    shell:  "multiqc qc/ -o qc/"

Nextflow

process BIOFASTQA {
    input:  path fastq
    output: path "*_report.{html,json}", path "*_mqc.json" optional true

    script:
    """
    biofastq-a ${fastq} --headless --multiqc --output-dir .
    """
}

process BIOFASTQA_TRIM {
    input:  path fastq
    output: path "*_trimmed.fastq.gz", path "*_report.html"

    script:
    """
    biofastq-a ${fastq} --trim --poly-g --cut-right \\
        --min-quality 20 --headless --output-dir .
    """
}

MultiQC Integration

--multiqc writes <stem>_mqc.json — picked up automatically by multiqc .

The file populates the General Statistics table with: Total Reads · % GC · Avg Length · Avg Quality · % Q30 · % Adapter · % Dups · N50

for f in data/*.fastq.gz; do
    biofastq-a "$f" --headless --multiqc --output-dir qc/
done
multiqc qc/ -o qc/

Examples

# Basic QC
biofastq-a sample.fastq

# Full preprocessing pipeline for NovaSeq data
biofastq-a reads.fastq.gz \
    --trim \
    --poly-g \
    --cut-right --window-quality 20 \
    --min-quality 20 \
    --max-n 5 \
    --output-dir ./qc

# ONT long-read QC
biofastq-a nanopore.fastq --long-read --headless --output-dir ./qc

# Compare two conditions
biofastq-a control.fastq treatment.fastq --compare --headless --output-dir ./qc

# Batch process all samples, generate MultiQC-compatible output
biofastq-a *.fastq.gz --headless --multiqc --output-dir ./qc

# Fast QC (skip heavy modules)
biofastq-a large_file.fastq.gz --fast --no-html --headless

# Paired-end with adapter trimming
biofastq-a R1.fastq.gz --in2 R2.fastq.gz \
    --trim --poly-g --cut-right \
    --output-dir ./qc

# CI / automated pipeline
biofastq-a sample.fastq.gz \
    --headless \
    --no-html \
    --multiqc \
    --output-dir ./reports

Scientific Accuracy

All calculations follow standard bioinformatics conventions and have been audited:

  • Phred quality: raw_byte − 33 = Phred score (Sanger/Illumina 1.8+ encoding). Mean quality is the arithmetic mean of Phred scores, not the mean of error probabilities.
  • GC content: (G + C) / total_bases × 100 including N bases in the denominator.
  • N50 / N90: Reads sorted descending by length; cumulative sum threshold uses div_ceil for precision at boundary values.
  • Duplication rate: 1 − (HyperLogLog_estimate / total_reads) × 100. HyperLogLog uses 1% error parameter.
  • Sliding window QC: O(n) sliding sum — seed first window, add new base, subtract outgoing base. Scientifically equivalent to Trimmomatic's SLIDINGWINDOW.
  • Poly-G/X trimming: Scans 3′ end backwards, counts consecutive homopolymer run, cuts if run ≥ min_len.
  • Per-position percentiles: Index-based histogram of Phred 0–42; percentile by cumulative threshold.

Support

If you find BioFastq-A useful in your research, consider citing it or starring the repository.

Due to age restrictions I'm unable to use traditional payment platforms — crypto is the only way I can receive support:

Network Address
Solana (SOL) AY5SwVxbvTHL16SUGj6kJBqMk4USniZmbqdXxH8xVrTa
Ethereum (ETH) 0x5176d005DD096aFa145B3ffff308b72ed76f1554

License

MIT © 2026 Zeynep Dila Deniz

About

High-performance FASTQ/FASTA quality analysis tool written in Rust — HTML reports, adapter trimming, k-mer analysis, N50/N90, duplication estimation, and real-time TUI

Topics

Resources

Stars

Watchers

Forks

Releases

Packages

Used by

Contributors

Languages