From 1f916fd65aef8e47fb5ffd50f103f8b8e5d996d7 Mon Sep 17 00:00:00 2001 From: STRchive bot Date: Wed, 24 Jun 2026 14:03:52 -0600 Subject: [PATCH 1/4] Fix inheritance mechanism --- data/STRchive-loci.json | 22301 ++++++++++++++++++++++++++++---------- 1 file changed, 16784 insertions(+), 5517 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 065429f7..fb5ab915 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -1,5586 +1,16853 @@ [ -{ - "id": "OPDM5_ABCD3", - "disease_id": "OPDM5", - "gene": "ABCD3", - "evidence": ["Moderate"], - "chrom": "chr1", - "start_hg38": 94418421, - "stop_hg38": 94418444, - "start_hg19": 94883977, - "stop_hg19": 94884000, - "start_t2t": 94266544, - "stop_t2t": 94266567, - "disease": "Oculopharyngodistal myopathy type 5", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in individuals of European, Japanese, and Chinese ancestry [@pmid:38876750; @pmid:34047774].", - "age_onset": "Typical: 24-30; Range: 10-50 [@pmid:39068203]. Age of onset data is limited to 8 families.", - "age_onset_min": 10.0, - "age_onset_max": 50.0, - "typ_age_onset_min": 24.0, - "typ_age_onset_max": 30.0, - "details": "Characterized in eight unrelated families which were used to establish benign (3-44) and pathogenic (118-694) ranges [@pmid:39068203].", - "detection": "RP-PCR has been used for detection [@pmid:39068203]. Short-read sequencing has significantly underestimated repeat count, while long-read sequencing has accurately resolved size [@pmid:39068203].", - "mechanism": null, - "mechanism_detail": "Potentially over-expression of transcripts [@pmid:39068203].", - "year": "2023 [@pmid:39068203]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 3, - "benign_max": 44, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 118, - "pathogenic_max": 694, - "motif_len": 3, - "ref_copies": 7.7, - "novel": "ref", - "gard": ["12592"], - "genereviews": [], - "malacard": [], - "medgen": ["320250"], - "mondo": ["0025193"], - "omim": [], - "orphanet": ["98897"], - "gnomad": ["ABCD3"], - "stripy": [], - "tr_atlas": ["TR5671"], - "webstr_hg38": ["1164141", "6329150"], - "webstr_hg19": ["STR_58687"], - "locus_tags": [], - "disease_tags": ["oculopharyngodistal_myopathy"], - "references": ["pmid:39068203", "pmid:38876750", "pmid:34047774", "mondo:0025193"], - "additional_literature": ["pmid:41959811", "pmid:41792844", "pmid:40645757"] -}, -{ - "id": "FRAXE_AFF2", - "disease_id": "FRAXE", - "gene": "AFF2", - "evidence": ["Definitive"], - "chrom": "chrX", - "start_hg38": 148500604, - "stop_hg38": 148500753, - "start_hg19": 147582124, - "stop_hg19": 147582273, - "start_t2t": 146765190, - "stop_t2t": 146765342, - "disease": "Intellectual developmental disorder, Fragile X intellectual disability", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659].", - "hpo_terms": ["HP:0000718 Aggressive behavior", "HP:0000713 Agitation", "HP:0000729 Autistic behavior", "HP:0002312 Clumsiness", "HP:0000722 Compulsive behaviors", "HP:0000750 Delayed speech and language development", "HP:0001249 Intellectual disability"], - "prevalence": "2/50000", - "prevalence_details": "1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464].", - "age_onset": "Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548].", - "age_onset_min": 1.0, - "age_onset_max": 10.0, - "typ_age_onset_min": 2.0, - "typ_age_onset_max": 10.0, - "details": "Allele ranges (benign:4-39; pathogenic: >200) inferred from The Human Gene Mutation Database [@genereviews:NBK535148]. Intermediate alleles correspond to a premutation [@pmid:23914978]. Non-canonical motifs include: CGG/CCT/GTG/CAG/CTG3 [@pmid:35245110; @pmid:34111553].", - "detection": "RP-PCR has been used to detect expansions and size alleles to ~80 repeats, while Southern blotting has sized full expansions and detected methylation using Notl, a methylation-sensitive restriction enzyme [@pmid:34282157].", - "mechanism": "LoF", - "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", - "year": "1993 [@pmid:8334699]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 39, - "intermediate_min": 40, - "intermediate_max": 200, - "pathogenic_min": 201, - "pathogenic_max": 2000, - "motif_len": 3, - "ref_copies": 50.3, - "novel": "ref", - "gard": ["2378"], - "genereviews": ["NBK535148"], - "malacard": ["INT399"], - "medgen": ["155512"], - "mondo": ["0010659"], - "omim": ["309548"], - "orphanet": ["100973"], - "gnomad": ["AFF2"], - "stripy": ["AFF2"], - "tr_atlas": ["TR173976"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "length_affects_penetrance", "length_affects_severity"], - "disease_tags": [], - "references": ["pmid:11246464", "omim:309548", "pmid:16205714", "pmid:36169768", "genereviews:NBK535148", "pmid:23914978", "pmid:35245110", "pmid:34111553", "url:medlineplus.gov/genetics/condition/fragile-xe-syndrome", "pmid:8334699", "mondo:0010659"], - "additional_literature": ["pmid:41074692", "pmid:40708890", "pmid:35431806", "pmid:28812997", "pmid:25171808", "pmid:24763282", "pmid:22718980", "pmid:21739600", "pmid:21254876", "pmid:21051337", "pmid:17635840", "pmid:17516099", "pmid:16469443", "pmid:11119302", "pmid:10780779", "pmid:10674158", "pmid:10424820", "pmid:9630071", "pmid:9415475", "pmid:9415473", "pmid:9341861", "pmid:8808600", "pmid:8844091", "pmid:8755928", "pmid:8673086", "pmid:7541938", "pmid:7783163", "pmid:7881407", "pmid:7977354", "pmid:8023854", "pmid:8162055", "pmid:8118462"] -}, -{ - "id": "FRA2A_AFF3", - "disease_id": "FRA2A", - "gene": "AFF3", - "evidence": ["Definitive"], - "chrom": "chr2", - "start_hg38": 100104798, - "stop_hg38": 100104824, - "start_hg19": 100721260, - "stop_hg19": 100721286, - "start_t2t": 100563685, - "stop_t2t": 100563738, - "disease": "Intellectual disability associated with fragile site FRA2A", - "inheritance": ["AD"], - "association_type": ["Mendelian", "Risk"], - "disease_description": "These expansions are associated with intellectual disability and clinical phenotypes such as delayed motor development or delays in speech/language [@pmid:24763282].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "1/862 (1/654-1266) population prevalence of methylated AFF3 expansions (mild cognitive disability) [@pmid:39313615]. Disease cases observed in South Australia [@pmid:24763282].", - "age_onset": "Early childhood (small sample size) [@pmid:24763282].", - "age_onset_min": 1.0, - "age_onset_max": 7.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Allele ranges established in study of 3 families; intermediate alleles likely premutations [@pmid:24763282]. Pathogenic threshold may be higher than 300 as this was the largest allele that could be accurately sized by the assay.", - "detection": "Standard PCR has detected small alleles, while RP-PCR and Southern blotting have detected large expansions. Short-read sequencing may underestimate the size of large expansions and exact sizing usually uses long-read sequencing [@pmid:24763282; @pmid:39313615].", - "mechanism": "LoF/methylation", - "mechanism_detail": "Silencing of the FMR2 gene as a consequence of a CCG expansion located upstream of this gene [@malacard:KNS007].", - "year": "2014 [@pmid:24763282]", - "location_in_gene": "Intron 3", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 3, - "benign_max": 20, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 300, - "pathogenic_max": 300, - "motif_len": 3, - "ref_copies": 8.7, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": ["KNS007"], - "medgen": [], - "mondo": [], - "omim": ["601464"], - "orphanet": [], - "gnomad": ["AFF3"], - "stripy": [], - "tr_atlas": ["TR252468"], - "webstr_hg38": ["288936"], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:24763282", "malacard:KNS007", "pmid:39313615"], - "additional_literature": ["pmid:40417743", "pmid:37205357"] -}, -{ - "id": "SBMA_AR", - "disease_id": "SBMA", - "gene": "AR", - "evidence": ["Definitive"], - "chrom": "chrX", - "start_hg38": 67545316, - "stop_hg38": 67545419, - "start_hg19": 66765158, - "stop_hg19": 66765261, - "start_t2t": 65975147, - "stop_t2t": 65975250, - "disease": "Spinal and bulbar muscular atrophy, Kennedy Disease", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting [@mondo:0010735].", - "hpo_terms": null, - "prevalence": "1/30000", - "prevalence_details": "1-2/100,000 (population-specific, higher in Finnish population, Canadian population) [@pmid:37628685]; 1/30,000 [@orphanet:481]; mutation frequency of 1:3182 10x more frequent than reported disease prevalence of 1 in 30,000 [@pmid:36797998]. Only documented in patients with European/Asian ancestry, including Scandinavian, English, Belgian, French, Italian, German, Polish, Spanish, Swiss, Moroccan, Turkish, Chinese, Japanese (more common because of a founder effect), East Indian (potentially related to Japanese founder mutation) [@pmid:37578398], Korean, and Vietnamese populations [@genereviews:NBK1333].", - "age_onset": "Typical: 20-49 [@pmid:11436124], Range: 8 [@pmid:15851746] - 83 [@doi:10.17161/2tmg0f25].", - "age_onset_min": 8.0, - "age_onset_max": 83.0, - "typ_age_onset_min": 20.0, - "typ_age_onset_max": 49.0, - "details": "Intermediate alleles indicate reduced penetrance [@genereviews:NBK1333]. Expansions larger than the pathogenic threshold in the AR gene should be evaluated carefully. Interruptions have not been observed in patient cases; it has been proposed that longer alleles with interruptions may not be pathogenic [@pmid:24041967]. Non-canonical motif CAA observed [@pmid:35245110]. Expansions are also detected ten-fold more often in a general population than would be expected by disease prevalence [@pmid:36797998]. Clinical evaluation and phenotypic matching may be necessary to determine diagnosis even in the presence of a pure expanded allele. It has been proposed that contractions may play a role in disease [@pmid:10398229]. Disease may be subclinical in females [@pmid:34922802], and can be clinically heterogeneous even within the same family [@pmid:20184516].", - "detection": "Although short-read sequencing screens have been used to detect this expansion [@pmid:36797998], sizing is generally validated with standard PCR fragment analysis or RP-PCR [@genereviews:NBK1333].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine alters protein conformation leading to gain-of-function neurodegeneration [@pmid:29398703; @pmid:36169768]. Transcriptional dysregulation, axonal transport disruption, and mitochondrial dysfunction also play causative roles in the neurodegeneration [@pmid:22609045].", - "year": "1991 [@pmid:2062380]; the first triplet disease to be discovered [@pmid:15313856]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCA"], - "pathogenic_motif_reference_orientation": ["GCA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 9, - "benign_max": 34, - "intermediate_min": 36, - "intermediate_max": 37, - "pathogenic_min": 38, - "pathogenic_max": 68, - "motif_len": 3, - "ref_copies": 34.0, - "novel": "ref", - "gard": ["6818"], - "genereviews": ["NBK1333"], - "malacard": ["SPN404"], - "medgen": ["333282"], - "mondo": ["0010735"], - "omim": ["313200"], - "orphanet": ["481"], - "gnomad": ["AR"], - "stripy": ["AR"], - "tr_atlas": ["TR169377"], - "webstr_hg38": ["859199"], - "webstr_hg19": [], - "locus_tags": ["contraction", "somatic_instability", "anticipation", "paternal_expansion", "length_affects_severity", "length_affects_penetrance", "length_affects_onset"], - "disease_tags": [], - "references": ["pmid:11436124", "pmid:15851746", "doi:10.17161/2tmg0f25", "pmid:29398703", "pmid:36169768", "pmid:22609045", "genereviews:NBK1333", "pmid:24041967", "pmid:35245110", "pmid:36797998", "pmid:10398229", "pmid:34922802", "pmid:20184516", "pmid:37628685", "orphanet:481", "pmid:37578398", "pmid:2062380", "pmid:15313856", "mondo:0010735"], - "additional_literature": ["pmid:42196324", "pmid:42138244", "pmid:42070078", "pmid:42067676", "pmid:41762523", "pmid:41564929", "pmid:41552385", "pmid:41513898", "pmid:41361869", "pmid:41246945", "pmid:40912964", "pmid:40614362", "pmid:40585427", "pmid:40488202", "pmid:40450087", "pmid:40371721", "pmid:40366765", "pmid:40031964", "pmid:39755011", "pmid:39729861", "pmid:39694906", "pmid:39570490", "pmid:39189540", "pmid:39140081", "pmid:38976730", "pmid:38860410", "pmid:38737445", "pmid:38701087", "pmid:38585669", "pmid:38284836", "pmid:38171945", "pmid:37936145", "pmid:37718889", "pmid:37715620", "pmid:37422780", "pmid:37269008", "pmid:37045687", "pmid:36988133", "pmid:36717478", "pmid:36701310", "pmid:36622568", "pmid:36599645", "pmid:36585400", "pmid:36142533", "pmid:36137740", "pmid:35982373", "pmid:35876459", "pmid:35872088", "pmid:35867854", "pmid:35661131", "pmid:35599735", "pmid:35571498", "pmid:35237894", "pmid:35230239", "pmid:35189449", "pmid:35182509", "pmid:35165376", "pmid:34914563", "pmid:34744823", "pmid:34723064", "pmid:34407295", "pmid:34390226", "pmid:34372915", "pmid:34006154", "pmid:33865179", "pmid:33738134", "pmid:33714752", "pmid:33261594", "pmid:33191626", "pmid:32989102", "pmid:32856855", "pmid:32468478", "pmid:32216057", "pmid:32166698", "pmid:32152060", "pmid:32070397", "pmid:31901908", "pmid:31522753", "pmid:31446215", "pmid:31303548", "pmid:31179189", "pmid:31040020", "pmid:31030566", "pmid:31019916", "pmid:30940675", "pmid:30886222", "pmid:30838350", "pmid:30837566", "pmid:30615214", "pmid:30612224", "pmid:30415810", "pmid:30351503", "pmid:30314815", "pmid:30247609", "pmid:30206564", "pmid:30206283", "pmid:30156935", "pmid:30156032", "pmid:30139231", "pmid:30120431", "pmid:30043577", "pmid:30019487", "pmid:30019104", "pmid:29914823", "pmid:29886316", "pmid:29809168", "pmid:29714466", "pmid:29706560", "pmid:29571584", "pmid:29556396", "pmid:29464380", "pmid:29364557", "pmid:29299905", "pmid:29249939", "pmid:28963363", "pmid:28915409", "pmid:28780536", "pmid:28585930", "pmid:28511915", "pmid:28367605", "pmid:28295444", "pmid:27873769", "pmid:27807533", "pmid:27669432", "pmid:27634944", "pmid:27517091", "pmid:27251588", "pmid:27193223", "pmid:27066582", "pmid:26872663", "pmid:26772404", "pmid:26691666", "pmid:26541420", "pmid:26511871", "pmid:26499105", "pmid:26410037", "pmid:26406407", "pmid:26355245", "pmid:26345963", "pmid:26298608", "pmid:26266536", "pmid:26246877", "pmid:26221130", "pmid:26043854", "pmid:25979597", "pmid:25925349", "pmid:25889790", "pmid:25828775", "pmid:25746115", "pmid:25665908", "pmid:25637315", "pmid:25536734", "pmid:25520876", "pmid:25514102", "pmid:25455261", "pmid:25230321", "pmid:25217983", "pmid:25148265", "pmid:25122660", "pmid:25078280", "pmid:25047668", "pmid:25027083", "pmid:24974051", "pmid:24966714", "pmid:24925673", "pmid:24925468", "pmid:24872216", "pmid:24824408", "pmid:24793825", "pmid:24742458", "pmid:24711544", "pmid:24691874", "pmid:24581183", "pmid:24566949", "pmid:24391916", "pmid:24274329", "pmid:24256885", "pmid:24200287", "pmid:24120273", "pmid:23799424", "pmid:23789051", "pmid:23732677", "pmid:23679084", "pmid:23545426", "pmid:23515294", "pmid:23467468", "pmid:23441776", "pmid:23388696", "pmid:23377847", "pmid:23364790", "pmid:23359804", "pmid:23272232", "pmid:23184046", "pmid:23167717", "pmid:23136466", "pmid:23062703", "pmid:22941760", "pmid:22819977", "pmid:22792352", "pmid:22765868", "pmid:22736030", "pmid:22731640", "pmid:22653589", "pmid:22652498", "pmid:24052720", "pmid:22333840", "pmid:22233359", "pmid:22107839", "pmid:22068615", "pmid:22038041", "pmid:22025404", "pmid:21977989", "pmid:21664238", "pmid:21643744", "pmid:21642359", "pmid:21486420", "pmid:21445561", "pmid:21410629", "pmid:21270324", "pmid:21247881", "pmid:21089003", "pmid:20880698", "pmid:20689246", "pmid:20425835", "pmid:20353269", "pmid:20233785", "pmid:20127024", "pmid:20063560", "pmid:19956434", "pmid:19818997", "pmid:19692580", "pmid:19684044", "pmid:19497852", "pmid:19482445", "pmid:19237573", "pmid:19228953", "pmid:19218788", "pmid:19211034", "pmid:19207614", "pmid:19100835", "pmid:19095061", "pmid:19062046", "pmid:18962445", "pmid:18783352", "pmid:18762554", "pmid:18645714", "pmid:18642379", "pmid:18624843", "pmid:18610651", "pmid:18592136", "pmid:18446630", "pmid:18365230", "pmid:18323476", "pmid:18222439", "pmid:18217192", "pmid:18191848", "pmid:18181049", "pmid:18097504", "pmid:17997416", "pmid:17984450", "pmid:17984063", "pmid:17979523", "pmid:17854832", "pmid:17852020", "pmid:17825390", "pmid:17635942", "pmid:17556727", "pmid:17507624", "pmid:17507457", "pmid:17465263", "pmid:17440439", "pmid:17431729", "pmid:17372242", "pmid:17321486", "pmid:17230529", "pmid:17161354", "pmid:17137601", "pmid:17027356", "pmid:16859836", "pmid:16847812", "pmid:16817826", "pmid:16813680", "pmid:16804045", "pmid:16793958", "pmid:16772330", "pmid:16696857", "pmid:16621916", "pmid:16515589", "pmid:16493814", "pmid:16462497", "pmid:16448271", "pmid:16437189", "pmid:16425097", "pmid:16403814", "pmid:16377095", "pmid:16365010", "pmid:16358333", "pmid:16299230", "pmid:16187285", "pmid:16117826", "pmid:16008071", "pmid:15956082", "pmid:15954500", "pmid:15952987", "pmid:15950642", "pmid:15876692", "pmid:15824176", "pmid:15747808", "pmid:15725470", "pmid:15721279", "pmid:15659427", "pmid:15609126", "pmid:15599941", "pmid:15570555", "pmid:15545219", "pmid:15472213", "pmid:15366384", "pmid:15358199", "pmid:15341991", "pmid:15310009", "pmid:15198988", "pmid:15146455", "pmid:15120698", "pmid:15044606", "pmid:15003169", "pmid:14974917", "pmid:14973115", "pmid:14731580", "pmid:14698481", "pmid:14693242", "pmid:14691592", "pmid:14674723", "pmid:14605819", "pmid:14585317", "pmid:14511217", "pmid:14506156", "pmid:12898143", "pmid:12860943", "pmid:12767946", "pmid:12755998", "pmid:12714591", "pmid:12670590", "pmid:12634316", "pmid:12632109", "pmid:12602915", "pmid:12542725", "pmid:12534937", "pmid:12478141", "pmid:12404104", "pmid:12388541", "pmid:12385020", "pmid:12376473", "pmid:12220434", "pmid:12189490", "pmid:12189162", "pmid:12085360", "pmid:12042281", "pmid:12031042", "pmid:11956643", "pmid:11935317", "pmid:11927493", "pmid:11894978", "pmid:11875046", "pmid:11847524", "pmid:11810651", "pmid:11809726", "pmid:11788641", "pmid:11721964", "pmid:11720249", "pmid:11701709", "pmid:11600555", "pmid:11571732", "pmid:11571725", "pmid:11550169", "pmid:11494335", "pmid:11473958", "pmid:11443190", "pmid:11368874", "pmid:11331662", "pmid:11330644", "pmid:11266016", "pmid:11259089", "pmid:11167027", "pmid:11121465", "pmid:11016637", "pmid:10999852", "pmid:10958659", "pmid:10956560", "pmid:10852984", "pmid:10821498", "pmid:10817350", "pmid:10794490", "pmid:10732798", "pmid:10732754", "pmid:10717532", "pmid:10717003", "pmid:10656235", "pmid:10643885", "pmid:10637497", "pmid:10617922", "pmid:10574254", "pmid:10564878", "pmid:10544298", "pmid:10486315", "pmid:10419869", "pmid:10400640", "pmid:10323251", "pmid:10234512", "pmid:9925917", "pmid:9886069", "pmid:9880240", "pmid:9815849", "pmid:9813160", "pmid:9761394", "pmid:9732460", "pmid:9731888", "pmid:9692387", "pmid:9677254", "pmid:9580659", "pmid:9499423", "pmid:9382110", "pmid:9270598", "pmid:9094973", "pmid:9020849", "pmid:8960833", "pmid:8954049", "pmid:8878435", "pmid:8737374", "pmid:8926495", "pmid:8807333", "pmid:8645957", "pmid:7772520", "pmid:7757084", "pmid:7719348", "pmid:8065934", "pmid:7951325", "pmid:7515106", "pmid:8232348", "pmid:1461383", "pmid:1734865"] -}, -{ - "id": "EIEE1_ARX", - "disease_id": "EIEE1", - "gene": "ARX", - "evidence": ["Definitive"], - "chrom": "chrX", - "start_hg38": 25013649, - "stop_hg38": 25013697, - "start_hg19": 25031766, - "stop_hg19": 25031814, - "start_t2t": 24597886, - "stop_t2t": 24597934, - "disease": "Early-infantile epileptic encephalopathy", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "Developmental and epileptic encephalopathy-1 (DEE1) is a severe form of epilepsy characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, characterized by high-voltage bursts alternating with almost flat suppression phases [@omim:308350].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in individuals of multiple ethnicities, including European and Asian ancestry [@pmid:12874418].", - "age_onset": "Typical: 0 [@pmid:21204215; @pmid:9307258]; Range: 0-4; 70% of cases involve infantile spasms, leading to seizures by 3 or 4 years [@pmid:19587282].", - "age_onset_min": 0.0, - "age_onset_max": 4.0, - "typ_age_onset_min": 0.0, - "typ_age_onset_max": 0.0, - "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", - "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:17668384].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", - "year": "2002 [@pmid:11889467]", - "location_in_gene": "Coding Exon 2, aa 110-115", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 16, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 17, - "pathogenic_max": 27, - "motif_len": 3, - "ref_copies": 14.7, - "novel": "ref", - "gard": ["15298"], - "genereviews": ["NBK535148"], - "malacard": ["ERL057"], - "medgen": ["483052"], - "mondo": ["0010632"], - "omim": ["308350", "300419", "300215"], - "orphanet": ["182079"], - "gnomad": ["ARX_1"], - "stripy": ["ARX_1"], - "tr_atlas": ["TR167317"], - "webstr_hg38": ["843651"], - "webstr_hg19": ["STR_1542607"], - "locus_tags": ["length_affects_phenotype"], - "disease_tags": ["phenotypic_spectrum"], - "references": ["pmid:21204215", "pmid:9307258", "pmid:19587282", "pmid:36169768", "pmid:38467784", "genereviews:NBK51932", "genereviews:NBK535148", "omim:309510", "omim:308350", "omim:300004", "omim:300215", "pmid:26029707", "pmid:20506206", "pmid:12874418", "pmid:11889467"], - "additional_literature": ["pmid:40608247", "pmid:39933386", "pmid:39123069", "pmid:36571524", "pmid:33847015", "pmid:32033960", "pmid:28627419", "pmid:28602636", "pmid:27798109", "pmid:26571108", "pmid:25171319", "pmid:24236044", "pmid:23968833", "pmid:23246292", "pmid:22628459", "pmid:22108177", "pmid:20376468", "pmid:19018235", "pmid:18823727", "pmid:18462864", "pmid:17668384", "pmid:17664401", "pmid:17480217", "pmid:15533998"] -}, -{ - "id": "PRTS_ARX", - "disease_id": "PRTS", - "gene": "ARX", - "evidence": ["Definitive"], - "chrom": "chrX", - "start_hg38": 25013529, - "stop_hg38": 25013565, - "start_hg19": 25031646, - "stop_hg19": 25031682, - "start_t2t": 24597766, - "stop_t2t": 24597802, - "disease": "Partington syndrome", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "A rare neurological condition that is primarily characterized by mild to moderate intellectual disability and dystonia of the hands. Other signs and symptoms may include dysarthria, behavioral abnormalities, recurrent seizures and/or an unusual gait (style of walking). Partington syndrome usually occurs in males; when it occurs in females, the signs and symptoms are often less severe. It is caused by changes (mutations) in the ARX gene and is inherited in an X-linked recessive manner. Treatment is based on the signs and symptoms present in each person [@mondo:0010654].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Limited clinical cases of predominantly European ancestry, such as Welsh/Belgian [@omim:309510].", - "age_onset": "Typical: 1-3; Range: 0-4. Mild phenotypes can make diagnosis difficult (expansions are particularly mild/absent in females) [@omim:309510].", - "age_onset_min": 0.0, - "age_onset_max": 4.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", - "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:11889467].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", - "year": "2002 [@pmid:11889467]", - "location_in_gene": "Coding Exon 2, aa 144-155", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 12, - "benign_max": 12, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 20, - "pathogenic_max": 20, - "motif_len": 3, - "ref_copies": 12.0, - "novel": "ref", - "gard": ["4235"], - "genereviews": ["NBK535148"], - "malacard": ["PRT003"], - "medgen": ["163237"], - "mondo": ["0010654"], - "omim": ["309510"], - "orphanet": ["94083"], - "gnomad": ["ARX_2"], - "stripy": ["ARX_2"], - "tr_atlas": ["TR167316"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": ["length_affects_phenotype"], - "disease_tags": ["phenotypic_spectrum"], - "references": ["omim:309510", "pmid:36169768", "pmid:38467784", "genereviews:NBK51932", "genereviews:NBK535148", "omim:308350", "omim:300004", "omim:300215", "pmid:26029707", "pmid:20506206", "pmid:11889467", "mondo:0010654"], - "additional_literature": ["pmid:40608247", "pmid:39933386", "pmid:39123069", "pmid:36571524", "pmid:33847015", "pmid:32033960", "pmid:28627419", "pmid:28602636", "pmid:27798109", "pmid:26571108", "pmid:25171319", "pmid:24236044", "pmid:23968833", "pmid:23246292", "pmid:22628459", "pmid:22108177", "pmid:21204215", "pmid:20376468", "pmid:19587282", "pmid:19018235", "pmid:18823727", "pmid:18462864", "pmid:17668384", "pmid:17664401", "pmid:17480217", "pmid:15533998", "pmid:12874418"] -}, -{ - "id": "DRPLA_ATN1", - "disease_id": "DRPLA", - "gene": "ATN1", - "evidence": ["Definitive"], - "chrom": "chr12", - "start_hg38": 6936716, - "stop_hg38": 6936775, - "start_hg19": 7045879, - "stop_hg19": 7045938, - "start_t2t": 6947903, - "stop_t2t": 6947941, - "disease": "Dentatorubral-Pallidoluysian Atrophy", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Dentatorubral pallidoluysian atrophy (DRPLA) is a rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by involuntary movements, ataxia, epilepsy, mental disorders, cognitive decline and prominent anticipation [@mondo:0007435]. Epilepsy is common in earlier onset cases [@pmid:41147955].", - "hpo_terms": null, - "prevalence": "4.5/1000000", - "prevalence_details": "2-7/1,000,000. More prevalent in Japanese populations; also reported in North America, South America, Europe, and Australia [@genereviews:NBK1491].", - "age_onset": "Typical: 20-40 [@pmid:6808417; @genereviews:NBK1491]. Range: 0 [@pmid:11160976] - 72 [@genereviews:NBK1491].", - "age_onset_min": 0.0, - "age_onset_max": 72.0, - "typ_age_onset_min": 20.0, - "typ_age_onset_max": 40.0, - "details": "Pathogenic expansions (48-93) are fully penetrant with the exception of one documented case of 51 repeats; intermediate alleles (36-47) are associated with a milder phenotype and can expand upon transmission [@genereviews:NBK1491]. CAA interruptions have been observed without known clinical association [@pmid:35245110]. Length of the repeat is inversely associated with age of onset and severe epilepsy phenotype [@pmid:41147955].", - "detection": "PCR fragment analysis has detected most moderate alleles, but Southern blotting or RP-PCR have been used in cases of large expansions or when PCR shows an apparently homozygous small allele, to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1491].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansions leading to gain of function [@genereviews:NBK1491].", - "year": "1994 [@pmid:7842016]", - "location_in_gene": "Coding Exon 5", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 35, - "intermediate_min": 36, - "intermediate_max": 47, - "pathogenic_min": 48, - "pathogenic_max": 93, - "motif_len": 3, - "ref_copies": 19.0, - "novel": "ref", - "gard": ["5643"], - "genereviews": ["NBK1491"], - "malacard": ["DNT005"], - "medgen": ["155630"], - "mondo": ["0007435"], - "omim": ["125370"], - "orphanet": ["101"], - "gnomad": ["ATN1"], - "stripy": ["ATN1"], - "tr_atlas": ["TR114246"], - "webstr_hg38": ["5050156"], - "webstr_hg19": ["Expansion_ATN1/DRPLA"], - "locus_tags": ["anticipation", "somatic_instability", "paternal_expansion", "length_affects_onset", "length_affects_severity", "length_affects_phenotype"], - "disease_tags": ["ataxia", "epilepsy"], - "references": ["pmid:6808417", "genereviews:NBK1491", "pmid:11160976", "pmid:35245110", "pmid:41147955", "pmid:7842016", "mondo:0007435"], - "additional_literature": ["pmid:42196324", "pmid:41624332", "pmid:41355374", "pmid:41254939", "pmid:41082794", "pmid:40832356", "pmid:40488180", "pmid:40450087", "pmid:40340521", "pmid:40298952", "pmid:40263757", "pmid:40237283", "pmid:39820777", "pmid:39812846", "pmid:39742457", "pmid:39224955", "pmid:38961870", "pmid:38227102", "pmid:38152578", "pmid:37243799", "pmid:36599645", "pmid:36530930", "pmid:35182509", "pmid:34968706", "pmid:34022586", "pmid:33106889", "pmid:32711193", "pmid:32675418", "pmid:32129252", "pmid:31493762", "pmid:30891880", "pmid:30827498", "pmid:30615214", "pmid:30314815", "pmid:30120431", "pmid:29801887", "pmid:29715545", "pmid:29249939", "pmid:28782341", "pmid:28585930", "pmid:27896316", "pmid:27400454", "pmid:26374734", "pmid:26077168", "pmid:25842919", "pmid:25466696", "pmid:24972706", "pmid:24534762", "pmid:23933208", "pmid:23364790", "pmid:23263592", "pmid:23026538", "pmid:22527233", "pmid:22520093", "pmid:22342974", "pmid:22297462", "pmid:21108634", "pmid:20589872", "pmid:19429075", "pmid:19370769", "pmid:19259763", "pmid:19039037", "pmid:18182848", "pmid:17965145", "pmid:17961920", "pmid:17420317", "pmid:16967484", "pmid:16858508", "pmid:16251216", "pmid:16199124", "pmid:15553088", "pmid:15223312", "pmid:15148151", "pmid:15133824", "pmid:14756671", "pmid:12925365", "pmid:12805114", "pmid:12764052", "pmid:12614315", "pmid:12235319", "pmid:12042281", "pmid:11939898", "pmid:11807410", "pmid:11711886", "pmid:11709002", "pmid:11689158", "pmid:11574112", "pmid:11198291", "pmid:10942107", "pmid:10894992", "pmid:10814707", "pmid:10768629", "pmid:10766906", "pmid:10677044", "pmid:10564878", "pmid:10515170", "pmid:10486315", "pmid:10453742", "pmid:10332026", "pmid:10085113", "pmid:10084125", "pmid:9949204", "pmid:9887337", "pmid:9758625", "pmid:9705838", "pmid:9696528", "pmid:9647693", "pmid:9613852", "pmid:9507387", "pmid:9462738", "pmid:9385362", "pmid:9361003", "pmid:9187480", "pmid:9124808", "pmid:9109905", "pmid:9106530", "pmid:9050922", "pmid:9020849", "pmid:8962095", "pmid:9001798", "pmid:8651298", "pmid:8655136", "pmid:8780110", "pmid:8644735", "pmid:8852663", "pmid:8926495", "pmid:8559378", "pmid:8557266", "pmid:7633415", "pmid:7868125", "pmid:7824105", "pmid:7885531", "pmid:8136840", "pmid:8136826", "pmid:7734112"] -}, -{ - "id": "SCA1_ATXN1", - "disease_id": "SCA1", - "gene": "ATXN1", - "evidence": ["Definitive"], - "chrom": "chr6", - "start_hg38": 16327633, - "stop_hg38": 16327724, - "start_hg19": 16327864, - "stop_hg19": 16327955, - "start_t2t": 16200188, - "stop_t2t": 16200282, - "disease": "Spinocerebellar ataxia type 1", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 1 (SCA1) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by dysarthria, writing difficulties, limb ataxia, and commonly nystagmus and saccadic abnormalities [@mondo:0008119].", - "hpo_terms": null, - "prevalence": "1.5/100000", - "prevalence_details": "1-2/100,000. Cases have been reported worldwide, although prevalence varies by ancestry/ethnicity [@genereviews:NBK1184].", - "age_onset": "Typical: 20-39 [@url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias]; Range: 6 [@pmid:3165612] - 63 [@pmid:8825276].", - "age_onset_min": 6.0, - "age_onset_max": 63.0, - "typ_age_onset_min": 20.0, - "typ_age_onset_max": 39.0, - "details": "Penetrance is dependent on sequence purity in addition to expansion length: pure repeats are pathogenic at 39 repeats [@pmid:37906407], while CAT interruptions [@pmid:35245110] can lead to reduced penetrance at comparable lengths [@genereviews:NBK1184]. Regardless, intermediate alleles are considered premutations which may lead to disease upon transmission [@genereviews:NBK1184]. CAA interruptions have also been reported, but not linked to any phenotypic consequences [@pmid:23935513].", - "detection": "PCR fragment analysis is commonly used for sizing [@genereviews:NBK1184]. Standard fragment analysis does not resolve CAT interruptions, which require targeted analysis like RP-PCR or Sanger sequencing [@pmid:34635619; @genereviews:NBK1184].", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyglutamine expansion leading to toxic gain of function with eventual misregulation-based loss of function/dominant negative [@genereviews:NBK1184; @pmid:35573049].", - "year": "1993 [@pmid:8358429]", - "location_in_gene": "Coding Exon 8", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CTG"], - "pathogenic_motif_reference_orientation": ["CTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["ATG", "TTG"], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["ATC", "AAC"], - "locus_structure": [], - "benign_min": 6, - "benign_max": 35, - "intermediate_min": 36, - "intermediate_max": 38, - "pathogenic_min": 39, - "pathogenic_max": 91, - "motif_len": 3, - "ref_copies": 30.3, - "novel": "ref", - "gard": ["4071"], - "genereviews": ["NBK1184"], - "malacard": ["SPN294"], - "medgen": ["155703"], - "mondo": ["0008119"], - "omim": ["164400"], - "orphanet": ["98755"], - "gnomad": ["ATXN1"], - "stripy": ["ATXN1"], - "tr_atlas": ["TR63118"], - "webstr_hg38": ["5767842"], - "webstr_hg19": ["Expansion_SCA1/ATXN1"], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_severity", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance", "motif_affects_severity"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias", "pmid:3165612", "pmid:8825276", "genereviews:NBK1184", "pmid:35573049", "pmid:37906407", "pmid:35245110", "pmid:23935513", "pmid:8358429", "mondo:0008119"], - "additional_literature": ["pmid:42196324", "pmid:41727128", "pmid:41435767", "pmid:41426430", "pmid:41254939", "pmid:41149812", "pmid:40900235", "pmid:40488180", "pmid:40450087", "pmid:39820777", "pmid:39456985", "pmid:39289638", "pmid:39211226", "pmid:38961870", "pmid:38626762", "pmid:38585669", "pmid:38308084", "pmid:38125008", "pmid:37827155", "pmid:37776516", "pmid:37397792", "pmid:37146135", "pmid:37043475", "pmid:36599645", "pmid:36549973", "pmid:36291186", "pmid:35869263", "pmid:35525134", "pmid:35182509", "pmid:34830553", "pmid:34635619", "pmid:34600502", "pmid:34372915", "pmid:34179866", "pmid:33502644", "pmid:33276461", "pmid:33159825", "pmid:32954321", "pmid:32761094", "pmid:32580238", "pmid:32339968", "pmid:31940111", "pmid:31810584", "pmid:31645175", "pmid:30891880", "pmid:30729852", "pmid:30615214", "pmid:30324307", "pmid:30314815", "pmid:30120431", "pmid:30108484", "pmid:29845242", "pmid:29656178", "pmid:29497168", "pmid:29274668", "pmid:29249939", "pmid:29057148", "pmid:28585930", "pmid:28444220", "pmid:26077168", "pmid:25595967", "pmid:25344417", "pmid:25255716", "pmid:24972706", "pmid:24594842", "pmid:24534762", "pmid:23197749", "pmid:22884877", "pmid:18337722", "pmid:18301861", "pmid:17961920", "pmid:17420317", "pmid:17116127", "pmid:15300851"] -}, -{ - "id": "SCA10_ATXN10", - "disease_id": "SCA10", - "gene": "ATXN10", - "evidence": ["Definitive"], - "chrom": "chr22", - "start_hg38": 45795354, - "stop_hg38": 45795424, - "start_hg19": 46191234, - "stop_hg19": 46191304, - "start_t2t": 46280059, - "stop_t2t": 46280134, - "disease": "Spinocerebellar ataxia type 10", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 10 (SCA10) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by slowly progressive cerebellar syndrome and epilepsy, sometimes mild pyramidal signs, peripheral neuropathy and neuropsychological disturbances [@mondo:0011330].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Unknown prevalence, >300 individuals. Cases have been identified in Mexico, Brazil, China, and Japan [@genereviews:NBK1175].", - "age_onset": "Typical: 12-48; Range: 11-83 [@genereviews:NBK1175].", - "age_onset_min": 11.0, - "age_onset_max": 83.0, - "typ_age_onset_min": 12.0, - "typ_age_onset_max": 48.0, - "details": "Unaffected individuals are usually (82%) compound heterozygotes in the benign range [@genereviews:NBK1175]. Intermediate alleles show reduced penetrance, and exact distinction between intermediate and the lower end of the pathogenic range is unclear [@genereviews:NBK1175]. Expansions are frequently interrupted by ATCCT, ATCCC, ATTCC, ATTTCT, ATATTCT, or ATTCTTCT; interruptions of ATTGT, TTTCT, ATTTTCT, ATTCTCT, GTTTCT, CTTCT, and ATTCTAT have been noted [@pmid:36199580] as has the interruption ATGCT [@pmid:19234597]. The ATCCT interruption motif is associated with a higher prevalence of epileptic seizures [@pmid:24318420]. Different motif patterns and mixed motif ratios may influence age of onset and anticipation [@pmid:41229449]. One study suggests that alleles with completely pure ATTCT expansions are non-pathogenic, and that repeat interruptions such as ATTCC, are necessary to cause SCA10 [@pmid:36092952].", - "detection": "RP-PCR with fragment analysis is commonly used for detection. Pathogenicity depends heavily on interruptions, so long-read sequencing approaches have been used for full structure resolution [@pmid:26295943; @pmid:32160188].", - "mechanism": "GoF", - "mechanism_detail": "Transdominant mechanism theorized [@pmid:38467784].", - "year": "2000 [@pmid:11017075]", - "location_in_gene": "Intron 9", - "gene_strand": "+", - "reference_motif_reference_orientation": ["ATTCT"], - "pathogenic_motif_reference_orientation": ["ATTCT"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["ATCCT", "ATCCC", "ATTCC", "ATTTCT", "ATATTCT", "ATTCTTCT", "ATTGT", "TTTCT", "ATTTTCT", "ATTCTCT", "GTTTCT", "CTTCT", "ATGCT"], - "pathogenic_motif_gene_orientation": ["ATTCT"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["ATCCT", "ATCCC", "ATTCC", "ATTTCT", "ATATTCT", "ATTCTTCT", "ATTGT", "CTTTT", "ATTTTCT", "ATTCTCT", "CTGTTT", "CTCTT", "ATGCT"], - "locus_structure": [], - "benign_min": 10, - "benign_max": 32, - "intermediate_min": 33, - "intermediate_max": 850, - "pathogenic_min": 800, - "pathogenic_max": 4500, - "motif_len": 5, - "ref_copies": 14.0, - "novel": "ref", - "gard": ["10474"], - "genereviews": ["NBK1175"], - "malacard": ["SPN314"], - "medgen": ["369786"], - "mondo": ["0011330"], - "omim": ["603516"], - "orphanet": ["98761"], - "gnomad": ["ATXN10"], - "stripy": ["ATXN10"], - "tr_atlas": ["TR165509"], - "webstr_hg38": ["1027359", "4921433"], - "webstr_hg19": ["STR_909210"], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "motif_affects_instability", "motif_affects_penetrance", "motif_affects_phenotype"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK1175", "pmid:38467784", "pmid:36199580", "pmid:19234597", "pmid:24318420", "pmid:41229449", "pmid:36092952", "pmid:11017075", "mondo:0011330"], - "additional_literature": ["pmid:41229449", "pmid:41074692", "pmid:40900235", "pmid:40898875", "pmid:40488180", "pmid:40067487", "pmid:39820777", "pmid:38961870", "pmid:38832639", "pmid:35103298", "pmid:34970537", "pmid:33502644", "pmid:32520333", "pmid:32160188", "pmid:31737797", "pmid:31445906", "pmid:31342269", "pmid:29922950", "pmid:29316893", "pmid:28890930", "pmid:28423040", "pmid:27248057", "pmid:26374734", "pmid:26295943", "pmid:26077168", "pmid:26039897", "pmid:25466696", "pmid:24278426", "pmid:24269018", "pmid:23443018", "pmid:23083689", "pmid:23026538", "pmid:22065565", "pmid:22053702", "pmid:21282659", "pmid:20065034", "pmid:19651850", "pmid:19306311", "pmid:19171184", "pmid:19147916", "pmid:17961920", "pmid:17846122", "pmid:16924013", "pmid:16498633", "pmid:16385455", "pmid:15505178", "pmid:15201271", "pmid:15148151", "pmid:15096564", "pmid:12764052", "pmid:12589756", "pmid:11839840", "pmid:11160961", "pmid:9973298"] -}, -{ - "id": "SCA2_ATXN2", - "disease_id": "SCA2", - "gene": "ATXN2", - "evidence": ["Definitive"], - "chrom": "chr12", - "start_hg38": 111598949, - "stop_hg38": 111599019, - "start_hg19": 112036753, - "stop_hg19": 112036823, - "start_t2t": 111575873, - "stop_t2t": 111575940, - "disease": "Spinocerebellar ataxia type 2", - "inheritance": ["AD", "AR"], - "association_type": ["Mendelian", "Risk", "Modifier"], - "disease_description": "A subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by truncal ataxia, dysarthria, slowed saccades and less commonly ophthalmoparesis and chorea [@mondo:0008458].", - "hpo_terms": null, - "prevalence": "1.5/100000", - "prevalence_details": "1-2/100,000 (population-dependent) [@pmid:29100084]. Cases have been found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1275].", - "age_onset": "Typical: 30-39 [@genereviews:NBK1275]; Range: 2-86 [@omim:183090].", - "age_onset_min": 2.0, - "age_onset_max": 86.0, - "typ_age_onset_min": 30.0, - "typ_age_onset_max": 39.0, - "details": "Full penetrance of single alleles occurs at ~35 repeats [@genereviews:NBK1275; @pmid:37906407] and pathogenic expansions have been documented as large as 500 repeats [@pmid:12116207]. 33-34 length repeats are associated with reduced penetrance and later onset (age >50 years) [@genereviews:NBK1275]. Homozygous 31 repeat alleles may lead to recessive disease [@pmid:30533529], while a single 29-32 repeat is associated with increased ALS risk [@genereviews:NBK1275; @pmid:25285812; @pmid:32954321]. There is some evidence that all CAG-repeat expansions in ATXN2 may be a risk factor for ALS, regardless of length and interruptions [@pmid:39956874]. CAA interruptions have been observed which appear to stabilize the allele in transmission [@genereviews:NBK1275].", - "detection": "RP-PCR with fragment analysis is commonly used for detection, while Southern blotting is required to estimate size over 100 repeats [@genereviews:NBK1275].", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyglutamine cytoplasmic aggregates leading to cellular apoptosis; RAN translation implicated [@genereviews:NBK1275].", - "year": "1996 [@pmid:8896556]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CTG"], - "pathogenic_motif_reference_orientation": ["CTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["TTG"], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AAC"], - "locus_structure": [], - "benign_min": 14, - "benign_max": 28, - "intermediate_min": 29, - "intermediate_max": 34, - "pathogenic_min": 35, - "pathogenic_max": 500, - "motif_len": 3, - "ref_copies": 23.3, - "novel": "ref", - "gard": ["4072"], - "genereviews": ["NBK1275"], - "malacard": ["SPN301"], - "medgen": ["155704"], - "mondo": ["0008458"], - "omim": ["183090"], - "orphanet": ["98756"], - "gnomad": ["ATXN2"], - "stripy": ["ATXN2"], - "tr_atlas": ["TR120465"], - "webstr_hg38": ["598560", "5117050"], - "webstr_hg19": ["Expansion_SCA2/ATXN2"], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "maternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability", "motif_affects_phenotype", "proposed_modifier"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK1275", "omim:183090", "pmid:37906407", "pmid:12116207", "pmid:30533529", "pmid:25285812", "pmid:32954321", "pmid:39956874", "pmid:29100084", "pmid:8896556", "mondo:0008458"], - "additional_literature": ["pmid:42204920", "pmid:42196324", "pmid:42096001", "pmid:42087256", "pmid:42019185", "pmid:41912844", "pmid:41876820", "pmid:41771688", "pmid:41728197", "pmid:41693683", "pmid:41683965", "pmid:41630926", "pmid:41435767", "pmid:41426430", "pmid:41373690", "pmid:41359433", "pmid:41310328", "pmid:41298695", "pmid:41196070", "pmid:41149812", "pmid:41082794", "pmid:41077586", "pmid:41071260", "pmid:41009775", "pmid:41001200", "pmid:40908144", "pmid:40906330", "pmid:40900235", "pmid:40746751", "pmid:40684213", "pmid:40556342", "pmid:40488180", "pmid:40346885", "pmid:40220918", "pmid:40004498", "pmid:39940702", "pmid:39820777", "pmid:39812846", "pmid:39804470", "pmid:39571249", "pmid:39521966", "pmid:39512795", "pmid:39457708", "pmid:39420034", "pmid:39317855", "pmid:39209824", "pmid:39200113", "pmid:39048885", "pmid:39004246", "pmid:38961870", "pmid:38715656", "pmid:38667292", "pmid:38642323", "pmid:38626762", "pmid:38585669", "pmid:38419144", "pmid:38397958", "pmid:38340219", "pmid:38239855", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37848721", "pmid:37821389", "pmid:37397792", "pmid:37379724", "pmid:37202167", "pmid:37146135", "pmid:37070044", "pmid:37043475", "pmid:37003406", "pmid:36894829", "pmid:36823368", "pmid:36618024", "pmid:36530930", "pmid:36209056", "pmid:36008116", "pmid:35989899", "pmid:35962273", "pmid:35869263", "pmid:35787375", "pmid:35599735", "pmid:35525134", "pmid:35521889", "pmid:35297556", "pmid:35188716", "pmid:35182509", "pmid:35052497", "pmid:34565721", "pmid:34430069", "pmid:34390268", "pmid:34372915", "pmid:34350994", "pmid:34298214", "pmid:34284285", "pmid:34179866", "pmid:34168085", "pmid:34159894", "pmid:34077532", "pmid:33688396", "pmid:33625581", "pmid:33548146", "pmid:33502644", "pmid:33414559", "pmid:33377399", "pmid:33284045", "pmid:33159825", "pmid:33115537", "pmid:33070405", "pmid:33058338", "pmid:33029780", "pmid:32989102", "pmid:32932600", "pmid:32870233", "pmid:32822634", "pmid:32340607", "pmid:32307524", "pmid:32124191", "pmid:32082115", "pmid:31940111", "pmid:31898278", "pmid:31812845", "pmid:31810584", "pmid:31766565", "pmid:31619481", "pmid:31522753", "pmid:31432357", "pmid:31343735", "pmid:30920184", "pmid:30891880", "pmid:30847648", "pmid:30615214", "pmid:30611021", "pmid:30591349", "pmid:30417124", "pmid:30342765", "pmid:30342763", "pmid:30314815", "pmid:30196130", "pmid:30123518", "pmid:30120431", "pmid:29959555", "pmid:29934271", "pmid:29895397", "pmid:29848387", "pmid:29801887", "pmid:29801076", "pmid:29756284", "pmid:29715545", "pmid:29666341", "pmid:29665996", "pmid:29553382", "pmid:29497168", "pmid:29468174", "pmid:29462666", "pmid:29249939", "pmid:29080331", "pmid:29057148", "pmid:29046994", "pmid:28923333", "pmid:28782341", "pmid:28642336", "pmid:28585930", "pmid:28534046", "pmid:30363439", "pmid:28527524", "pmid:28525545", "pmid:28444220", "pmid:28263872", "pmid:28124431", "pmid:28017238", "pmid:27896316", "pmid:27848087", "pmid:27774050", "pmid:27531668", "pmid:27333979", "pmid:27245636", "pmid:26846400", "pmid:26777436", "pmid:26733254", "pmid:26599997", "pmid:26551617", "pmid:26377379", "pmid:26374734", "pmid:26362908", "pmid:26354989", "pmid:26095883", "pmid:26086378", "pmid:26077168", "pmid:26054379", "pmid:25893506", "pmid:25790475", "pmid:25721894", "pmid:25634432", "pmid:25527265", "pmid:25466696", "pmid:25189938", "pmid:25189117", "pmid:25111021", "pmid:25098532", "pmid:24972706", "pmid:24908169", "pmid:24866401", "pmid:24780882", "pmid:24780439", "pmid:24718895", "pmid:24534762", "pmid:24269018", "pmid:24209901", "pmid:23959108", "pmid:23844332", "pmid:23635656", "pmid:23634774", "pmid:23368522", "pmid:23197749", "pmid:23047744", "pmid:23026538", "pmid:22868089", "pmid:22831947", "pmid:22650353", "pmid:22520093", "pmid:22507827", "pmid:22425256", "pmid:22297462", "pmid:22053702", "pmid:22035589", "pmid:21889984", "pmid:21880993", "pmid:21832228", "pmid:21741123", "pmid:21610160", "pmid:21600833", "pmid:21562247", "pmid:21537950", "pmid:21479228", "pmid:21329459", "pmid:20960485", "pmid:20740007", "pmid:20095980", "pmid:20070987", "pmid:20069235", "pmid:22353486", "pmid:19676102", "pmid:19672991", "pmid:19473475", "pmid:19429075", "pmid:19049837", "pmid:18990604", "pmid:18759344", "pmid:18685131", "pmid:18418678", "pmid:18297329", "pmid:18182848", "pmid:18028243", "pmid:17961920", "pmid:17923635", "pmid:17712857", "pmid:17620498", "pmid:17568014", "pmid:17440947", "pmid:17420317", "pmid:16687213", "pmid:16436644", "pmid:16389595", "pmid:16000334", "pmid:15911147", "pmid:15747371", "pmid:22473187", "pmid:15553088", "pmid:15533937", "pmid:15504570", "pmid:15300851", "pmid:15265035", "pmid:15148151", "pmid:15133829", "pmid:15080863", "pmid:14967767", "pmid:14966163", "pmid:14756671", "pmid:14732617", "pmid:12853230", "pmid:12812977", "pmid:12810491", "pmid:12764052", "pmid:12682323", "pmid:12671950", "pmid:12614315", "pmid:12490063", "pmid:12235319", "pmid:12039668", "pmid:11939898", "pmid:11889231", "pmid:11839840", "pmid:11804332", "pmid:11719273", "pmid:11689490", "pmid:11591855", "pmid:11502947", "pmid:11448300", "pmid:11374096", "pmid:11160961", "pmid:10369884", "pmid:11030803", "pmid:11030410", "pmid:10953195", "pmid:10942107", "pmid:10915763", "pmid:10894992", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10642945", "pmid:10573020", "pmid:10525984", "pmid:10525976", "pmid:10453742", "pmid:10219787", "pmid:10210910", "pmid:10050970", "pmid:9973298", "pmid:9855520", "pmid:9779806", "pmid:9776463", "pmid:9762957", "pmid:9758625", "pmid:9748675", "pmid:9741408", "pmid:9710044", "pmid:9696528", "pmid:9674805", "pmid:9613852", "pmid:9588855", "pmid:9577387", "pmid:9549522", "pmid:9507387", "pmid:9436730", "pmid:9385362", "pmid:9403486", "pmid:9403480", "pmid:9339711", "pmid:9339681", "pmid:9259275", "pmid:9225982", "pmid:10735276", "pmid:9106530", "pmid:9020849", "pmid:10464657", "pmid:8968739", "pmid:8896557", "pmid:8896555", "pmid:8559378", "pmid:7477379", "pmid:7762567"] -}, -{ - "id": "SCA3_ATXN3", - "disease_id": "SCA3, MJD", - "gene": "ATXN3", - "evidence": ["Definitive"], - "chrom": "chr14", - "start_hg38": 92071010, - "stop_hg38": 92071052, - "start_hg19": 92537354, - "stop_hg19": 92537396, - "start_t2t": 86300519, - "stop_t2t": 86300603, - "disease": "Spinocerebellar ataxia type 3/Machado-Joseph disease", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease, is the most common subtype of type 1 autosomal dominant cerebellar ataxia (ADCA type 1), a neurodegenerative disorder, and is characterized by ataxia, external progressive ophthalmoplegia, and other neurological manifestations [@mondo:0007182]. Research suggests that length of ATXN2 expansions may affect the phenotype of SCA3 [@pmid:40684213].", - "hpo_terms": null, - "prevalence": "2.1/100000", - "prevalence_details": "1-5/100,000 [@pmid:29100084]. Most prevalent SCA subtype [@genereviews:NBK557816]. Found worldwide across ancestries/ethnicities [@genereviews:NBK1196].", - "age_onset": "Typical: 10-49 [@genereviews:NBK1196]; 3 [@pmid:40004498] - 73 [@genereviews:NBK1196; @pmid:30414314].", - "age_onset_min": 3.0, - "age_onset_max": 73.0, - "typ_age_onset_min": 10.0, - "typ_age_onset_max": 49.0, - "details": "Benign alleles range from 11-44 repeats [@pmid:37906407], with intermediate alleles (45-59) associated with incomplete penetrance and non-classic phenotypes [@genereviews:NBK1196]. The threshold between incomplete and full penetrance is unclear, but presumed to occur at ~60 repeats [@genereviews:NBK1196; @pmid:37906407]. The interruption CAA has been observed [@pmid:35245110]; AAG is present in hg38 reference sequence. The APOE ε4 allele appears to act as a disease modifier [@pmid:39731318]; GLS expansions may also function as disease modifiers [@pmid:39699045].", - "detection": "PCR fragment analysis or RP-PCR typically detect expansions, but homozygous PCR results may require Southern blotting to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1196]. Long-read sequencing can characterize full structure [@pmid:40890629].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to gain of function; aggregated and mislocalized proteins in neurons [@pmid:36169768; @genereviews:NBK1196].", - "year": "1994 [@pmid:7874163]", - "location_in_gene": "Coding Exon 10", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CTG"], - "pathogenic_motif_reference_orientation": ["CTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["TTG", "AGG"], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AAC", "CCT"], - "locus_structure": [], - "benign_min": 11, - "benign_max": 44, - "intermediate_min": 45, - "intermediate_max": 59, - "pathogenic_min": 60, - "pathogenic_max": 87, - "motif_len": 3, - "ref_copies": 14.0, - "novel": "ref", - "gard": ["6801"], - "genereviews": ["NBK1196"], - "malacard": ["MCH002"], - "medgen": ["9841"], - "mondo": ["0007182"], - "omim": ["109150"], - "orphanet": ["98757"], - "gnomad": ["ATXN3"], - "stripy": ["ATXN3"], - "tr_atlas": ["TR132758"], - "webstr_hg38": ["5316666", "1481402"], - "webstr_hg19": ["Expansion_SCA3_MJD/ATXN3"], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "maternal_expansion", "length_affects_onset", "length_affects_phenotype", "length_affects_severity"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK1196", "pmid:40004498", "pmid:30414314", "pmid:36169768", "pmid:37906407", "pmid:35245110", "pmid:39731318", "pmid:39699045", "pmid:29100084", "genereviews:NBK557816", "pmid:7874163", "mondo:0007182", "pmid:40684213"], - "additional_literature": ["pmid:42191105", "pmid:42105168", "pmid:42096001", "pmid:41854058", "pmid:41853947", "pmid:41818480", "pmid:41771688", "pmid:41736717", "pmid:41713739", "pmid:41701293", "pmid:41613623", "pmid:41612618", "pmid:41552385", "pmid:41435767", "pmid:41358280", "pmid:41082794", "pmid:41058593", "pmid:41009775", "pmid:41001200", "pmid:40906330", "pmid:40900235", "pmid:40890629", "pmid:40880681", "pmid:40797466", "pmid:40754098", "pmid:40738252", "pmid:40692435", "pmid:40635703", "pmid:40488202", "pmid:40488180", "pmid:40450087", "pmid:40204795", "pmid:40178277", "pmid:40152810", "pmid:39987589", "pmid:39921113", "pmid:39820777", "pmid:39571249", "pmid:39516744", "pmid:39456985", "pmid:39375222", "pmid:39317855", "pmid:39298485", "pmid:39229124", "pmid:39125643", "pmid:39088078", "pmid:39048885", "pmid:38961870", "pmid:38900277", "pmid:38626762", "pmid:38513302", "pmid:38449714", "pmid:38443995", "pmid:38429929", "pmid:38291334", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37961108", "pmid:37866221", "pmid:37848721", "pmid:37830620", "pmid:37830611", "pmid:37735371", "pmid:37397792", "pmid:37379724", "pmid:37333326", "pmid:37215811", "pmid:37122622", "pmid:37003406", "pmid:36907537", "pmid:36891289", "pmid:36875652", "pmid:36733922", "pmid:36618024", "pmid:36530930", "pmid:36482247", "pmid:36250694", "pmid:35997830", "pmid:35962273", "pmid:35952620", "pmid:35851059", "pmid:35847233", "pmid:35426475", "pmid:35421843", "pmid:35406787", "pmid:35188716", "pmid:35182509", "pmid:35052497", "pmid:35042771", "pmid:34783886", "pmid:34716557", "pmid:34706018", "pmid:34565721", "pmid:34473252", "pmid:34430069", "pmid:34284285", "pmid:34191270", "pmid:34167352", "pmid:34160773", "pmid:34159894", "pmid:34087977", "pmid:33893204", "pmid:33782863", "pmid:33743045", "pmid:33502644", "pmid:33468086", "pmid:33413375", "pmid:33371889", "pmid:33159825", "pmid:33157084", "pmid:33087504", "pmid:33058338", "pmid:32978817", "pmid:32822634", "pmid:32729243", "pmid:32205441", "pmid:31934455", "pmid:31920494", "pmid:31783119", "pmid:31687087", "pmid:31616370", "pmid:31565539", "pmid:31394429", "pmid:31374463", "pmid:31310802", "pmid:31230722", "pmid:30920184", "pmid:30891880", "pmid:30833927", "pmid:30804982", "pmid:30685895", "pmid:30615214", "pmid:30591349", "pmid:30554804", "pmid:30314815", "pmid:30231063", "pmid:30125433", "pmid:30120431", "pmid:30008965", "pmid:29959555", "pmid:29936336", "pmid:29922950", "pmid:29881950", "pmid:29852360", "pmid:29801869", "pmid:29737427", "pmid:29666341", "pmid:29553382", "pmid:29497168", "pmid:29444500", "pmid:29249939", "pmid:29057148", "pmid:28854700", "pmid:28782341", "pmid:28624196", "pmid:28585930", "pmid:28444220", "pmid:28158474", "pmid:28065793", "pmid:27942452", "pmid:27896316", "pmid:27848087", "pmid:27847820", "pmid:27596958", "pmid:27774050", "pmid:27731380", "pmid:27600091", "pmid:27333979", "pmid:26615955", "pmid:26601773", "pmid:26505994", "pmid:26467707", "pmid:26377379", "pmid:26374734", "pmid:26362908", "pmid:26354989", "pmid:26336829", "pmid:26266536", "pmid:26083476", "pmid:26077168", "pmid:26067219", "pmid:26054379", "pmid:30363545", "pmid:25700012", "pmid:25634432", "pmid:25633985", "pmid:25590633", "pmid:25466696", "pmid:25320121", "pmid:25144244", "pmid:25143392", "pmid:25068645", "pmid:25026993", "pmid:24972706", "pmid:24780882", "pmid:24746364", "pmid:24675225", "pmid:24534762", "pmid:24525517", "pmid:24242192", "pmid:23844332", "pmid:23775343", "pmid:23659897", "pmid:23423669", "pmid:23413156", "pmid:23382971", "pmid:23368522", "pmid:23026538", "pmid:22520093", "pmid:22351852", "pmid:22297462", "pmid:22090366", "pmid:22023810", "pmid:21975858", "pmid:21889984", "pmid:21832228", "pmid:21795378", "pmid:21780213", "pmid:21625753", "pmid:21600833", "pmid:21506152", "pmid:20726892", "pmid:20503052", "pmid:20484674", "pmid:20467850", "pmid:20334689", "pmid:20069235", "pmid:22353486", "pmid:19802879", "pmid:19699305", "pmid:19672991", "pmid:19631275", "pmid:19608203", "pmid:19597981", "pmid:19503814", "pmid:19412185", "pmid:19049837", "pmid:18990604", "pmid:18759344", "pmid:18685131", "pmid:18506570", "pmid:18449188", "pmid:18418678", "pmid:18413477", "pmid:18385100", "pmid:18261802", "pmid:18182848", "pmid:18071041", "pmid:18028243", "pmid:17961920", "pmid:17948873", "pmid:17712857", "pmid:17594286", "pmid:17440947", "pmid:17420317", "pmid:17116127", "pmid:17027034", "pmid:16967484", "pmid:16791428", "pmid:16724006", "pmid:16687213", "pmid:16389595", "pmid:16340213", "pmid:16241973", "pmid:15911147", "pmid:15747371", "pmid:22473187", "pmid:15553088", "pmid:15534186", "pmid:15504352", "pmid:15265035", "pmid:15223312", "pmid:15201448", "pmid:15167689", "pmid:15148151", "pmid:15080863", "pmid:15026782", "pmid:14966163", "pmid:14756671", "pmid:14679302", "pmid:14616293", "pmid:12938149", "pmid:12853230", "pmid:12832059", "pmid:12810491", "pmid:12764052", "pmid:12614315", "pmid:12486728", "pmid:12433269", "pmid:12235319", "pmid:12042281", "pmid:12007862", "pmid:11978767", "pmid:11889231", "pmid:11839840", "pmid:11807410", "pmid:11804332", "pmid:11559318", "pmid:11448300", "pmid:11466410", "pmid:11409435", "pmid:11405804", "pmid:11374096", "pmid:11160961", "pmid:10369884", "pmid:11030803", "pmid:11030410", "pmid:10942107", "pmid:10915763", "pmid:10894992", "pmid:10855623", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10732811", "pmid:10717003", "pmid:10575843", "pmid:10525976", "pmid:10453742", "pmid:10433966", "pmid:10072437", "pmid:10071104", "pmid:9973298", "pmid:9855520", "pmid:9762957", "pmid:9758625", "pmid:9696528", "pmid:9674805", "pmid:9635424", "pmid:9613852", "pmid:9536097", "pmid:9588850", "pmid:9577387", "pmid:9562258", "pmid:9549522", "pmid:9532283", "pmid:9469848", "pmid:9507387", "pmid:9506544", "pmid:9415538", "pmid:9450899", "pmid:9436730", "pmid:9385362", "pmid:9371900", "pmid:9403486", "pmid:9403480", "pmid:9339702", "pmid:9339681", "pmid:9292723", "pmid:9259275", "pmid:9254842", "pmid:9225982", "pmid:9215676", "pmid:10735276", "pmid:9124808", "pmid:9106530", "pmid:9132496", "pmid:9020849", "pmid:10464657", "pmid:9401013", "pmid:8962095", "pmid:9088110", "pmid:8968739", "pmid:8931692", "pmid:8937340", "pmid:8836972", "pmid:8659514", "pmid:8609925", "pmid:8655136", "pmid:8780110", "pmid:8644735", "pmid:8815156", "pmid:8824876", "pmid:8926495", "pmid:8900536", "pmid:8800925", "pmid:8559378", "pmid:8559377", "pmid:8583215", "pmid:7574470", "pmid:7573040", "pmid:7496771", "pmid:8523034", "pmid:7668288", "pmid:7611296", "pmid:7762567", "pmid:7655453", "pmid:7633439"] -}, -{ - "id": "SCA7_ATXN7", - "disease_id": "SCA7", - "gene": "ATXN7", - "evidence": ["Definitive"], - "chrom": "chr3", - "start_hg38": 63912684, - "stop_hg38": 63912715, - "start_hg19": 63898360, - "stop_hg19": 63898391, - "start_t2t": 63956302, - "stop_t2t": 63956333, - "disease": "Spinocerebellar ataxia type 7", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia-7 (SCA7) is an autosomal dominant neurodegenerative disorder characterized by adult onset of progressive cerebellar ataxia associated with pigmental macular dystrophy [@omim:164500].", - "hpo_terms": null, - "prevalence": "0.999/300000", - "prevalence_details": "<1/300,000: predominantly found in those with North European and African ancestry [@genereviews:NBK1256].", - "age_onset": "Typical: 4-48 [@pmid:20739808]; Range: 0-90 [@genereviews:NBK1256; @pmid:14571264].", - "age_onset_min": 0.0, - "age_onset_max": 65.0, - "typ_age_onset_min": 4.0, - "typ_age_onset_max": 48.0, - "details": "Benign alleles range from 4-27 [@pmid:37906407], with intermediate alleles ranging from premutations (28-33) to reduced penetrance (34-36) [@genereviews:NBK1256]. Interruptions observed include CAA [@pmid:35245110].", - "detection": "Short-read WGS cannot accurately detect repeat expansions at this locus. PCR fragment analysis or RP-PCR has detected expansions and sized most normal or moderate pathogenic alleles, while very large expansions have been detected with Southern blotting or long-read sequencing [@genereviews:NBK1256].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to gain of function; toxic misfolded intermediated suspected [@genereviews:NBK1256; @pmid:18418675].", - "year": "1996 [@pmid:8908515]", - "location_in_gene": "Coding Exon 1, 2, or 3 (depending on isoform)", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + { - "motif": "CAG", - "count": null, - "type": "pathogenic_repeat" + "id": "OPDM5_ABCD3", + "disease_id": "OPDM5", + "gene": "ABCD3", + "evidence": [ + "Moderate" + ], + "chrom": "chr1", + "start_hg38": 94418421, + "stop_hg38": 94418444, + "start_hg19": 94883977, + "stop_hg19": 94884000, + "start_t2t": 94266544, + "stop_t2t": 94266567, + "disease": "Oculopharyngodistal myopathy type 5", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in individuals of European, Japanese, and Chinese ancestry [@pmid:38876750; @pmid:34047774].", + "age_onset": "Typical: 24-30; Range: 10-50 [@pmid:39068203]. Age of onset data is limited to 8 families.", + "age_onset_min": 10, + "age_onset_max": 50, + "typ_age_onset_min": 24, + "typ_age_onset_max": 30, + "details": "Characterized in eight unrelated families which were used to establish benign (3-44) and pathogenic (118-694) ranges [@pmid:39068203].", + "detection": "RP-PCR has been used for detection [@pmid:39068203]. Short-read sequencing has significantly underestimated repeat count, while long-read sequencing has accurately resolved size [@pmid:39068203].", + "mechanism": null, + "mechanism_detail": "Potentially over-expression of transcripts [@pmid:39068203].", + "year": "2023 [@pmid:39068203]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 3, + "benign_max": 44, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 118, + "pathogenic_max": 694, + "motif_len": 3, + "ref_copies": 7.7, + "novel": "ref", + "gard": [ + "12592" + ], + "genereviews": [], + "malacard": [], + "medgen": [ + "320250" + ], + "mondo": [ + "0025193" + ], + "omim": [], + "orphanet": [ + "98897" + ], + "gnomad": [ + "ABCD3" + ], + "stripy": [], + "tr_atlas": [ + "TR5671" + ], + "webstr_hg38": [ + "1164141", + "6329150" + ], + "webstr_hg19": [ + "STR_58687" + ], + "locus_tags": [], + "disease_tags": [ + "oculopharyngodistal_myopathy" + ], + "references": [ + "pmid:39068203", + "pmid:38876750", + "pmid:34047774", + "mondo:0025193" + ], + "additional_literature": [ + "pmid:41959811", + "pmid:41792844", + "pmid:40645757" + ] }, { - "motif": "CCG", - "count": 4, - "type": "flank_repeat" - }], - "benign_min": 4, - "benign_max": 27, - "intermediate_min": 28, - "intermediate_max": 35, - "pathogenic_min": 37, - "pathogenic_max": 460, - "motif_len": 3, - "ref_copies": 10.7, - "novel": "ref", - "gard": ["20405"], - "genereviews": ["NBK1256"], - "malacard": ["SPN291"], - "medgen": ["156006"], - "mondo": ["0016163"], - "omim": ["164500"], - "orphanet": ["94147"], - "gnomad": ["ATXN7"], - "stripy": ["ATXN7"], - "tr_atlas": ["TR31879", "TR31880"], - "webstr_hg38": ["4965588"], - "webstr_hg19": ["Expansion_SCA7/ATXN7"], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["pmid:20739808", "genereviews:NBK1256", "pmid:14571264", "pmid:18418675", "pmid:37906407", "pmid:35245110", "pmid:8908515", "omim:164500"], - "additional_literature": ["pmid:41771688", "pmid:41254939", "pmid:40900235", "pmid:40488180", "pmid:40417743", "pmid:39820777", "pmid:39649105", "pmid:39571249", "pmid:39504355", "pmid:39317855", "pmid:39053472", "pmid:38961870", "pmid:38906973", "pmid:38851031", "pmid:38673939", "pmid:38626762", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:38045332", "pmid:37986914", "pmid:37848721", "pmid:37283503", "pmid:37214832", "pmid:36618024", "pmid:36530930", "pmid:35422034", "pmid:35182509", "pmid:35052497", "pmid:34870541", "pmid:34565721", "pmid:34160002", "pmid:34159894", "pmid:33995769", "pmid:33626063", "pmid:32138195", "pmid:31694722", "pmid:31522753", "pmid:31269856", "pmid:30891880", "pmid:30721448", "pmid:30699348", "pmid:30615214", "pmid:30381411", "pmid:30314815", "pmid:30255962", "pmid:30120431", "pmid:29801887", "pmid:29462666", "pmid:29316893", "pmid:29249939", "pmid:29248324", "pmid:28597910", "pmid:28585930", "pmid:28568901", "pmid:28444220", "pmid:27999335", "pmid:27774050", "pmid:27632585", "pmid:27333979", "pmid:27044733", "pmid:26584329", "pmid:26374734", "pmid:26077168", "pmid:25900954", "pmid:25755283", "pmid:25643591", "pmid:25608122", "pmid:25506882", "pmid:25466696", "pmid:25306109", "pmid:24972706", "pmid:24667781", "pmid:24534762", "pmid:24209901", "pmid:23828024", "pmid:23368522", "pmid:23197655", "pmid:23064575", "pmid:23026538", "pmid:22831947", "pmid:22520093", "pmid:22072678", "pmid:22053702", "pmid:21689595", "pmid:21147232", "pmid:20069235", "pmid:19226466", "pmid:19008940", "pmid:18418678", "pmid:18325672", "pmid:18182848", "pmid:17961920", "pmid:17420317", "pmid:17254003", "pmid:16626296", "pmid:16436644", "pmid:16434483", "pmid:16389941", "pmid:16389595", "pmid:16325416", "pmid:15750685", "pmid:15715978", "pmid:22473187", "pmid:15349877", "pmid:15148151", "pmid:15115762", "pmid:15080863", "pmid:14967767", "pmid:14966163", "pmid:12810491", "pmid:12764052", "pmid:12490531", "pmid:11939898", "pmid:11889231", "pmid:11839840", "pmid:11804332", "pmid:11781712", "pmid:11580893", "pmid:11448300", "pmid:11160961", "pmid:10369884", "pmid:11030825", "pmid:11030806", "pmid:11030410", "pmid:10942107", "pmid:10894992", "pmid:10841760", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10602364", "pmid:10556295", "pmid:9467013", "pmid:10500272", "pmid:10453742", "pmid:10441328", "pmid:9973298", "pmid:9855520", "pmid:9736784", "pmid:9613852", "pmid:9536097", "pmid:9425224", "pmid:9425223", "pmid:9425222", "pmid:9425905", "pmid:9385362", "pmid:9288099", "pmid:10464657"] -}, -{ - "id": "SCA8_ATXN8OS", - "disease_id": "SCA8", - "gene": "ATXN8OS", - "evidence": ["Definitive"], - "chrom": "chr13", - "start_hg38": 70139383, - "stop_hg38": 70139429, - "start_hg19": 70713515, - "stop_hg19": 70713561, - "start_t2t": 69361243, - "stop_t2t": 69361270, - "disease": "Spinocerebellar ataxia type 8", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 8 (SCA8) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by cerebellar ataxia and cognitive dysfunction in almost three quarters of patients and pyramidal and sensory signs in approximately a third of patients [@mondo:0012116].", - "hpo_terms": null, - "prevalence": "0.5/100000", - "prevalence_details": "<1/100,000 [@pmid:29100084]; expansion in 1:100-1200 chromosomes [@genereviews:NBK1268]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1268].", - "age_onset": "Typical: third to fifth decade (20-49); Range: 0 [@genereviews:NBK1268] - 76 [@pmid:40015980].", - "age_onset_min": 0.0, - "age_onset_max": 76.0, - "typ_age_onset_min": 20.0, - "typ_age_onset_max": 49.0, - "details": "Two genes span the CTG/CAG repeat and are expressed in opposite directions: ATXN8, a nearly pure polyglutamine repeat protein in the CAG direction, and ATXN8OS, which is transcribed to a noncoding CUG repeat RNA [@pmid:16804541]. Reduced penetrance is found in alleles of all sizes, although penetrance appears higher at 71+ repeats and repeats at 50-70 appear less likely to result in disease [@genereviews:NBK1268; @pmid:20373340]. Roda et al. suggested that the ATXN8 or ATXN8OS gene should not be evaluated in isolation as a candidate gene for spinocerebellar degenerative disease [@pmid:28451643]. CCG/CGG interruptions in high-penetrance SCA8 families increase RAN translation and protein toxicity [@pmid:34632710]; Interruptions in CTG/CAG expansion by 1 or more CCG/CGG, CTA/TAG, CTC/GAG, CCA/TGG, or CTT/AAG trinucleotides have been observed in full-penetrance repeats [@pmid:16804541; @genereviews:NBK1268].", - "detection": "Short-read genome sequencing has been reported to underestimate expansion size [@pmid:40015980; @genereviews:NBK1268]. RP-PCR has detected large expansions while long-read sequencing and Southern blotting estimated size more accurately [@genereviews:NBK1268].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine/toxic gain-of-function [@omim:608768; @genereviews:NBK1268].", - "year": "1999 [@pmid:10192387]", - "location_in_gene": "Coding Exon 1, or 3' UTR depending on transcript", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CTG"], - "pathogenic_motif_reference_orientation": ["CTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["CCG", "CTA", "CTC", "CCA", "CTT"], - "pathogenic_motif_gene_orientation": ["CTG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["CCG", "ACT", "CCT", "ACC", "CTT"], - "locus_structure": [ + "id": "FRAXE_AFF2", + "disease_id": "FRAXE", + "gene": "AFF2", + "evidence": [ + "Definitive" + ], + "chrom": "chrX", + "start_hg38": 148500604, + "stop_hg38": 148500753, + "start_hg19": 147582124, + "stop_hg19": 147582273, + "start_t2t": 146765190, + "stop_t2t": 146765342, + "disease": "Intellectual developmental disorder, Fragile X intellectual disability", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659].", + "hpo_terms": [ + "HP:0000718 Aggressive behavior", + "HP:0000713 Agitation", + "HP:0000729 Autistic behavior", + "HP:0002312 Clumsiness", + "HP:0000722 Compulsive behaviors", + "HP:0000750 Delayed speech and language development", + "HP:0001249 Intellectual disability" + ], + "prevalence": "2/50000", + "prevalence_details": "1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464].", + "age_onset": "Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548].", + "age_onset_min": 1, + "age_onset_max": 10, + "typ_age_onset_min": 2, + "typ_age_onset_max": 10, + "details": "Allele ranges (benign:4-39; pathogenic: >200) inferred from The Human Gene Mutation Database [@genereviews:NBK535148]. Intermediate alleles correspond to a premutation [@pmid:23914978]. Non-canonical motifs include: CGG/CCT/GTG/CAG/CTG3 [@pmid:35245110; @pmid:34111553].", + "detection": "RP-PCR has been used to detect expansions and size alleles to ~80 repeats, while Southern blotting has sized full expansions and detected methylation using Notl, a methylation-sensitive restriction enzyme [@pmid:34282157].", + "mechanism": "LoF", + "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", + "year": "1993 [@pmid:8334699]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 39, + "intermediate_min": 40, + "intermediate_max": 200, + "pathogenic_min": 201, + "pathogenic_max": 2000, + "motif_len": 3, + "ref_copies": 50.3, + "novel": "ref", + "gard": [ + "2378" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "INT399" + ], + "medgen": [ + "155512" + ], + "mondo": [ + "0010659" + ], + "omim": [ + "309548" + ], + "orphanet": [ + "100973" + ], + "gnomad": [ + "AFF2" + ], + "stripy": [ + "AFF2" + ], + "tr_atlas": [ + "TR173976" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [ + "somatic_instability", + "anticipation", + "maternal_expansion", + "length_affects_penetrance", + "length_affects_severity" + ], + "disease_tags": [], + "references": [ + "pmid:11246464", + "omim:309548", + "pmid:16205714", + "pmid:36169768", + "genereviews:NBK535148", + "pmid:23914978", + "pmid:35245110", + "pmid:34111553", + "url:medlineplus.gov/genetics/condition/fragile-xe-syndrome", + "pmid:8334699", + "mondo:0010659" + ], + "additional_literature": [ + "pmid:41074692", + "pmid:40708890", + "pmid:35431806", + "pmid:28812997", + "pmid:25171808", + "pmid:24763282", + "pmid:22718980", + "pmid:21739600", + "pmid:21254876", + "pmid:21051337", + "pmid:17635840", + "pmid:17516099", + "pmid:16469443", + "pmid:11119302", + "pmid:10780779", + "pmid:10674158", + "pmid:10424820", + "pmid:9630071", + "pmid:9415475", + "pmid:9415473", + "pmid:9341861", + "pmid:8808600", + "pmid:8844091", + "pmid:8755928", + "pmid:8673086", + "pmid:7541938", + "pmid:7783163", + "pmid:7881407", + "pmid:7977354", + "pmid:8023854", + "pmid:8162055", + "pmid:8118462" + ] + }, + { + "id": "FRA2A_AFF3", + "disease_id": "FRA2A", + "gene": "AFF3", + "evidence": [ + "Definitive" + ], + "chrom": "chr2", + "start_hg38": 100104798, + "stop_hg38": 100104824, + "start_hg19": 100721260, + "stop_hg19": 100721286, + "start_t2t": 100563685, + "stop_t2t": 100563738, + "disease": "Intellectual disability associated with fragile site FRA2A", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian", + "Risk" + ], + "disease_description": "These expansions are associated with intellectual disability and clinical phenotypes such as delayed motor development or delays in speech/language [@pmid:24763282].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "1/862 (1/654-1266) population prevalence of methylated AFF3 expansions (mild cognitive disability) [@pmid:39313615]. Disease cases observed in South Australia [@pmid:24763282].", + "age_onset": "Early childhood (small sample size) [@pmid:24763282].", + "age_onset_min": 1, + "age_onset_max": 7, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Allele ranges established in study of 3 families; intermediate alleles likely premutations [@pmid:24763282]. Pathogenic threshold may be higher than 300 as this was the largest allele that could be accurately sized by the assay.", + "detection": "Standard PCR has detected small alleles, while RP-PCR and Southern blotting have detected large expansions. Short-read sequencing may underestimate the size of large expansions and exact sizing usually uses long-read sequencing [@pmid:24763282; @pmid:39313615].", + "mechanism": "LoF/methylation", + "mechanism_detail": "Silencing of the FMR2 gene as a consequence of a CCG expansion located upstream of this gene [@malacard:KNS007].", + "year": "2014 [@pmid:24763282]", + "location_in_gene": "Intron 3", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 3, + "benign_max": 20, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 300, + "pathogenic_max": 300, + "motif_len": 3, + "ref_copies": 8.7, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": [ + "KNS007" + ], + "medgen": [], + "mondo": [], + "omim": [ + "601464" + ], + "orphanet": [], + "gnomad": [ + "AFF3" + ], + "stripy": [], + "tr_atlas": [ + "TR252468" + ], + "webstr_hg38": [ + "288936" + ], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:24763282", + "malacard:KNS007", + "pmid:39313615" + ], + "additional_literature": [ + "pmid:40417743", + "pmid:37205357" + ] + }, + { + "id": "SBMA_AR", + "disease_id": "SBMA", + "gene": "AR", + "evidence": [ + "Definitive" + ], + "chrom": "chrX", + "start_hg38": 67545316, + "stop_hg38": 67545419, + "start_hg19": 66765158, + "stop_hg19": 66765261, + "start_t2t": 65975147, + "stop_t2t": 65975250, + "disease": "Spinal and bulbar muscular atrophy, Kennedy Disease", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting [@mondo:0010735].", + "hpo_terms": null, + "prevalence": "1/30000", + "prevalence_details": "1-2/100,000 (population-specific, higher in Finnish population, Canadian population) [@pmid:37628685]; 1/30,000 [@orphanet:481]; mutation frequency of 1:3182 10x more frequent than reported disease prevalence of 1 in 30,000 [@pmid:36797998]. Only documented in patients with European/Asian ancestry, including Scandinavian, English, Belgian, French, Italian, German, Polish, Spanish, Swiss, Moroccan, Turkish, Chinese, Japanese (more common because of a founder effect), East Indian (potentially related to Japanese founder mutation) [@pmid:37578398], Korean, and Vietnamese populations [@genereviews:NBK1333].", + "age_onset": "Typical: 20-49 [@pmid:11436124], Range: 8 [@pmid:15851746] - 83 [@doi:10.17161/2tmg0f25].", + "age_onset_min": 8, + "age_onset_max": 83, + "typ_age_onset_min": 20, + "typ_age_onset_max": 49, + "details": "Intermediate alleles indicate reduced penetrance [@genereviews:NBK1333]. Expansions larger than the pathogenic threshold in the AR gene should be evaluated carefully. Interruptions have not been observed in patient cases; it has been proposed that longer alleles with interruptions may not be pathogenic [@pmid:24041967]. Non-canonical motif CAA observed [@pmid:35245110]. Expansions are also detected ten-fold more often in a general population than would be expected by disease prevalence [@pmid:36797998]. Clinical evaluation and phenotypic matching may be necessary to determine diagnosis even in the presence of a pure expanded allele. It has been proposed that contractions may play a role in disease [@pmid:10398229]. Disease may be subclinical in females [@pmid:34922802], and can be clinically heterogeneous even within the same family [@pmid:20184516].", + "detection": "Although short-read sequencing screens have been used to detect this expansion [@pmid:36797998], sizing is generally validated with standard PCR fragment analysis or RP-PCR [@genereviews:NBK1333].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine alters protein conformation leading to gain-of-function neurodegeneration [@pmid:29398703; @pmid:36169768]. Transcriptional dysregulation, axonal transport disruption, and mitochondrial dysfunction also play causative roles in the neurodegeneration [@pmid:22609045].", + "year": "1991 [@pmid:2062380]; the first triplet disease to be discovered [@pmid:15313856]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCA" + ], + "pathogenic_motif_reference_orientation": [ + "GCA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 9, + "benign_max": 34, + "intermediate_min": 36, + "intermediate_max": 37, + "pathogenic_min": 38, + "pathogenic_max": 68, + "motif_len": 3, + "ref_copies": 34, + "novel": "ref", + "gard": [ + "6818" + ], + "genereviews": [ + "NBK1333" + ], + "malacard": [ + "SPN404" + ], + "medgen": [ + "333282" + ], + "mondo": [ + "0010735" + ], + "omim": [ + "313200" + ], + "orphanet": [ + "481" + ], + "gnomad": [ + "AR" + ], + "stripy": [ + "AR" + ], + "tr_atlas": [ + "TR169377" + ], + "webstr_hg38": [ + "859199" + ], + "webstr_hg19": [], + "locus_tags": [ + "contraction", + "somatic_instability", + "anticipation", + "paternal_expansion", + "length_affects_severity", + "length_affects_penetrance", + "length_affects_onset" + ], + "disease_tags": [], + "references": [ + "pmid:11436124", + "pmid:15851746", + "doi:10.17161/2tmg0f25", + "pmid:29398703", + "pmid:36169768", + "pmid:22609045", + "genereviews:NBK1333", + "pmid:24041967", + "pmid:35245110", + "pmid:36797998", + "pmid:10398229", + "pmid:34922802", + "pmid:20184516", + "pmid:37628685", + "orphanet:481", + "pmid:37578398", + "pmid:2062380", + "pmid:15313856", + "mondo:0010735" + ], + "additional_literature": [ + "pmid:42196324", + "pmid:42138244", + "pmid:42070078", + "pmid:42067676", + "pmid:41762523", + "pmid:41564929", + "pmid:41552385", + "pmid:41513898", + "pmid:41361869", + "pmid:41246945", + "pmid:40912964", + "pmid:40614362", + "pmid:40585427", + "pmid:40488202", + "pmid:40450087", + "pmid:40371721", + "pmid:40366765", + "pmid:40031964", + "pmid:39755011", + "pmid:39729861", + "pmid:39694906", + "pmid:39570490", + "pmid:39189540", + "pmid:39140081", + "pmid:38976730", + "pmid:38860410", + "pmid:38737445", + "pmid:38701087", + "pmid:38585669", + "pmid:38284836", + "pmid:38171945", + "pmid:37936145", + "pmid:37718889", + "pmid:37715620", + "pmid:37422780", + "pmid:37269008", + "pmid:37045687", + "pmid:36988133", + "pmid:36717478", + "pmid:36701310", + "pmid:36622568", + "pmid:36599645", + "pmid:36585400", + "pmid:36142533", + "pmid:36137740", + "pmid:35982373", + "pmid:35876459", + "pmid:35872088", + "pmid:35867854", + "pmid:35661131", + "pmid:35599735", + "pmid:35571498", + "pmid:35237894", + "pmid:35230239", + "pmid:35189449", + "pmid:35182509", + "pmid:35165376", + "pmid:34914563", + "pmid:34744823", + "pmid:34723064", + "pmid:34407295", + "pmid:34390226", + "pmid:34372915", + "pmid:34006154", + "pmid:33865179", + "pmid:33738134", + "pmid:33714752", + "pmid:33261594", + "pmid:33191626", + "pmid:32989102", + "pmid:32856855", + "pmid:32468478", + "pmid:32216057", + "pmid:32166698", + "pmid:32152060", + "pmid:32070397", + "pmid:31901908", + "pmid:31522753", + "pmid:31446215", + "pmid:31303548", + "pmid:31179189", + "pmid:31040020", + "pmid:31030566", + "pmid:31019916", + "pmid:30940675", + "pmid:30886222", + "pmid:30838350", + "pmid:30837566", + "pmid:30615214", + "pmid:30612224", + "pmid:30415810", + "pmid:30351503", + "pmid:30314815", + "pmid:30247609", + "pmid:30206564", + "pmid:30206283", + "pmid:30156935", + "pmid:30156032", + "pmid:30139231", + "pmid:30120431", + "pmid:30043577", + "pmid:30019487", + "pmid:30019104", + "pmid:29914823", + "pmid:29886316", + "pmid:29809168", + "pmid:29714466", + "pmid:29706560", + "pmid:29571584", + "pmid:29556396", + "pmid:29464380", + "pmid:29364557", + "pmid:29299905", + "pmid:29249939", + "pmid:28963363", + "pmid:28915409", + "pmid:28780536", + "pmid:28585930", + "pmid:28511915", + "pmid:28367605", + "pmid:28295444", + "pmid:27873769", + "pmid:27807533", + "pmid:27669432", + "pmid:27634944", + "pmid:27517091", + "pmid:27251588", + "pmid:27193223", + "pmid:27066582", + "pmid:26872663", + "pmid:26772404", + "pmid:26691666", + "pmid:26541420", + "pmid:26511871", + "pmid:26499105", + "pmid:26410037", + "pmid:26406407", + "pmid:26355245", + "pmid:26345963", + "pmid:26298608", + "pmid:26266536", + "pmid:26246877", + "pmid:26221130", + "pmid:26043854", + "pmid:25979597", + "pmid:25925349", + "pmid:25889790", + "pmid:25828775", + "pmid:25746115", + "pmid:25665908", + "pmid:25637315", + "pmid:25536734", + "pmid:25520876", + "pmid:25514102", + "pmid:25455261", + "pmid:25230321", + "pmid:25217983", + "pmid:25148265", + "pmid:25122660", + "pmid:25078280", + "pmid:25047668", + "pmid:25027083", + "pmid:24974051", + "pmid:24966714", + "pmid:24925673", + "pmid:24925468", + "pmid:24872216", + "pmid:24824408", + "pmid:24793825", + "pmid:24742458", + "pmid:24711544", + "pmid:24691874", + "pmid:24581183", + "pmid:24566949", + "pmid:24391916", + "pmid:24274329", + "pmid:24256885", + "pmid:24200287", + "pmid:24120273", + "pmid:23799424", + "pmid:23789051", + "pmid:23732677", + "pmid:23679084", + "pmid:23545426", + "pmid:23515294", + "pmid:23467468", + "pmid:23441776", + "pmid:23388696", + "pmid:23377847", + "pmid:23364790", + "pmid:23359804", + "pmid:23272232", + "pmid:23184046", + "pmid:23167717", + "pmid:23136466", + "pmid:23062703", + "pmid:22941760", + "pmid:22819977", + "pmid:22792352", + "pmid:22765868", + "pmid:22736030", + "pmid:22731640", + "pmid:22653589", + "pmid:22652498", + "pmid:24052720", + "pmid:22333840", + "pmid:22233359", + "pmid:22107839", + "pmid:22068615", + "pmid:22038041", + "pmid:22025404", + "pmid:21977989", + "pmid:21664238", + "pmid:21643744", + "pmid:21642359", + "pmid:21486420", + "pmid:21445561", + "pmid:21410629", + "pmid:21270324", + "pmid:21247881", + "pmid:21089003", + "pmid:20880698", + "pmid:20689246", + "pmid:20425835", + "pmid:20353269", + "pmid:20233785", + "pmid:20127024", + "pmid:20063560", + "pmid:19956434", + "pmid:19818997", + "pmid:19692580", + "pmid:19684044", + "pmid:19497852", + "pmid:19482445", + "pmid:19237573", + "pmid:19228953", + "pmid:19218788", + "pmid:19211034", + "pmid:19207614", + "pmid:19100835", + "pmid:19095061", + "pmid:19062046", + "pmid:18962445", + "pmid:18783352", + "pmid:18762554", + "pmid:18645714", + "pmid:18642379", + "pmid:18624843", + "pmid:18610651", + "pmid:18592136", + "pmid:18446630", + "pmid:18365230", + "pmid:18323476", + "pmid:18222439", + "pmid:18217192", + "pmid:18191848", + "pmid:18181049", + "pmid:18097504", + "pmid:17997416", + "pmid:17984450", + "pmid:17984063", + "pmid:17979523", + "pmid:17854832", + "pmid:17852020", + "pmid:17825390", + "pmid:17635942", + "pmid:17556727", + "pmid:17507624", + "pmid:17507457", + "pmid:17465263", + "pmid:17440439", + "pmid:17431729", + "pmid:17372242", + "pmid:17321486", + "pmid:17230529", + "pmid:17161354", + "pmid:17137601", + "pmid:17027356", + "pmid:16859836", + "pmid:16847812", + "pmid:16817826", + "pmid:16813680", + "pmid:16804045", + "pmid:16793958", + "pmid:16772330", + "pmid:16696857", + "pmid:16621916", + "pmid:16515589", + "pmid:16493814", + "pmid:16462497", + "pmid:16448271", + "pmid:16437189", + "pmid:16425097", + "pmid:16403814", + "pmid:16377095", + "pmid:16365010", + "pmid:16358333", + "pmid:16299230", + "pmid:16187285", + "pmid:16117826", + "pmid:16008071", + "pmid:15956082", + "pmid:15954500", + "pmid:15952987", + "pmid:15950642", + "pmid:15876692", + "pmid:15824176", + "pmid:15747808", + "pmid:15725470", + "pmid:15721279", + "pmid:15659427", + "pmid:15609126", + "pmid:15599941", + "pmid:15570555", + "pmid:15545219", + "pmid:15472213", + "pmid:15366384", + "pmid:15358199", + "pmid:15341991", + "pmid:15310009", + "pmid:15198988", + "pmid:15146455", + "pmid:15120698", + "pmid:15044606", + "pmid:15003169", + "pmid:14974917", + "pmid:14973115", + "pmid:14731580", + "pmid:14698481", + "pmid:14693242", + "pmid:14691592", + "pmid:14674723", + "pmid:14605819", + "pmid:14585317", + "pmid:14511217", + "pmid:14506156", + "pmid:12898143", + "pmid:12860943", + "pmid:12767946", + "pmid:12755998", + "pmid:12714591", + "pmid:12670590", + "pmid:12634316", + "pmid:12632109", + "pmid:12602915", + "pmid:12542725", + "pmid:12534937", + "pmid:12478141", + "pmid:12404104", + "pmid:12388541", + "pmid:12385020", + "pmid:12376473", + "pmid:12220434", + "pmid:12189490", + "pmid:12189162", + "pmid:12085360", + "pmid:12042281", + "pmid:12031042", + "pmid:11956643", + "pmid:11935317", + "pmid:11927493", + "pmid:11894978", + "pmid:11875046", + "pmid:11847524", + "pmid:11810651", + "pmid:11809726", + "pmid:11788641", + "pmid:11721964", + "pmid:11720249", + "pmid:11701709", + "pmid:11600555", + "pmid:11571732", + "pmid:11571725", + "pmid:11550169", + "pmid:11494335", + "pmid:11473958", + "pmid:11443190", + "pmid:11368874", + "pmid:11331662", + "pmid:11330644", + "pmid:11266016", + "pmid:11259089", + "pmid:11167027", + "pmid:11121465", + "pmid:11016637", + "pmid:10999852", + "pmid:10958659", + "pmid:10956560", + "pmid:10852984", + "pmid:10821498", + "pmid:10817350", + "pmid:10794490", + "pmid:10732798", + "pmid:10732754", + "pmid:10717532", + "pmid:10717003", + "pmid:10656235", + "pmid:10643885", + "pmid:10637497", + "pmid:10617922", + "pmid:10574254", + "pmid:10564878", + "pmid:10544298", + "pmid:10486315", + "pmid:10419869", + "pmid:10400640", + "pmid:10323251", + "pmid:10234512", + "pmid:9925917", + "pmid:9886069", + "pmid:9880240", + "pmid:9815849", + "pmid:9813160", + "pmid:9761394", + "pmid:9732460", + "pmid:9731888", + "pmid:9692387", + "pmid:9677254", + "pmid:9580659", + "pmid:9499423", + "pmid:9382110", + "pmid:9270598", + "pmid:9094973", + "pmid:9020849", + "pmid:8960833", + "pmid:8954049", + "pmid:8878435", + "pmid:8737374", + "pmid:8926495", + "pmid:8807333", + "pmid:8645957", + "pmid:7772520", + "pmid:7757084", + "pmid:7719348", + "pmid:8065934", + "pmid:7951325", + "pmid:7515106", + "pmid:8232348", + "pmid:1461383", + "pmid:1734865" + ] + }, + { + "id": "EIEE1_ARX", + "disease_id": "EIEE1", + "gene": "ARX", + "evidence": [ + "Definitive" + ], + "chrom": "chrX", + "start_hg38": 25013649, + "stop_hg38": 25013697, + "start_hg19": 25031766, + "stop_hg19": 25031814, + "start_t2t": 24597886, + "stop_t2t": 24597934, + "disease": "Early-infantile epileptic encephalopathy", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Developmental and epileptic encephalopathy-1 (DEE1) is a severe form of epilepsy characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, characterized by high-voltage bursts alternating with almost flat suppression phases [@omim:308350].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in individuals of multiple ethnicities, including European and Asian ancestry [@pmid:12874418].", + "age_onset": "Typical: 0 [@pmid:21204215; @pmid:9307258]; Range: 0-4; 70% of cases involve infantile spasms, leading to seizures by 3 or 4 years [@pmid:19587282].", + "age_onset_min": 0, + "age_onset_max": 4, + "typ_age_onset_min": 0, + "typ_age_onset_max": 0, + "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", + "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:17668384].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", + "year": "2002 [@pmid:11889467]", + "location_in_gene": "Coding Exon 2, aa 110-115", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 16, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 17, + "pathogenic_max": 27, + "motif_len": 3, + "ref_copies": 14.7, + "novel": "ref", + "gard": [ + "15298" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "ERL057" + ], + "medgen": [ + "483052" + ], + "mondo": [ + "0010632" + ], + "omim": [ + "308350", + "300419", + "300215" + ], + "orphanet": [ + "182079" + ], + "gnomad": [ + "ARX_1" + ], + "stripy": [ + "ARX_1" + ], + "tr_atlas": [ + "TR167317" + ], + "webstr_hg38": [ + "843651" + ], + "webstr_hg19": [ + "STR_1542607" + ], + "locus_tags": [ + "length_affects_phenotype" + ], + "disease_tags": [ + "phenotypic_spectrum" + ], + "references": [ + "pmid:21204215", + "pmid:9307258", + "pmid:19587282", + "pmid:36169768", + "pmid:38467784", + "genereviews:NBK51932", + "genereviews:NBK535148", + "omim:309510", + "omim:308350", + "omim:300004", + "omim:300215", + "pmid:26029707", + "pmid:20506206", + "pmid:12874418", + "pmid:11889467" + ], + "additional_literature": [ + "pmid:40608247", + "pmid:39933386", + "pmid:39123069", + "pmid:36571524", + "pmid:33847015", + "pmid:32033960", + "pmid:28627419", + "pmid:28602636", + "pmid:27798109", + "pmid:26571108", + "pmid:25171319", + "pmid:24236044", + "pmid:23968833", + "pmid:23246292", + "pmid:22628459", + "pmid:22108177", + "pmid:20376468", + "pmid:19018235", + "pmid:18823727", + "pmid:18462864", + "pmid:17668384", + "pmid:17664401", + "pmid:17480217", + "pmid:15533998" + ] + }, + { + "id": "PRTS_ARX", + "disease_id": "PRTS", + "gene": "ARX", + "evidence": [ + "Definitive" + ], + "chrom": "chrX", + "start_hg38": 25013529, + "stop_hg38": 25013565, + "start_hg19": 25031646, + "stop_hg19": 25031682, + "start_t2t": 24597766, + "stop_t2t": 24597802, + "disease": "Partington syndrome", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A rare neurological condition that is primarily characterized by mild to moderate intellectual disability and dystonia of the hands. Other signs and symptoms may include dysarthria, behavioral abnormalities, recurrent seizures and/or an unusual gait (style of walking). Partington syndrome usually occurs in males; when it occurs in females, the signs and symptoms are often less severe. It is caused by changes (mutations) in the ARX gene and is inherited in an X-linked recessive manner. Treatment is based on the signs and symptoms present in each person [@mondo:0010654].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Limited clinical cases of predominantly European ancestry, such as Welsh/Belgian [@omim:309510].", + "age_onset": "Typical: 1-3; Range: 0-4. Mild phenotypes can make diagnosis difficult (expansions are particularly mild/absent in females) [@omim:309510].", + "age_onset_min": 0, + "age_onset_max": 4, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", + "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:11889467].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", + "year": "2002 [@pmid:11889467]", + "location_in_gene": "Coding Exon 2, aa 144-155", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 12, + "benign_max": 12, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 20, + "pathogenic_max": 20, + "motif_len": 3, + "ref_copies": 12, + "novel": "ref", + "gard": [ + "4235" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "PRT003" + ], + "medgen": [ + "163237" + ], + "mondo": [ + "0010654" + ], + "omim": [ + "309510" + ], + "orphanet": [ + "94083" + ], + "gnomad": [ + "ARX_2" + ], + "stripy": [ + "ARX_2" + ], + "tr_atlas": [ + "TR167316" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [ + "length_affects_phenotype" + ], + "disease_tags": [ + "phenotypic_spectrum" + ], + "references": [ + "omim:309510", + "pmid:36169768", + "pmid:38467784", + "genereviews:NBK51932", + "genereviews:NBK535148", + "omim:308350", + "omim:300004", + "omim:300215", + "pmid:26029707", + "pmid:20506206", + "pmid:11889467", + "mondo:0010654" + ], + "additional_literature": [ + "pmid:40608247", + "pmid:39933386", + "pmid:39123069", + "pmid:36571524", + "pmid:33847015", + "pmid:32033960", + "pmid:28627419", + "pmid:28602636", + "pmid:27798109", + "pmid:26571108", + "pmid:25171319", + "pmid:24236044", + "pmid:23968833", + "pmid:23246292", + "pmid:22628459", + "pmid:22108177", + "pmid:21204215", + "pmid:20376468", + "pmid:19587282", + "pmid:19018235", + "pmid:18823727", + "pmid:18462864", + "pmid:17668384", + "pmid:17664401", + "pmid:17480217", + "pmid:15533998", + "pmid:12874418" + ] + }, + { + "id": "DRPLA_ATN1", + "disease_id": "DRPLA", + "gene": "ATN1", + "evidence": [ + "Definitive" + ], + "chrom": "chr12", + "start_hg38": 6936716, + "stop_hg38": 6936775, + "start_hg19": 7045879, + "stop_hg19": 7045938, + "start_t2t": 6947903, + "stop_t2t": 6947941, + "disease": "Dentatorubral-Pallidoluysian Atrophy", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Dentatorubral pallidoluysian atrophy (DRPLA) is a rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by involuntary movements, ataxia, epilepsy, mental disorders, cognitive decline and prominent anticipation [@mondo:0007435]. Epilepsy is common in earlier onset cases [@pmid:41147955].", + "hpo_terms": null, + "prevalence": "4.5/1000000", + "prevalence_details": "2-7/1,000,000. More prevalent in Japanese populations; also reported in North America, South America, Europe, and Australia [@genereviews:NBK1491].", + "age_onset": "Typical: 20-40 [@pmid:6808417; @genereviews:NBK1491]. Range: 0 [@pmid:11160976] - 72 [@genereviews:NBK1491].", + "age_onset_min": 0, + "age_onset_max": 72, + "typ_age_onset_min": 20, + "typ_age_onset_max": 40, + "details": "Pathogenic expansions (48-93) are fully penetrant with the exception of one documented case of 51 repeats; intermediate alleles (36-47) are associated with a milder phenotype and can expand upon transmission [@genereviews:NBK1491]. CAA interruptions have been observed without known clinical association [@pmid:35245110]. Length of the repeat is inversely associated with age of onset and severe epilepsy phenotype [@pmid:41147955].", + "detection": "PCR fragment analysis has detected most moderate alleles, but Southern blotting or RP-PCR have been used in cases of large expansions or when PCR shows an apparently homozygous small allele, to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1491].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansions leading to gain of function [@genereviews:NBK1491].", + "year": "1994 [@pmid:7842016]", + "location_in_gene": "Coding Exon 5", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 35, + "intermediate_min": 36, + "intermediate_max": 47, + "pathogenic_min": 48, + "pathogenic_max": 93, + "motif_len": 3, + "ref_copies": 19, + "novel": "ref", + "gard": [ + "5643" + ], + "genereviews": [ + "NBK1491" + ], + "malacard": [ + "DNT005" + ], + "medgen": [ + "155630" + ], + "mondo": [ + "0007435" + ], + "omim": [ + "125370" + ], + "orphanet": [ + "101" + ], + "gnomad": [ + "ATN1" + ], + "stripy": [ + "ATN1" + ], + "tr_atlas": [ + "TR114246" + ], + "webstr_hg38": [ + "5050156" + ], + "webstr_hg19": [ + "Expansion_ATN1/DRPLA" + ], + "locus_tags": [ + "anticipation", + "somatic_instability", + "paternal_expansion", + "length_affects_onset", + "length_affects_severity", + "length_affects_phenotype" + ], + "disease_tags": [ + "ataxia", + "epilepsy" + ], + "references": [ + "pmid:6808417", + "genereviews:NBK1491", + "pmid:11160976", + "pmid:35245110", + "pmid:41147955", + "pmid:7842016", + "mondo:0007435" + ], + "additional_literature": [ + "pmid:42196324", + "pmid:41624332", + "pmid:41355374", + "pmid:41254939", + "pmid:41082794", + "pmid:40832356", + "pmid:40488180", + "pmid:40450087", + "pmid:40340521", + "pmid:40298952", + "pmid:40263757", + "pmid:40237283", + "pmid:39820777", + "pmid:39812846", + "pmid:39742457", + "pmid:39224955", + "pmid:38961870", + "pmid:38227102", + "pmid:38152578", + "pmid:37243799", + "pmid:36599645", + "pmid:36530930", + "pmid:35182509", + "pmid:34968706", + "pmid:34022586", + "pmid:33106889", + "pmid:32711193", + "pmid:32675418", + "pmid:32129252", + "pmid:31493762", + "pmid:30891880", + "pmid:30827498", + "pmid:30615214", + "pmid:30314815", + "pmid:30120431", + "pmid:29801887", + "pmid:29715545", + "pmid:29249939", + "pmid:28782341", + "pmid:28585930", + "pmid:27896316", + "pmid:27400454", + "pmid:26374734", + "pmid:26077168", + "pmid:25842919", + "pmid:25466696", + "pmid:24972706", + "pmid:24534762", + "pmid:23933208", + "pmid:23364790", + "pmid:23263592", + "pmid:23026538", + "pmid:22527233", + "pmid:22520093", + "pmid:22342974", + "pmid:22297462", + "pmid:21108634", + "pmid:20589872", + "pmid:19429075", + "pmid:19370769", + "pmid:19259763", + "pmid:19039037", + "pmid:18182848", + "pmid:17965145", + "pmid:17961920", + "pmid:17420317", + "pmid:16967484", + "pmid:16858508", + "pmid:16251216", + "pmid:16199124", + "pmid:15553088", + "pmid:15223312", + "pmid:15148151", + "pmid:15133824", + "pmid:14756671", + "pmid:12925365", + "pmid:12805114", + "pmid:12764052", + "pmid:12614315", + "pmid:12235319", + "pmid:12042281", + "pmid:11939898", + "pmid:11807410", + "pmid:11711886", + "pmid:11709002", + "pmid:11689158", + "pmid:11574112", + "pmid:11198291", + "pmid:10942107", + "pmid:10894992", + "pmid:10814707", + "pmid:10768629", + "pmid:10766906", + "pmid:10677044", + "pmid:10564878", + "pmid:10515170", + "pmid:10486315", + "pmid:10453742", + "pmid:10332026", + "pmid:10085113", + "pmid:10084125", + "pmid:9949204", + "pmid:9887337", + "pmid:9758625", + "pmid:9705838", + "pmid:9696528", + "pmid:9647693", + "pmid:9613852", + "pmid:9507387", + "pmid:9462738", + "pmid:9385362", + "pmid:9361003", + "pmid:9187480", + "pmid:9124808", + "pmid:9109905", + "pmid:9106530", + "pmid:9050922", + "pmid:9020849", + "pmid:8962095", + "pmid:9001798", + "pmid:8651298", + "pmid:8655136", + "pmid:8780110", + "pmid:8644735", + "pmid:8852663", + "pmid:8926495", + "pmid:8559378", + "pmid:8557266", + "pmid:7633415", + "pmid:7868125", + "pmid:7824105", + "pmid:7885531", + "pmid:8136840", + "pmid:8136826", + "pmid:7734112" + ] + }, + { + "id": "SCA1_ATXN1", + "disease_id": "SCA1", + "gene": "ATXN1", + "evidence": [ + "Definitive" + ], + "chrom": "chr6", + "start_hg38": 16327633, + "stop_hg38": 16327724, + "start_hg19": 16327864, + "stop_hg19": 16327955, + "start_t2t": 16200188, + "stop_t2t": 16200282, + "disease": "Spinocerebellar ataxia type 1", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 1 (SCA1) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by dysarthria, writing difficulties, limb ataxia, and commonly nystagmus and saccadic abnormalities [@mondo:0008119].", + "hpo_terms": null, + "prevalence": "1.5/100000", + "prevalence_details": "1-2/100,000. Cases have been reported worldwide, although prevalence varies by ancestry/ethnicity [@genereviews:NBK1184].", + "age_onset": "Typical: 20-39 [@url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias]; Range: 6 [@pmid:3165612] - 63 [@pmid:8825276].", + "age_onset_min": 6, + "age_onset_max": 63, + "typ_age_onset_min": 20, + "typ_age_onset_max": 39, + "details": "Penetrance is dependent on sequence purity in addition to expansion length: pure repeats are pathogenic at 39 repeats [@pmid:37906407], while CAT interruptions [@pmid:35245110] can lead to reduced penetrance at comparable lengths [@genereviews:NBK1184]. Regardless, intermediate alleles are considered premutations which may lead to disease upon transmission [@genereviews:NBK1184]. CAA interruptions have also been reported, but not linked to any phenotypic consequences [@pmid:23935513].", + "detection": "PCR fragment analysis is commonly used for sizing [@genereviews:NBK1184]. Standard fragment analysis does not resolve CAT interruptions, which require targeted analysis like RP-PCR or Sanger sequencing [@pmid:34635619; @genereviews:NBK1184].", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyglutamine expansion leading to toxic gain of function with eventual misregulation-based loss of function/dominant negative [@genereviews:NBK1184; @pmid:35573049].", + "year": "1993 [@pmid:8358429]", + "location_in_gene": "Coding Exon 8", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CTG" + ], + "pathogenic_motif_reference_orientation": [ + "CTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "ATG", + "TTG" + ], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "ATC", + "AAC" + ], + "locus_structure": [], + "benign_min": 6, + "benign_max": 35, + "intermediate_min": 36, + "intermediate_max": 38, + "pathogenic_min": 39, + "pathogenic_max": 91, + "motif_len": 3, + "ref_copies": 30.3, + "novel": "ref", + "gard": [ + "4071" + ], + "genereviews": [ + "NBK1184" + ], + "malacard": [ + "SPN294" + ], + "medgen": [ + "155703" + ], + "mondo": [ + "0008119" + ], + "omim": [ + "164400" + ], + "orphanet": [ + "98755" + ], + "gnomad": [ + "ATXN1" + ], + "stripy": [ + "ATXN1" + ], + "tr_atlas": [ + "TR63118" + ], + "webstr_hg38": [ + "5767842" + ], + "webstr_hg19": [ + "Expansion_SCA1/ATXN1" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_severity", + "motif_affects_instability", + "motif_affects_onset", + "motif_affects_penetrance", + "motif_affects_severity" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias", + "pmid:3165612", + "pmid:8825276", + "genereviews:NBK1184", + "pmid:35573049", + "pmid:37906407", + "pmid:35245110", + "pmid:23935513", + "pmid:8358429", + "mondo:0008119" + ], + "additional_literature": [ + "pmid:42196324", + "pmid:41727128", + "pmid:41435767", + "pmid:41426430", + "pmid:41254939", + "pmid:41149812", + "pmid:40900235", + "pmid:40488180", + "pmid:40450087", + "pmid:39820777", + "pmid:39456985", + "pmid:39289638", + "pmid:39211226", + "pmid:38961870", + "pmid:38626762", + "pmid:38585669", + "pmid:38308084", + "pmid:38125008", + "pmid:37827155", + "pmid:37776516", + "pmid:37397792", + "pmid:37146135", + "pmid:37043475", + "pmid:36599645", + "pmid:36549973", + "pmid:36291186", + "pmid:35869263", + "pmid:35525134", + "pmid:35182509", + "pmid:34830553", + "pmid:34635619", + "pmid:34600502", + "pmid:34372915", + "pmid:34179866", + "pmid:33502644", + "pmid:33276461", + "pmid:33159825", + "pmid:32954321", + "pmid:32761094", + "pmid:32580238", + "pmid:32339968", + "pmid:31940111", + "pmid:31810584", + "pmid:31645175", + "pmid:30891880", + "pmid:30729852", + "pmid:30615214", + "pmid:30324307", + "pmid:30314815", + "pmid:30120431", + "pmid:30108484", + "pmid:29845242", + "pmid:29656178", + "pmid:29497168", + "pmid:29274668", + "pmid:29249939", + "pmid:29057148", + "pmid:28585930", + "pmid:28444220", + "pmid:26077168", + "pmid:25595967", + "pmid:25344417", + "pmid:25255716", + "pmid:24972706", + "pmid:24594842", + "pmid:24534762", + "pmid:23197749", + "pmid:22884877", + "pmid:18337722", + "pmid:18301861", + "pmid:17961920", + "pmid:17420317", + "pmid:17116127", + "pmid:15300851" + ] + }, + { + "id": "SCA10_ATXN10", + "disease_id": "SCA10", + "gene": "ATXN10", + "evidence": [ + "Definitive" + ], + "chrom": "chr22", + "start_hg38": 45795354, + "stop_hg38": 45795424, + "start_hg19": 46191234, + "stop_hg19": 46191304, + "start_t2t": 46280059, + "stop_t2t": 46280134, + "disease": "Spinocerebellar ataxia type 10", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 10 (SCA10) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by slowly progressive cerebellar syndrome and epilepsy, sometimes mild pyramidal signs, peripheral neuropathy and neuropsychological disturbances [@mondo:0011330].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Unknown prevalence, >300 individuals. Cases have been identified in Mexico, Brazil, China, and Japan [@genereviews:NBK1175].", + "age_onset": "Typical: 12-48; Range: 11-83 [@genereviews:NBK1175].", + "age_onset_min": 11, + "age_onset_max": 83, + "typ_age_onset_min": 12, + "typ_age_onset_max": 48, + "details": "Unaffected individuals are usually (82%) compound heterozygotes in the benign range [@genereviews:NBK1175]. Intermediate alleles show reduced penetrance, and exact distinction between intermediate and the lower end of the pathogenic range is unclear [@genereviews:NBK1175]. Expansions are frequently interrupted by ATCCT, ATCCC, ATTCC, ATTTCT, ATATTCT, or ATTCTTCT; interruptions of ATTGT, TTTCT, ATTTTCT, ATTCTCT, GTTTCT, CTTCT, and ATTCTAT have been noted [@pmid:36199580] as has the interruption ATGCT [@pmid:19234597]. The ATCCT interruption motif is associated with a higher prevalence of epileptic seizures [@pmid:24318420]. Different motif patterns and mixed motif ratios may influence age of onset and anticipation [@pmid:41229449]. One study suggests that alleles with completely pure ATTCT expansions are non-pathogenic, and that repeat interruptions such as ATTCC, are necessary to cause SCA10 [@pmid:36092952].", + "detection": "RP-PCR with fragment analysis is commonly used for detection. Pathogenicity depends heavily on interruptions, so long-read sequencing approaches have been used for full structure resolution [@pmid:26295943; @pmid:32160188].", + "mechanism": "GoF", + "mechanism_detail": "Transdominant mechanism theorized [@pmid:38467784].", + "year": "2000 [@pmid:11017075]", + "location_in_gene": "Intron 9", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "ATTCT" + ], + "pathogenic_motif_reference_orientation": [ + "ATTCT" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "ATCCT", + "ATCCC", + "ATTCC", + "ATTTCT", + "ATATTCT", + "ATTCTTCT", + "ATTGT", + "TTTCT", + "ATTTTCT", + "ATTCTCT", + "GTTTCT", + "CTTCT", + "ATGCT" + ], + "pathogenic_motif_gene_orientation": [ + "ATTCT" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "ATCCT", + "ATCCC", + "ATTCC", + "ATTTCT", + "ATATTCT", + "ATTCTTCT", + "ATTGT", + "CTTTT", + "ATTTTCT", + "ATTCTCT", + "CTGTTT", + "CTCTT", + "ATGCT" + ], + "locus_structure": [], + "benign_min": 10, + "benign_max": 32, + "intermediate_min": 33, + "intermediate_max": 850, + "pathogenic_min": 800, + "pathogenic_max": 4500, + "motif_len": 5, + "ref_copies": 14, + "novel": "ref", + "gard": [ + "10474" + ], + "genereviews": [ + "NBK1175" + ], + "malacard": [ + "SPN314" + ], + "medgen": [ + "369786" + ], + "mondo": [ + "0011330" + ], + "omim": [ + "603516" + ], + "orphanet": [ + "98761" + ], + "gnomad": [ + "ATXN10" + ], + "stripy": [ + "ATXN10" + ], + "tr_atlas": [ + "TR165509" + ], + "webstr_hg38": [ + "1027359", + "4921433" + ], + "webstr_hg19": [ + "STR_909210" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_phenotype", + "motif_affects_instability", + "motif_affects_penetrance", + "motif_affects_phenotype" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK1175", + "pmid:38467784", + "pmid:36199580", + "pmid:19234597", + "pmid:24318420", + "pmid:41229449", + "pmid:36092952", + "pmid:11017075", + "mondo:0011330" + ], + "additional_literature": [ + "pmid:41229449", + "pmid:41074692", + "pmid:40900235", + "pmid:40898875", + "pmid:40488180", + "pmid:40067487", + "pmid:39820777", + "pmid:38961870", + "pmid:38832639", + "pmid:35103298", + "pmid:34970537", + "pmid:33502644", + "pmid:32520333", + "pmid:32160188", + "pmid:31737797", + "pmid:31445906", + "pmid:31342269", + "pmid:29922950", + "pmid:29316893", + "pmid:28890930", + "pmid:28423040", + "pmid:27248057", + "pmid:26374734", + "pmid:26295943", + "pmid:26077168", + "pmid:26039897", + "pmid:25466696", + "pmid:24278426", + "pmid:24269018", + "pmid:23443018", + "pmid:23083689", + "pmid:23026538", + "pmid:22065565", + "pmid:22053702", + "pmid:21282659", + "pmid:20065034", + "pmid:19651850", + "pmid:19306311", + "pmid:19171184", + "pmid:19147916", + "pmid:17961920", + "pmid:17846122", + "pmid:16924013", + "pmid:16498633", + "pmid:16385455", + "pmid:15505178", + "pmid:15201271", + "pmid:15148151", + "pmid:15096564", + "pmid:12764052", + "pmid:12589756", + "pmid:11839840", + "pmid:11160961", + "pmid:9973298" + ] + }, + { + "id": "SCA2_ATXN2", + "disease_id": "SCA2", + "gene": "ATXN2", + "evidence": [ + "Definitive" + ], + "chrom": "chr12", + "start_hg38": 111598949, + "stop_hg38": 111599019, + "start_hg19": 112036753, + "stop_hg19": 112036823, + "start_t2t": 111575873, + "stop_t2t": 111575940, + "disease": "Spinocerebellar ataxia type 2", + "inheritance": [ + "AD", + "AR" + ], + "association_type": [ + "Mendelian", + "Risk", + "Modifier" + ], + "disease_description": "A subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by truncal ataxia, dysarthria, slowed saccades and less commonly ophthalmoparesis and chorea [@mondo:0008458].", + "hpo_terms": null, + "prevalence": "1.5/100000", + "prevalence_details": "1-2/100,000 (population-dependent) [@pmid:29100084]. Cases have been found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1275].", + "age_onset": "Typical: 30-39 [@genereviews:NBK1275]; Range: 2-86 [@omim:183090].", + "age_onset_min": 2, + "age_onset_max": 86, + "typ_age_onset_min": 30, + "typ_age_onset_max": 39, + "details": "Full penetrance of single alleles occurs at ~35 repeats [@genereviews:NBK1275; @pmid:37906407] and pathogenic expansions have been documented as large as 500 repeats [@pmid:12116207]. 33-34 length repeats are associated with reduced penetrance and later onset (age >50 years) [@genereviews:NBK1275]. Homozygous 31 repeat alleles may lead to recessive disease [@pmid:30533529], while a single 29-32 repeat is associated with increased ALS risk [@genereviews:NBK1275; @pmid:25285812; @pmid:32954321]. There is some evidence that all CAG-repeat expansions in ATXN2 may be a risk factor for ALS, regardless of length and interruptions [@pmid:39956874]. CAA interruptions have been observed which appear to stabilize the allele in transmission [@genereviews:NBK1275].", + "detection": "RP-PCR with fragment analysis is commonly used for detection, while Southern blotting is required to estimate size over 100 repeats [@genereviews:NBK1275].", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyglutamine cytoplasmic aggregates leading to cellular apoptosis; RAN translation implicated [@genereviews:NBK1275].", + "year": "1996 [@pmid:8896556]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CTG" + ], + "pathogenic_motif_reference_orientation": [ + "CTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "TTG" + ], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AAC" + ], + "locus_structure": [], + "benign_min": 14, + "benign_max": 28, + "intermediate_min": 29, + "intermediate_max": 34, + "pathogenic_min": 35, + "pathogenic_max": 500, + "motif_len": 3, + "ref_copies": 23.3, + "novel": "ref", + "gard": [ + "4072" + ], + "genereviews": [ + "NBK1275" + ], + "malacard": [ + "SPN301" + ], + "medgen": [ + "155704" + ], + "mondo": [ + "0008458" + ], + "omim": [ + "183090" + ], + "orphanet": [ + "98756" + ], + "gnomad": [ + "ATXN2" + ], + "stripy": [ + "ATXN2" + ], + "tr_atlas": [ + "TR120465" + ], + "webstr_hg38": [ + "598560", + "5117050" + ], + "webstr_hg19": [ + "Expansion_SCA2/ATXN2" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "maternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_phenotype", + "length_affects_severity", + "motif_affects_instability", + "motif_affects_phenotype", + "proposed_modifier" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK1275", + "omim:183090", + "pmid:37906407", + "pmid:12116207", + "pmid:30533529", + "pmid:25285812", + "pmid:32954321", + "pmid:39956874", + "pmid:29100084", + "pmid:8896556", + "mondo:0008458" + ], + "additional_literature": [ + "pmid:42204920", + "pmid:42196324", + "pmid:42096001", + "pmid:42087256", + "pmid:42019185", + "pmid:41912844", + "pmid:41876820", + "pmid:41771688", + "pmid:41728197", + "pmid:41693683", + "pmid:41683965", + "pmid:41630926", + "pmid:41435767", + "pmid:41426430", + "pmid:41373690", + "pmid:41359433", + "pmid:41310328", + "pmid:41298695", + "pmid:41196070", + "pmid:41149812", + "pmid:41082794", + "pmid:41077586", + "pmid:41071260", + "pmid:41009775", + "pmid:41001200", + "pmid:40908144", + "pmid:40906330", + "pmid:40900235", + "pmid:40746751", + "pmid:40684213", + "pmid:40556342", + "pmid:40488180", + "pmid:40346885", + "pmid:40220918", + "pmid:40004498", + "pmid:39940702", + "pmid:39820777", + "pmid:39812846", + "pmid:39804470", + "pmid:39571249", + "pmid:39521966", + "pmid:39512795", + "pmid:39457708", + "pmid:39420034", + "pmid:39317855", + "pmid:39209824", + "pmid:39200113", + "pmid:39048885", + "pmid:39004246", + "pmid:38961870", + "pmid:38715656", + "pmid:38667292", + "pmid:38642323", + "pmid:38626762", + "pmid:38585669", + "pmid:38419144", + "pmid:38397958", + "pmid:38340219", + "pmid:38239855", + "pmid:38227102", + "pmid:38165578", + "pmid:38152578", + "pmid:37848721", + "pmid:37821389", + "pmid:37397792", + "pmid:37379724", + "pmid:37202167", + "pmid:37146135", + "pmid:37070044", + "pmid:37043475", + "pmid:37003406", + "pmid:36894829", + "pmid:36823368", + "pmid:36618024", + "pmid:36530930", + "pmid:36209056", + "pmid:36008116", + "pmid:35989899", + "pmid:35962273", + "pmid:35869263", + "pmid:35787375", + "pmid:35599735", + "pmid:35525134", + "pmid:35521889", + "pmid:35297556", + "pmid:35188716", + "pmid:35182509", + "pmid:35052497", + "pmid:34565721", + "pmid:34430069", + "pmid:34390268", + "pmid:34372915", + "pmid:34350994", + "pmid:34298214", + "pmid:34284285", + "pmid:34179866", + "pmid:34168085", + "pmid:34159894", + "pmid:34077532", + "pmid:33688396", + "pmid:33625581", + "pmid:33548146", + "pmid:33502644", + "pmid:33414559", + "pmid:33377399", + "pmid:33284045", + "pmid:33159825", + "pmid:33115537", + "pmid:33070405", + "pmid:33058338", + "pmid:33029780", + "pmid:32989102", + "pmid:32932600", + "pmid:32870233", + "pmid:32822634", + "pmid:32340607", + "pmid:32307524", + "pmid:32124191", + "pmid:32082115", + "pmid:31940111", + "pmid:31898278", + "pmid:31812845", + "pmid:31810584", + "pmid:31766565", + "pmid:31619481", + "pmid:31522753", + "pmid:31432357", + "pmid:31343735", + "pmid:30920184", + "pmid:30891880", + "pmid:30847648", + "pmid:30615214", + "pmid:30611021", + "pmid:30591349", + "pmid:30417124", + "pmid:30342765", + "pmid:30342763", + "pmid:30314815", + "pmid:30196130", + "pmid:30123518", + "pmid:30120431", + "pmid:29959555", + "pmid:29934271", + "pmid:29895397", + "pmid:29848387", + "pmid:29801887", + "pmid:29801076", + "pmid:29756284", + "pmid:29715545", + "pmid:29666341", + "pmid:29665996", + "pmid:29553382", + "pmid:29497168", + "pmid:29468174", + "pmid:29462666", + "pmid:29249939", + "pmid:29080331", + "pmid:29057148", + "pmid:29046994", + "pmid:28923333", + "pmid:28782341", + "pmid:28642336", + "pmid:28585930", + "pmid:28534046", + "pmid:30363439", + "pmid:28527524", + "pmid:28525545", + "pmid:28444220", + "pmid:28263872", + "pmid:28124431", + "pmid:28017238", + "pmid:27896316", + "pmid:27848087", + "pmid:27774050", + "pmid:27531668", + "pmid:27333979", + "pmid:27245636", + "pmid:26846400", + "pmid:26777436", + "pmid:26733254", + "pmid:26599997", + "pmid:26551617", + "pmid:26377379", + "pmid:26374734", + "pmid:26362908", + "pmid:26354989", + "pmid:26095883", + "pmid:26086378", + "pmid:26077168", + "pmid:26054379", + "pmid:25893506", + "pmid:25790475", + "pmid:25721894", + "pmid:25634432", + "pmid:25527265", + "pmid:25466696", + "pmid:25189938", + "pmid:25189117", + "pmid:25111021", + "pmid:25098532", + "pmid:24972706", + "pmid:24908169", + "pmid:24866401", + "pmid:24780882", + "pmid:24780439", + "pmid:24718895", + "pmid:24534762", + "pmid:24269018", + "pmid:24209901", + "pmid:23959108", + "pmid:23844332", + "pmid:23635656", + "pmid:23634774", + "pmid:23368522", + "pmid:23197749", + "pmid:23047744", + "pmid:23026538", + "pmid:22868089", + "pmid:22831947", + "pmid:22650353", + "pmid:22520093", + "pmid:22507827", + "pmid:22425256", + "pmid:22297462", + "pmid:22053702", + "pmid:22035589", + "pmid:21889984", + "pmid:21880993", + "pmid:21832228", + "pmid:21741123", + "pmid:21610160", + "pmid:21600833", + "pmid:21562247", + "pmid:21537950", + "pmid:21479228", + "pmid:21329459", + "pmid:20960485", + "pmid:20740007", + "pmid:20095980", + "pmid:20070987", + "pmid:20069235", + "pmid:22353486", + "pmid:19676102", + "pmid:19672991", + "pmid:19473475", + "pmid:19429075", + "pmid:19049837", + "pmid:18990604", + "pmid:18759344", + "pmid:18685131", + "pmid:18418678", + "pmid:18297329", + "pmid:18182848", + "pmid:18028243", + "pmid:17961920", + "pmid:17923635", + "pmid:17712857", + "pmid:17620498", + "pmid:17568014", + "pmid:17440947", + "pmid:17420317", + "pmid:16687213", + "pmid:16436644", + "pmid:16389595", + "pmid:16000334", + "pmid:15911147", + "pmid:15747371", + "pmid:22473187", + "pmid:15553088", + "pmid:15533937", + "pmid:15504570", + "pmid:15300851", + "pmid:15265035", + "pmid:15148151", + "pmid:15133829", + "pmid:15080863", + "pmid:14967767", + "pmid:14966163", + "pmid:14756671", + "pmid:14732617", + "pmid:12853230", + "pmid:12812977", + "pmid:12810491", + "pmid:12764052", + "pmid:12682323", + "pmid:12671950", + "pmid:12614315", + "pmid:12490063", + "pmid:12235319", + "pmid:12039668", + "pmid:11939898", + "pmid:11889231", + "pmid:11839840", + "pmid:11804332", + "pmid:11719273", + "pmid:11689490", + "pmid:11591855", + "pmid:11502947", + "pmid:11448300", + "pmid:11374096", + "pmid:11160961", + "pmid:10369884", + "pmid:11030803", + "pmid:11030410", + "pmid:10953195", + "pmid:10942107", + "pmid:10915763", + "pmid:10894992", + "pmid:10785256", + "pmid:10768629", + "pmid:10766906", + "pmid:10642945", + "pmid:10573020", + "pmid:10525984", + "pmid:10525976", + "pmid:10453742", + "pmid:10219787", + "pmid:10210910", + "pmid:10050970", + "pmid:9973298", + "pmid:9855520", + "pmid:9779806", + "pmid:9776463", + "pmid:9762957", + "pmid:9758625", + "pmid:9748675", + "pmid:9741408", + "pmid:9710044", + "pmid:9696528", + "pmid:9674805", + "pmid:9613852", + "pmid:9588855", + "pmid:9577387", + "pmid:9549522", + "pmid:9507387", + "pmid:9436730", + "pmid:9385362", + "pmid:9403486", + "pmid:9403480", + "pmid:9339711", + "pmid:9339681", + "pmid:9259275", + "pmid:9225982", + "pmid:10735276", + "pmid:9106530", + "pmid:9020849", + "pmid:10464657", + "pmid:8968739", + "pmid:8896557", + "pmid:8896555", + "pmid:8559378", + "pmid:7477379", + "pmid:7762567" + ] + }, + { + "id": "SCA3_ATXN3", + "disease_id": "SCA3, MJD", + "gene": "ATXN3", + "evidence": [ + "Definitive" + ], + "chrom": "chr14", + "start_hg38": 92071010, + "stop_hg38": 92071052, + "start_hg19": 92537354, + "stop_hg19": 92537396, + "start_t2t": 86300519, + "stop_t2t": 86300603, + "disease": "Spinocerebellar ataxia type 3/Machado-Joseph disease", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease, is the most common subtype of type 1 autosomal dominant cerebellar ataxia (ADCA type 1), a neurodegenerative disorder, and is characterized by ataxia, external progressive ophthalmoplegia, and other neurological manifestations [@mondo:0007182]. Research suggests that length of ATXN2 expansions may affect the phenotype of SCA3 [@pmid:40684213].", + "hpo_terms": null, + "prevalence": "2.1/100000", + "prevalence_details": "1-5/100,000 [@pmid:29100084]. Most prevalent SCA subtype [@genereviews:NBK557816]. Found worldwide across ancestries/ethnicities [@genereviews:NBK1196].", + "age_onset": "Typical: 10-49 [@genereviews:NBK1196]; 3 [@pmid:40004498] - 73 [@genereviews:NBK1196; @pmid:30414314].", + "age_onset_min": 3, + "age_onset_max": 73, + "typ_age_onset_min": 10, + "typ_age_onset_max": 49, + "details": "Benign alleles range from 11-44 repeats [@pmid:37906407], with intermediate alleles (45-59) associated with incomplete penetrance and non-classic phenotypes [@genereviews:NBK1196]. The threshold between incomplete and full penetrance is unclear, but presumed to occur at ~60 repeats [@genereviews:NBK1196; @pmid:37906407]. The interruption CAA has been observed [@pmid:35245110]; AAG is present in hg38 reference sequence. The APOE ε4 allele appears to act as a disease modifier [@pmid:39731318]; GLS expansions may also function as disease modifiers [@pmid:39699045].", + "detection": "PCR fragment analysis or RP-PCR typically detect expansions, but homozygous PCR results may require Southern blotting to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1196]. Long-read sequencing can characterize full structure [@pmid:40890629].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to gain of function; aggregated and mislocalized proteins in neurons [@pmid:36169768; @genereviews:NBK1196].", + "year": "1994 [@pmid:7874163]", + "location_in_gene": "Coding Exon 10", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CTG" + ], + "pathogenic_motif_reference_orientation": [ + "CTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "TTG", + "AGG" + ], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AAC", + "CCT" + ], + "locus_structure": [], + "benign_min": 11, + "benign_max": 44, + "intermediate_min": 45, + "intermediate_max": 59, + "pathogenic_min": 60, + "pathogenic_max": 87, + "motif_len": 3, + "ref_copies": 14, + "novel": "ref", + "gard": [ + "6801" + ], + "genereviews": [ + "NBK1196" + ], + "malacard": [ + "MCH002" + ], + "medgen": [ + "9841" + ], + "mondo": [ + "0007182" + ], + "omim": [ + "109150" + ], + "orphanet": [ + "98757" + ], + "gnomad": [ + "ATXN3" + ], + "stripy": [ + "ATXN3" + ], + "tr_atlas": [ + "TR132758" + ], + "webstr_hg38": [ + "5316666", + "1481402" + ], + "webstr_hg19": [ + "Expansion_SCA3_MJD/ATXN3" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "maternal_expansion", + "length_affects_onset", + "length_affects_phenotype", + "length_affects_severity" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK1196", + "pmid:40004498", + "pmid:30414314", + "pmid:36169768", + "pmid:37906407", + "pmid:35245110", + "pmid:39731318", + "pmid:39699045", + "pmid:29100084", + "genereviews:NBK557816", + "pmid:7874163", + "mondo:0007182", + "pmid:40684213" + ], + "additional_literature": [ + "pmid:42191105", + "pmid:42105168", + "pmid:42096001", + "pmid:41854058", + "pmid:41853947", + "pmid:41818480", + "pmid:41771688", + "pmid:41736717", + "pmid:41713739", + "pmid:41701293", + "pmid:41613623", + "pmid:41612618", + "pmid:41552385", + "pmid:41435767", + "pmid:41358280", + "pmid:41082794", + "pmid:41058593", + "pmid:41009775", + "pmid:41001200", + "pmid:40906330", + "pmid:40900235", + "pmid:40890629", + "pmid:40880681", + "pmid:40797466", + "pmid:40754098", + "pmid:40738252", + "pmid:40692435", + "pmid:40635703", + "pmid:40488202", + "pmid:40488180", + "pmid:40450087", + "pmid:40204795", + "pmid:40178277", + "pmid:40152810", + "pmid:39987589", + "pmid:39921113", + "pmid:39820777", + "pmid:39571249", + "pmid:39516744", + "pmid:39456985", + "pmid:39375222", + "pmid:39317855", + "pmid:39298485", + "pmid:39229124", + "pmid:39125643", + "pmid:39088078", + "pmid:39048885", + "pmid:38961870", + "pmid:38900277", + "pmid:38626762", + "pmid:38513302", + "pmid:38449714", + "pmid:38443995", + "pmid:38429929", + "pmid:38291334", + "pmid:38227102", + "pmid:38165578", + "pmid:38152578", + "pmid:37961108", + "pmid:37866221", + "pmid:37848721", + "pmid:37830620", + "pmid:37830611", + "pmid:37735371", + "pmid:37397792", + "pmid:37379724", + "pmid:37333326", + "pmid:37215811", + "pmid:37122622", + "pmid:37003406", + "pmid:36907537", + "pmid:36891289", + "pmid:36875652", + "pmid:36733922", + "pmid:36618024", + "pmid:36530930", + "pmid:36482247", + "pmid:36250694", + "pmid:35997830", + "pmid:35962273", + "pmid:35952620", + "pmid:35851059", + "pmid:35847233", + "pmid:35426475", + "pmid:35421843", + "pmid:35406787", + "pmid:35188716", + "pmid:35182509", + "pmid:35052497", + "pmid:35042771", + "pmid:34783886", + "pmid:34716557", + "pmid:34706018", + "pmid:34565721", + "pmid:34473252", + "pmid:34430069", + "pmid:34284285", + "pmid:34191270", + "pmid:34167352", + "pmid:34160773", + "pmid:34159894", + "pmid:34087977", + "pmid:33893204", + "pmid:33782863", + "pmid:33743045", + "pmid:33502644", + "pmid:33468086", + "pmid:33413375", + "pmid:33371889", + "pmid:33159825", + "pmid:33157084", + "pmid:33087504", + "pmid:33058338", + "pmid:32978817", + "pmid:32822634", + "pmid:32729243", + "pmid:32205441", + "pmid:31934455", + "pmid:31920494", + "pmid:31783119", + "pmid:31687087", + "pmid:31616370", + "pmid:31565539", + "pmid:31394429", + "pmid:31374463", + "pmid:31310802", + "pmid:31230722", + "pmid:30920184", + "pmid:30891880", + "pmid:30833927", + "pmid:30804982", + "pmid:30685895", + "pmid:30615214", + "pmid:30591349", + "pmid:30554804", + "pmid:30314815", + "pmid:30231063", + "pmid:30125433", + "pmid:30120431", + "pmid:30008965", + "pmid:29959555", + "pmid:29936336", + "pmid:29922950", + "pmid:29881950", + "pmid:29852360", + "pmid:29801869", + "pmid:29737427", + "pmid:29666341", + "pmid:29553382", + "pmid:29497168", + "pmid:29444500", + "pmid:29249939", + "pmid:29057148", + "pmid:28854700", + "pmid:28782341", + "pmid:28624196", + "pmid:28585930", + "pmid:28444220", + "pmid:28158474", + "pmid:28065793", + "pmid:27942452", + "pmid:27896316", + "pmid:27848087", + "pmid:27847820", + "pmid:27596958", + "pmid:27774050", + "pmid:27731380", + "pmid:27600091", + "pmid:27333979", + "pmid:26615955", + "pmid:26601773", + "pmid:26505994", + "pmid:26467707", + "pmid:26377379", + "pmid:26374734", + "pmid:26362908", + "pmid:26354989", + "pmid:26336829", + "pmid:26266536", + "pmid:26083476", + "pmid:26077168", + "pmid:26067219", + "pmid:26054379", + "pmid:30363545", + "pmid:25700012", + "pmid:25634432", + "pmid:25633985", + "pmid:25590633", + "pmid:25466696", + "pmid:25320121", + "pmid:25144244", + "pmid:25143392", + "pmid:25068645", + "pmid:25026993", + "pmid:24972706", + "pmid:24780882", + "pmid:24746364", + "pmid:24675225", + "pmid:24534762", + "pmid:24525517", + "pmid:24242192", + "pmid:23844332", + "pmid:23775343", + "pmid:23659897", + "pmid:23423669", + "pmid:23413156", + "pmid:23382971", + "pmid:23368522", + "pmid:23026538", + "pmid:22520093", + "pmid:22351852", + "pmid:22297462", + "pmid:22090366", + "pmid:22023810", + "pmid:21975858", + "pmid:21889984", + "pmid:21832228", + "pmid:21795378", + "pmid:21780213", + "pmid:21625753", + "pmid:21600833", + "pmid:21506152", + "pmid:20726892", + "pmid:20503052", + "pmid:20484674", + "pmid:20467850", + "pmid:20334689", + "pmid:20069235", + "pmid:22353486", + "pmid:19802879", + "pmid:19699305", + "pmid:19672991", + "pmid:19631275", + "pmid:19608203", + "pmid:19597981", + "pmid:19503814", + "pmid:19412185", + "pmid:19049837", + "pmid:18990604", + "pmid:18759344", + "pmid:18685131", + "pmid:18506570", + "pmid:18449188", + "pmid:18418678", + "pmid:18413477", + "pmid:18385100", + "pmid:18261802", + "pmid:18182848", + "pmid:18071041", + "pmid:18028243", + "pmid:17961920", + "pmid:17948873", + "pmid:17712857", + "pmid:17594286", + "pmid:17440947", + "pmid:17420317", + "pmid:17116127", + "pmid:17027034", + "pmid:16967484", + "pmid:16791428", + "pmid:16724006", + "pmid:16687213", + "pmid:16389595", + "pmid:16340213", + "pmid:16241973", + "pmid:15911147", + "pmid:15747371", + "pmid:22473187", + "pmid:15553088", + "pmid:15534186", + "pmid:15504352", + "pmid:15265035", + "pmid:15223312", + "pmid:15201448", + "pmid:15167689", + "pmid:15148151", + "pmid:15080863", + "pmid:15026782", + "pmid:14966163", + "pmid:14756671", + "pmid:14679302", + "pmid:14616293", + "pmid:12938149", + "pmid:12853230", + "pmid:12832059", + "pmid:12810491", + "pmid:12764052", + "pmid:12614315", + "pmid:12486728", + "pmid:12433269", + "pmid:12235319", + "pmid:12042281", + "pmid:12007862", + "pmid:11978767", + "pmid:11889231", + "pmid:11839840", + "pmid:11807410", + "pmid:11804332", + "pmid:11559318", + "pmid:11448300", + "pmid:11466410", + "pmid:11409435", + "pmid:11405804", + "pmid:11374096", + "pmid:11160961", + "pmid:10369884", + "pmid:11030803", + "pmid:11030410", + "pmid:10942107", + "pmid:10915763", + "pmid:10894992", + "pmid:10855623", + "pmid:10785256", + "pmid:10768629", + "pmid:10766906", + "pmid:10732811", + "pmid:10717003", + "pmid:10575843", + "pmid:10525976", + "pmid:10453742", + "pmid:10433966", + "pmid:10072437", + "pmid:10071104", + "pmid:9973298", + "pmid:9855520", + "pmid:9762957", + "pmid:9758625", + "pmid:9696528", + "pmid:9674805", + "pmid:9635424", + "pmid:9613852", + "pmid:9536097", + "pmid:9588850", + "pmid:9577387", + "pmid:9562258", + "pmid:9549522", + "pmid:9532283", + "pmid:9469848", + "pmid:9507387", + "pmid:9506544", + "pmid:9415538", + "pmid:9450899", + "pmid:9436730", + "pmid:9385362", + "pmid:9371900", + "pmid:9403486", + "pmid:9403480", + "pmid:9339702", + "pmid:9339681", + "pmid:9292723", + "pmid:9259275", + "pmid:9254842", + "pmid:9225982", + "pmid:9215676", + "pmid:10735276", + "pmid:9124808", + "pmid:9106530", + "pmid:9132496", + "pmid:9020849", + "pmid:10464657", + "pmid:9401013", + "pmid:8962095", + "pmid:9088110", + "pmid:8968739", + "pmid:8931692", + "pmid:8937340", + "pmid:8836972", + "pmid:8659514", + "pmid:8609925", + "pmid:8655136", + "pmid:8780110", + "pmid:8644735", + "pmid:8815156", + "pmid:8824876", + "pmid:8926495", + "pmid:8900536", + "pmid:8800925", + "pmid:8559378", + "pmid:8559377", + "pmid:8583215", + "pmid:7574470", + "pmid:7573040", + "pmid:7496771", + "pmid:8523034", + "pmid:7668288", + "pmid:7611296", + "pmid:7762567", + "pmid:7655453", + "pmid:7633439" + ] + }, + { + "id": "SCA7_ATXN7", + "disease_id": "SCA7", + "gene": "ATXN7", + "evidence": [ + "Definitive" + ], + "chrom": "chr3", + "start_hg38": 63912684, + "stop_hg38": 63912715, + "start_hg19": 63898360, + "stop_hg19": 63898391, + "start_t2t": 63956302, + "stop_t2t": 63956333, + "disease": "Spinocerebellar ataxia type 7", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia-7 (SCA7) is an autosomal dominant neurodegenerative disorder characterized by adult onset of progressive cerebellar ataxia associated with pigmental macular dystrophy [@omim:164500].", + "hpo_terms": null, + "prevalence": "0.999/300000", + "prevalence_details": "<1/300,000: predominantly found in those with North European and African ancestry [@genereviews:NBK1256].", + "age_onset": "Typical: 4-48 [@pmid:20739808]; Range: 0-90 [@genereviews:NBK1256; @pmid:14571264].", + "age_onset_min": 0, + "age_onset_max": 65, + "typ_age_onset_min": 4, + "typ_age_onset_max": 48, + "details": "Benign alleles range from 4-27 [@pmid:37906407], with intermediate alleles ranging from premutations (28-33) to reduced penetrance (34-36) [@genereviews:NBK1256]. Interruptions observed include CAA [@pmid:35245110].", + "detection": "Short-read WGS cannot accurately detect repeat expansions at this locus. PCR fragment analysis or RP-PCR has detected expansions and sized most normal or moderate pathogenic alleles, while very large expansions have been detected with Southern blotting or long-read sequencing [@genereviews:NBK1256].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to gain of function; toxic misfolded intermediated suspected [@genereviews:NBK1256; @pmid:18418675].", + "year": "1996 [@pmid:8908515]", + "location_in_gene": "Coding Exon 1, 2, or 3 (depending on isoform)", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "CAG", + "count": null, + "type": "pathogenic_repeat" + }, + { + "motif": "CCG", + "count": 4, + "type": "flank_repeat" + } + ], + "benign_min": 4, + "benign_max": 27, + "intermediate_min": 28, + "intermediate_max": 35, + "pathogenic_min": 37, + "pathogenic_max": 460, + "motif_len": 3, + "ref_copies": 10.7, + "novel": "ref", + "gard": [ + "20405" + ], + "genereviews": [ + "NBK1256" + ], + "malacard": [ + "SPN291" + ], + "medgen": [ + "156006" + ], + "mondo": [ + "0016163" + ], + "omim": [ + "164500" + ], + "orphanet": [ + "94147" + ], + "gnomad": [ + "ATXN7" + ], + "stripy": [ + "ATXN7" + ], + "tr_atlas": [ + "TR31879", + "TR31880" + ], + "webstr_hg38": [ + "4965588" + ], + "webstr_hg19": [ + "Expansion_SCA7/ATXN7" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_phenotype", + "length_affects_severity" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "pmid:20739808", + "genereviews:NBK1256", + "pmid:14571264", + "pmid:18418675", + "pmid:37906407", + "pmid:35245110", + "pmid:8908515", + "omim:164500" + ], + "additional_literature": [ + "pmid:41771688", + "pmid:41254939", + "pmid:40900235", + "pmid:40488180", + "pmid:40417743", + "pmid:39820777", + "pmid:39649105", + "pmid:39571249", + "pmid:39504355", + "pmid:39317855", + "pmid:39053472", + "pmid:38961870", + "pmid:38906973", + "pmid:38851031", + "pmid:38673939", + "pmid:38626762", + "pmid:38227102", + "pmid:38165578", + "pmid:38152578", + "pmid:38045332", + "pmid:37986914", + "pmid:37848721", + "pmid:37283503", + "pmid:37214832", + "pmid:36618024", + "pmid:36530930", + "pmid:35422034", + "pmid:35182509", + "pmid:35052497", + "pmid:34870541", + "pmid:34565721", + "pmid:34160002", + "pmid:34159894", + "pmid:33995769", + "pmid:33626063", + "pmid:32138195", + "pmid:31694722", + "pmid:31522753", + "pmid:31269856", + "pmid:30891880", + "pmid:30721448", + "pmid:30699348", + "pmid:30615214", + "pmid:30381411", + "pmid:30314815", + "pmid:30255962", + "pmid:30120431", + "pmid:29801887", + "pmid:29462666", + "pmid:29316893", + "pmid:29249939", + "pmid:29248324", + "pmid:28597910", + "pmid:28585930", + "pmid:28568901", + "pmid:28444220", + "pmid:27999335", + "pmid:27774050", + "pmid:27632585", + "pmid:27333979", + "pmid:27044733", + "pmid:26584329", + "pmid:26374734", + "pmid:26077168", + "pmid:25900954", + "pmid:25755283", + "pmid:25643591", + "pmid:25608122", + "pmid:25506882", + "pmid:25466696", + "pmid:25306109", + "pmid:24972706", + "pmid:24667781", + "pmid:24534762", + "pmid:24209901", + "pmid:23828024", + "pmid:23368522", + "pmid:23197655", + "pmid:23064575", + "pmid:23026538", + "pmid:22831947", + "pmid:22520093", + "pmid:22072678", + "pmid:22053702", + "pmid:21689595", + "pmid:21147232", + "pmid:20069235", + "pmid:19226466", + "pmid:19008940", + "pmid:18418678", + "pmid:18325672", + "pmid:18182848", + "pmid:17961920", + "pmid:17420317", + "pmid:17254003", + "pmid:16626296", + "pmid:16436644", + "pmid:16434483", + "pmid:16389941", + "pmid:16389595", + "pmid:16325416", + "pmid:15750685", + "pmid:15715978", + "pmid:22473187", + "pmid:15349877", + "pmid:15148151", + "pmid:15115762", + "pmid:15080863", + "pmid:14967767", + "pmid:14966163", + "pmid:12810491", + "pmid:12764052", + "pmid:12490531", + "pmid:11939898", + "pmid:11889231", + "pmid:11839840", + "pmid:11804332", + "pmid:11781712", + "pmid:11580893", + "pmid:11448300", + "pmid:11160961", + "pmid:10369884", + "pmid:11030825", + "pmid:11030806", + "pmid:11030410", + "pmid:10942107", + "pmid:10894992", + "pmid:10841760", + "pmid:10785256", + "pmid:10768629", + "pmid:10766906", + "pmid:10602364", + "pmid:10556295", + "pmid:9467013", + "pmid:10500272", + "pmid:10453742", + "pmid:10441328", + "pmid:9973298", + "pmid:9855520", + "pmid:9736784", + "pmid:9613852", + "pmid:9536097", + "pmid:9425224", + "pmid:9425223", + "pmid:9425222", + "pmid:9425905", + "pmid:9385362", + "pmid:9288099", + "pmid:10464657" + ] + }, + { + "id": "SCA8_ATXN8OS", + "disease_id": "SCA8", + "gene": "ATXN8OS", + "evidence": [ + "Definitive" + ], + "chrom": "chr13", + "start_hg38": 70139383, + "stop_hg38": 70139429, + "start_hg19": 70713515, + "stop_hg19": 70713561, + "start_t2t": 69361243, + "stop_t2t": 69361270, + "disease": "Spinocerebellar ataxia type 8", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 8 (SCA8) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by cerebellar ataxia and cognitive dysfunction in almost three quarters of patients and pyramidal and sensory signs in approximately a third of patients [@mondo:0012116].", + "hpo_terms": null, + "prevalence": "0.5/100000", + "prevalence_details": "<1/100,000 [@pmid:29100084]; expansion in 1:100-1200 chromosomes [@genereviews:NBK1268]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1268].", + "age_onset": "Typical: third to fifth decade (20-49); Range: 0 [@genereviews:NBK1268] - 76 [@pmid:40015980].", + "age_onset_min": 0, + "age_onset_max": 76, + "typ_age_onset_min": 20, + "typ_age_onset_max": 49, + "details": "Two genes span the CTG/CAG repeat and are expressed in opposite directions: ATXN8, a nearly pure polyglutamine repeat protein in the CAG direction, and ATXN8OS, which is transcribed to a noncoding CUG repeat RNA [@pmid:16804541]. Reduced penetrance is found in alleles of all sizes, although penetrance appears higher at 71+ repeats and repeats at 50-70 appear less likely to result in disease [@genereviews:NBK1268; @pmid:20373340]. Roda et al. suggested that the ATXN8 or ATXN8OS gene should not be evaluated in isolation as a candidate gene for spinocerebellar degenerative disease [@pmid:28451643]. CCG/CGG interruptions in high-penetrance SCA8 families increase RAN translation and protein toxicity [@pmid:34632710]; Interruptions in CTG/CAG expansion by 1 or more CCG/CGG, CTA/TAG, CTC/GAG, CCA/TGG, or CTT/AAG trinucleotides have been observed in full-penetrance repeats [@pmid:16804541; @genereviews:NBK1268].", + "detection": "Short-read genome sequencing has been reported to underestimate expansion size [@pmid:40015980; @genereviews:NBK1268]. RP-PCR has detected large expansions while long-read sequencing and Southern blotting estimated size more accurately [@genereviews:NBK1268].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine/toxic gain-of-function [@omim:608768; @genereviews:NBK1268].", + "year": "1999 [@pmid:10192387]", + "location_in_gene": "Coding Exon 1, or 3' UTR depending on transcript", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CTG" + ], + "pathogenic_motif_reference_orientation": [ + "CTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "CCG", + "CTA", + "CTC", + "CCA", + "CTT" + ], + "pathogenic_motif_gene_orientation": [ + "CTG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "CCG", + "ACT", + "CCT", + "ACC", + "CTT" + ], + "locus_structure": [ + { + "motif": "CTA", + "count": 10, + "type": "flank_repeat" + }, + { + "motif": "CTG", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 15, + "benign_max": 50, + "intermediate_min": 50, + "intermediate_max": 70, + "pathogenic_min": 71, + "pathogenic_max": 1300, + "motif_len": 3, + "ref_copies": 15.3, + "novel": "ref", + "gard": [ + "4956" + ], + "genereviews": [ + "NBK1268" + ], + "malacard": [ + "SPN304" + ], + "medgen": [ + "332457" + ], + "mondo": [ + "0012116" + ], + "omim": [ + "608768" + ], + "orphanet": [ + "98760" + ], + "gnomad": [ + "ATXN8OS" + ], + "stripy": [ + "ATXN8OS" + ], + "tr_atlas": [ + "TR125263", + "TR125264" + ], + "webstr_hg38": [ + "5356762" + ], + "webstr_hg19": [ + "Expansion_SCA8/ATXN8" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "maternal_expansion", + "motif_affects_onset", + "motif_affects_penetrance" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK1268", + "doi:10.1101/gr.279634.124", + "omim:608768", + "pmid:16804541", + "pmid:20373340", + "pmid:28451643", + "pmid:34632710", + "pmid:29100084", + "pmid:10192387", + "mondo:0012116" + ], + "additional_literature": [ + "pmid:41771688", + "pmid:41762523", + "pmid:41353794", + "pmid:41082794", + "pmid:41079917", + "pmid:41074692", + "pmid:41001200", + "pmid:40906330", + "pmid:40890648", + "pmid:40844737", + "pmid:40765612", + "pmid:40488180", + "pmid:40007153", + "pmid:38961870", + "pmid:38227102", + "pmid:38165578", + "pmid:38152578", + "pmid:37906407", + "pmid:37848721", + "pmid:37146135", + "pmid:37003406", + "pmid:36703300", + "pmid:36530930", + "pmid:34622207", + "pmid:34600502", + "pmid:34284285", + "pmid:33526774", + "pmid:33502644", + "pmid:31471687", + "pmid:30109267", + "pmid:29316893", + "pmid:29111027", + "pmid:28782341", + "pmid:28229454", + "pmid:27896316", + "pmid:26374734", + "pmid:26077168", + "pmid:25466696", + "pmid:23711133", + "pmid:23026538", + "pmid:22581592", + "pmid:22520093", + "pmid:22297462", + "pmid:22053702", + "pmid:21173221", + "pmid:20403608", + "pmid:19259763", + "pmid:19229559", + "pmid:18684474", + "pmid:18418692", + "pmid:17961920", + "pmid:17005861", + "pmid:16184604", + "pmid:16054804", + "pmid:15553088", + "pmid:15148151", + "pmid:15080863", + "pmid:14972680", + "pmid:14966163", + "pmid:14960773", + "pmid:14756671", + "pmid:12838526", + "pmid:12764052", + "pmid:12545428", + "pmid:12505613", + "pmid:12470185", + "pmid:12431257", + "pmid:12372061", + "pmid:12140678", + "pmid:12042281", + "pmid:11939898", + "pmid:11839840", + "pmid:11807410", + "pmid:11708995", + "pmid:11591855", + "pmid:11448300", + "pmid:11160961", + "pmid:11121196", + "pmid:11102643", + "pmid:11030410", + "pmid:10976642", + "pmid:10958651", + "pmid:10785256", + "pmid:10712198", + "pmid:10700168", + "pmid:10690991" + ] + }, { - "motif": "CTA", - "count": 10, - "type": "flank_repeat" + "id": "SCA31_BEAN1", + "disease_id": "SCA31", + "gene": "BEAN1", + "evidence": [ + "Definitive" + ], + "chrom": "chr16", + "start_hg38": 66490396, + "stop_hg38": 66490466, + "start_hg19": 66524299, + "stop_hg19": 66524369, + "start_t2t": 72284666, + "stop_t2t": 72284761, + "disease": "Spinocerebellar ataxia type 31", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 31 (SCA31) is a very rare subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by the late-onset of cerebral ataxia, dysarthria and horizontal gaze nystagmus, and that is occasionally accompanied by pyramidal signs, tremor, decreased vibration sense and hearing difficulties [@mondo:0007296].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Has been found in Japanese populations [@omim:117210] and then once respectively in a Korean and a Chinese family [@pmid:36563608].", + "age_onset": "Typical: 56-62 [@pmid:36563608]; Range: 8-83 [@pmid:23331413].", + "age_onset_min": 8, + "age_onset_max": 83, + "typ_age_onset_min": 56, + "typ_age_onset_max": 62, + "details": "This locus is a novel STR-containing insertion, not present in reference genome; the pathogenic threshold (110-760) is based on the pure repeat of the pathogenic motif within the insertion [@pmid:19878914].", + "detection": "RP-PCR has accurately detected this insertion [@pmid:22992774], while long-read sequencing has resolved size and motif architecture [@pmid:36289212].", + "mechanism": "GoF", + "mechanism_detail": "RNA toxicity and gain of function leading to neurodegeneration [@pmid:36371266]. Role in heterochromatin or chromosomal structure theorized [@omim:117210].", + "year": "2009 [@pmid:19878914]", + "location_in_gene": "Intron 4/4", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "AATAA" + ], + "pathogenic_motif_reference_orientation": [ + "TGGAA", + "TAGAA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "AAAAA", + "AAAAC", + "AAATG", + "AGAAA", + "ATAAG", + "TAAAC", + "TAACA", + "TACAA", + "TCAAA", + "TGCAA" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AATGG", + "AATAG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "AAAAA", + "AAAAC", + "AAATG", + "AAAAG", + "AAGAT", + "AAACT", + "AACAT", + "AATAC", + "AAATC", + "AATGC" + ], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 110, + "pathogenic_max": 760, + "motif_len": 5, + "ref_copies": 14.4, + "novel": "novel", + "gard": [ + "9975" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "SPN103" + ], + "medgen": [ + "348439" + ], + "mondo": [ + "0007296" + ], + "omim": [ + "117210" + ], + "orphanet": [ + "217012" + ], + "gnomad": [ + "BEAN1" + ], + "stripy": [ + "BEAN1" + ], + "tr_atlas": [ + "TR141992" + ], + "webstr_hg38": [ + "812447", + "5971756" + ], + "webstr_hg19": [ + "STR_539736" + ], + "locus_tags": [ + "anticipation", + "motif_affects_onset", + "motif_affects_penetrance" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "pmid:36563608", + "pmid:23331413", + "pmid:36371266", + "omim:117210", + "pmid:19878914", + "mondo:0007296" + ], + "additional_literature": [ + "pmid:41841436", + "pmid:41426430", + "pmid:40765612", + "pmid:40488180", + "pmid:38961870", + "pmid:38152578", + "pmid:37848721", + "pmid:36970617", + "pmid:36092952", + "pmid:35084690", + "pmid:33785066", + "pmid:33431896", + "pmid:32066831", + "pmid:31737797", + "pmid:29111027", + "pmid:28343865", + "pmid:24215022", + "pmid:23607545" + ] }, { - "motif": "CTG", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 15, - "benign_max": 50, - "intermediate_min": 50, - "intermediate_max": 70, - "pathogenic_min": 71, - "pathogenic_max": 1300, - "motif_len": 3, - "ref_copies": 15.3, - "novel": "ref", - "gard": ["4956"], - "genereviews": ["NBK1268"], - "malacard": ["SPN304"], - "medgen": ["332457"], - "mondo": ["0012116"], - "omim": ["608768"], - "orphanet": ["98760"], - "gnomad": ["ATXN8OS"], - "stripy": ["ATXN8OS"], - "tr_atlas": ["TR125263", "TR125264"], - "webstr_hg38": ["5356762"], - "webstr_hg19": ["Expansion_SCA8/ATXN8"], - "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "motif_affects_onset", "motif_affects_penetrance"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK1268", "doi:10.1101/gr.279634.124", "omim:608768", "pmid:16804541", "pmid:20373340", "pmid:28451643", "pmid:34632710", "pmid:29100084", "pmid:10192387", "mondo:0012116"], - "additional_literature": ["pmid:41771688", "pmid:41762523", "pmid:41353794", "pmid:41082794", "pmid:41079917", "pmid:41074692", "pmid:41001200", "pmid:40906330", "pmid:40890648", "pmid:40844737", "pmid:40765612", "pmid:40488180", "pmid:40007153", "pmid:38961870", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37906407", "pmid:37848721", "pmid:37146135", "pmid:37003406", "pmid:36703300", "pmid:36530930", "pmid:34622207", "pmid:34600502", "pmid:34284285", "pmid:33526774", "pmid:33502644", "pmid:31471687", "pmid:30109267", "pmid:29316893", "pmid:29111027", "pmid:28782341", "pmid:28229454", "pmid:27896316", "pmid:26374734", "pmid:26077168", "pmid:25466696", "pmid:23711133", "pmid:23026538", "pmid:22581592", "pmid:22520093", "pmid:22297462", "pmid:22053702", "pmid:21173221", "pmid:20403608", "pmid:19259763", "pmid:19229559", "pmid:18684474", "pmid:18418692", "pmid:17961920", "pmid:17005861", "pmid:16184604", "pmid:16054804", "pmid:15553088", "pmid:15148151", "pmid:15080863", "pmid:14972680", "pmid:14966163", "pmid:14960773", "pmid:14756671", "pmid:12838526", "pmid:12764052", "pmid:12545428", "pmid:12505613", "pmid:12470185", "pmid:12431257", "pmid:12372061", "pmid:12140678", "pmid:12042281", "pmid:11939898", "pmid:11839840", "pmid:11807410", "pmid:11708995", "pmid:11591855", "pmid:11448300", "pmid:11160961", "pmid:11121196", "pmid:11102643", "pmid:11030410", "pmid:10976642", "pmid:10958651", "pmid:10785256", "pmid:10712198", "pmid:10700168", "pmid:10690991"] -}, -{ - "id": "SCA31_BEAN1", - "disease_id": "SCA31", - "gene": "BEAN1", - "evidence": ["Definitive"], - "chrom": "chr16", - "start_hg38": 66490396, - "stop_hg38": 66490466, - "start_hg19": 66524299, - "stop_hg19": 66524369, - "start_t2t": 72284666, - "stop_t2t": 72284761, - "disease": "Spinocerebellar ataxia type 31", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 31 (SCA31) is a very rare subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by the late-onset of cerebral ataxia, dysarthria and horizontal gaze nystagmus, and that is occasionally accompanied by pyramidal signs, tremor, decreased vibration sense and hearing difficulties [@mondo:0007296].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Has been found in Japanese populations [@omim:117210] and then once respectively in a Korean and a Chinese family [@pmid:36563608].", - "age_onset": "Typical: 56-62 [@pmid:36563608]; Range: 8-83 [@pmid:23331413].", - "age_onset_min": 8.0, - "age_onset_max": 83.0, - "typ_age_onset_min": 56.0, - "typ_age_onset_max": 62.0, - "details": "This locus is a novel STR-containing insertion, not present in reference genome; the pathogenic threshold (110-760) is based on the pure repeat of the pathogenic motif within the insertion [@pmid:19878914].", - "detection": "RP-PCR has accurately detected this insertion [@pmid:22992774], while long-read sequencing has resolved size and motif architecture [@pmid:36289212].", - "mechanism": "GoF", - "mechanism_detail": "RNA toxicity and gain of function leading to neurodegeneration [@pmid:36371266]. Role in heterochromatin or chromosomal structure theorized [@omim:117210].", - "year": "2009 [@pmid:19878914]", - "location_in_gene": "Intron 4/4", - "gene_strand": "+", - "reference_motif_reference_orientation": ["AATAA"], - "pathogenic_motif_reference_orientation": ["TGGAA", "TAGAA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AAATG", "AGAAA", "ATAAG", "TAAAC", "TAACA", "TACAA", "TCAAA", "TGCAA"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AATGG", "AATAG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["AAAAA", "AAAAC", "AAATG", "AAAAG", "AAGAT", "AAACT", "AACAT", "AATAC", "AAATC", "AATGC"], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 110, - "pathogenic_max": 760, - "motif_len": 5, - "ref_copies": 14.4, - "novel": "novel", - "gard": ["9975"], - "genereviews": ["NBK535148"], - "malacard": ["SPN103"], - "medgen": ["348439"], - "mondo": ["0007296"], - "omim": ["117210"], - "orphanet": ["217012"], - "gnomad": ["BEAN1"], - "stripy": ["BEAN1"], - "tr_atlas": ["TR141992"], - "webstr_hg38": ["812447", "5971756"], - "webstr_hg19": ["STR_539736"], - "locus_tags": ["anticipation", "motif_affects_onset", "motif_affects_penetrance"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["pmid:36563608", "pmid:23331413", "pmid:36371266", "omim:117210", "pmid:19878914", "mondo:0007296"], - "additional_literature": ["pmid:41841436", "pmid:41426430", "pmid:40765612", "pmid:40488180", "pmid:38961870", "pmid:38152578", "pmid:37848721", "pmid:36970617", "pmid:36092952", "pmid:35084690", "pmid:33785066", "pmid:33431896", "pmid:32066831", "pmid:31737797", "pmid:29111027", "pmid:28343865", "pmid:24215022", "pmid:23607545"] -}, -{ - "id": "FTDALS1_C9orf72", - "disease_id": "FTDALS1", - "gene": "C9orf72", - "evidence": ["Definitive"], - "chrom": "chr9", - "start_hg38": 27573484, - "stop_hg38": 27573546, - "start_hg19": 27573482, - "stop_hg19": 27573544, - "start_t2t": 27584063, - "stop_t2t": 27584155, - "disease": "Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS)", - "inheritance": ["AD"], - "association_type": ["Mendelian", "Risk"], - "disease_description": "Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:31315673]. Related individuals to patients with C9orf72-ALS appear at an increased risk of disease regardless of carrier status [@pmid:38149039; @pmid:39315390]. C9orf72-FTD is estimated to be 0.04-134:100,000 [@genereviews:NBK268647], and by our estimates 0.65-1.56/100,000 for C9orf72-ALS. The expansion has been found across ethnicities/ancestries, with population-dependent prevalence, highest in those with northern European ancestry [@genereviews:NBK268647].", - "age_onset": "Typical: 50-64; Range: 20-91 [@genereviews:NBK268647].", - "age_onset_min": 20.0, - "age_onset_max": 91.0, - "typ_age_onset_min": 50.0, - "typ_age_onset_max": 64.0, - "details": "FTD and ALS form a clinical spectrum [@pmid:37388914; @pmid:22406228]. The clinical ranges of the C9orf72 locus remain ambiguous [@stripy:C9ORF72][@pmid:41951733]: most healthy controls have alleles up to 24 repeats [@pmid:28319737] yet 24-30 repeats are associated with ALS [@pmid:31315673] and while 60 repeats is frequently used as a threshold for uncertain alleles, the exact threshold of pathogenicity remains unclear [@genereviews:NBK268647; @pmid:38099605]. Repeats of 80 motifs and lower appear to have delayed onset for any phenotype [@pmid:28319737]. >250 repeats are associated with a full FTD/ALS disease state [@pmid:31048495], but pathogenic alleles can range from 30 to more than 4000 repeats [@pmid:38099605; @pmid:39709476]. Somatic C9orf72 repeat expansions may emerge de novo in CNS tissue from alleles below the pathogenic range, potentially contributing to sporadic ALS/FTD [@pmid:41986690]. Penetrance appears to also be age-dependent, with environmental factors and specific phenotypes associated with sex and age at onset [@pmid:28522837]. Methylation appears to increase with expansion length and age [@pmid:39709476], and C9orf72 promoter hypermethylation has been observed in expansion carriers [@pmid:42222887]. ALS caused by repeat expansions in C9orf72 generally has an earlier disease onset and faster progression than other ALS presentations [@pmid:39226712]. C9orf72 expansions have been associated with reduced thalamic volume in undiagnosed carriers, and plasma neurofilament light chain has an approximately linear association with repeat count and motor neuron disease risk [@pmid:41951733; @pmid:42095061]. Pathogenic C9orf72 repeat expansions have also been identified in ambiguous late onset behavioral or psychiatric like presentations including executive deficits, apathy, and stereotyped behavior [@pmid:42158267].", - "detection": "Bidirectional RP-PCR is typically used for detection [@pmid:21944778]. Large pathogenic expansions are difficult to size exactly by PCR, so Southern blot is used to better estimate size [@pmid:23566336], while long-read sequencing provides direct sizing and sequence characterization [@pmid:30126445].", - "mechanism": "Ambiguous", - "mechanism_detail": "The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA/DNA hybrids (R-loops). The structural polymorphism causes a repeat length-dependent accumulation of transcripts aborted in the HRE region [@omim:105500]. Additional mechanisms theorized include protein loss-of-function and RNA gain-of-function [@pmid:37847372]. Multiple cell types in the prefrontal cortex, including oligodendrocytes, microglia, astrocytes, and neurons, appear impacted during pathogenesis [@pmid:39999167]. Drosophila model-system evidence suggests that RAN translated poly(GR) may contribute to toxicity by activating the integrated stress response through eIF2α phosphorylation and promoting stress granule accumulation [@pmid:42087256]. C9orf72 repeat expansions are associated with reduced C9orf72 expression in multiple ALS tissues and altered splicing of the exon 1a isoform [@pmid:42145639]. Reduced C9orf72 expression has also been observed in peripheral blood immune cells from C9orf72-associated ALS, with C9-ALS showing distinct monocyte activation signatures. In ALS spinal cord, activated myeloid cells expressing complement, lipid-processing, and phagocytic genes occur in regions with motor neuron loss and TDP-43 pathology [@pmid:42135512].", - "year": "2011 [@pmid:21944778]", - "location_in_gene": "Intron 1 or 5' UTR depending on transcript", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GGCCCC"], - "pathogenic_motif_reference_orientation": ["GGCCCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCGGGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 23, - "intermediate_min": 24, - "intermediate_max": 30, - "pathogenic_min": 31, - "pathogenic_max": 4088, - "motif_len": 6, - "ref_copies": 10.8, - "novel": "ref", - "gard": ["18396"], - "genereviews": ["NBK268647"], - "malacard": ["FRN044"], - "medgen": ["1830423"], - "mondo": ["0007105"], - "omim": ["105500"], - "orphanet": ["275872"], - "gnomad": ["C9ORF72"], - "stripy": ["C9ORF72"], - "tr_atlas": ["TR92417"], - "webstr_hg38": ["5877863", "1502453"], - "webstr_hg19": ["STR_1475506"], - "locus_tags": ["length_affects_phenotype", "length_affects_onset"], - "disease_tags": ["phenotypic_spectrum"], - "references": ["genereviews:NBK268647", "omim:105500", "pmid:37847372", "pmid:39999167", "pmid:37388914", "pmid:22406228", "stripy:C9ORF72", "pmid:41951733", "pmid:28319737", "pmid:31315673", "pmid:38099605", "pmid:31048495", "pmid:39709476", "pmid:41986690", "pmid:28522837", "pmid:39226712", "pmid:38149039", "pmid:39315390", "pmid:21944778", "pmid:39349043", "pmid:41074692", "pmid:41957010"], - "additional_literature": ["pmid:42222887", "pmid:42221822", "pmid:42211284", "pmid:42160515", "pmid:42158267", "pmid:42147445", "pmid:42145639", "pmid:42135512", "pmid:42095061", "pmid:42087256", "pmid:42033225", "pmid:41995858", "pmid:41993388", "pmid:41987036", "pmid:41961863", "pmid:41928938", "pmid:41917466", "pmid:41884597", "pmid:41856038", "pmid:41810938", "pmid:41799019", "pmid:41787388", "pmid:41766077", "pmid:41763422", "pmid:41762523", "pmid:41760955", "pmid:41757350", "pmid:41752089", "pmid:41751955", "pmid:41727102", "pmid:41717003", "pmid:41692171", "pmid:41665027", "pmid:41658940", "pmid:41643661", "pmid:41643021", "pmid:41640102", "pmid:41623487", "pmid:41612618", "pmid:41500252", "pmid:41440030", "pmid:41437053", "pmid:41426430", "pmid:41423553", "pmid:41394713", "pmid:41394638", "pmid:41379346", "pmid:41366786", "pmid:41359433", "pmid:41358323", "pmid:41294820", "pmid:41283823", "pmid:41278665", "pmid:41271630", "pmid:41269363", "pmid:41256634", "pmid:41240362", "pmid:41216140", "pmid:41196070", "pmid:41149812", "pmid:41149783", "pmid:41141812", "pmid:41137727", "pmid:41087751", "pmid:41063344", "pmid:41060790", "pmid:41040221", "pmid:41030957", "pmid:41025901", "pmid:41024438", "pmid:41009775", "pmid:41006764", "pmid:41005474", "pmid:41004400", "pmid:40992079", "pmid:40981770", "pmid:40966720", "pmid:40952044", "pmid:40930530", "pmid:40908789", "pmid:40891053", "pmid:40888599", "pmid:40875372", "pmid:40865525", "pmid:40832293", "pmid:40790269", "pmid:40776416", "pmid:40767591", "pmid:40765612", "pmid:40763713", "pmid:40758885", "pmid:40746751", "pmid:40709577", "pmid:40682810", "pmid:40621734", "pmid:40585812", "pmid:40581653", "pmid:40541176", "pmid:40536530", "pmid:40513650", "pmid:40504117", "pmid:40478310", "pmid:40426848", "pmid:40424855", "pmid:40411682", "pmid:40375307", "pmid:40349639", "pmid:40349338", "pmid:40346885", "pmid:40260680", "pmid:40250093", "pmid:40207633", "pmid:40203833", "pmid:40196659", "pmid:40150989", "pmid:40138021", "pmid:40073860", "pmid:40053600", "pmid:40050010", "pmid:40027671", "pmid:40000803", "pmid:39975241", "pmid:39957101", "pmid:39945490", "pmid:39920674", "pmid:39913612", "pmid:39894561", "pmid:39893487", "pmid:39869842", "pmid:39809899", "pmid:39779704", "pmid:39779681", "pmid:39764003", "pmid:39747573", "pmid:39730482", "pmid:39722074", "pmid:39711523", "pmid:39703094", "pmid:39670345", "pmid:39669124", "pmid:39638345", "pmid:39621905", "pmid:39589881", "pmid:39581338", "pmid:39569145", "pmid:39437787", "pmid:39417137", "pmid:39382125", "pmid:39345637", "pmid:39339364", "pmid:39323877", "pmid:39316747", "pmid:39316038", "pmid:39311028", "pmid:39289761", "pmid:39288267", "pmid:39282230", "pmid:39268612", "pmid:39270726", "pmid:39260140", "pmid:39256877", "pmid:39254359", "pmid:39253499", "pmid:39246336", "pmid:39233852", "pmid:39229486", "pmid:39222049", "pmid:39181135", "pmid:39146722", "pmid:39106320", "pmid:39098187", "pmid:39088455", "pmid:39059407", "pmid:39058450", "pmid:39056697", "pmid:39042693", "pmid:39000564", "pmid:38935506", "pmid:38915937", "pmid:38902980", "pmid:38896262", "pmid:38884646", "pmid:38876108", "pmid:38860430", "pmid:38852112", "pmid:38847891", "pmid:38799643", "pmid:38796984", "pmid:38753768", "pmid:38751620", "pmid:38746326", "pmid:38734896", "pmid:38722513", "pmid:38684907", "pmid:38667292", "pmid:38658168", "pmid:38641715", "pmid:38625400", "pmid:38621131", "pmid:38615685", "pmid:38613988", "pmid:38606777", "pmid:38585915", "pmid:38568044", "pmid:38556190", "pmid:38495583", "pmid:38464738", "pmid:38444607", "pmid:38431841", "pmid:38412259", "pmid:38397958", "pmid:38394210", "pmid:38376483", "pmid:38295729", "pmid:38312023", "pmid:38301895", "pmid:38260655", "pmid:38242117", "pmid:38234062", "pmid:38229533", "pmid:38191789", "pmid:38168370", "pmid:38168171", "pmid:38112783", "pmid:38110419", "pmid:38092738", "pmid:38064514", "pmid:38019311", "pmid:38009843", "pmid:37948524", "pmid:37891975", "pmid:37861203", "pmid:37845749", "pmid:37839080", "pmid:37827570", "pmid:37808871", "pmid:37791472", "pmid:37763163", "pmid:37736756", "pmid:37723585", "pmid:37714849", "pmid:37693322", "pmid:37686239", "pmid:37675986", "pmid:37648532", "pmid:37644512", "pmid:37590144", "pmid:37574738", "pmid:37548032", "pmid:37545231", "pmid:37527465", "pmid:37511014", "pmid:37471224", "pmid:37461319", "pmid:37450566", "pmid:37421883", "pmid:37399804", "pmid:37386798", "pmid:37379724", "pmid:37365312", "pmid:37339631", "pmid:37334257", "pmid:37333274", "pmid:37333144", "pmid:37332610", "pmid:37317656", "pmid:37294668", "pmid:37288312", "pmid:37223130", "pmid:37202167", "pmid:37178170", "pmid:37173134", "pmid:37147520", "pmid:37146135", "pmid:37138766", "pmid:37138765", "pmid:37133535", "pmid:37107688", "pmid:37080969", "pmid:37073950", "pmid:37043475", "pmid:37015082", "pmid:37010807", "pmid:37006326", "pmid:36963214", "pmid:36936421", "pmid:36857431", "pmid:36823368", "pmid:36822200", "pmid:36799407", "pmid:36764521", "pmid:36711601", "pmid:36650645", "pmid:36638803", "pmid:36619668", "pmid:36549973", "pmid:36515702", "pmid:36511680", "pmid:36511398", "pmid:36494425", "pmid:36482247", "pmid:36458975", "pmid:36454749", "pmid:36446586", "pmid:36443488", "pmid:36438488", "pmid:36409902", "pmid:36379394", "pmid:36373318", "pmid:36345033", "pmid:36322143", "pmid:36308529", "pmid:36271076", "pmid:36252286", "pmid:36226890", "pmid:36220889", "pmid:36219176", "pmid:36217158", "pmid:36202819", "pmid:36151083", "pmid:36148898", "pmid:36130523", "pmid:36108486", "pmid:36103513", "pmid:38933387", "pmid:36070099", "pmid:36008116", "pmid:35989899", "pmid:35974122", "pmid:35933239", "pmid:35908282", "pmid:35906014", "pmid:35903771", "pmid:35895140", "pmid:35876881", "pmid:35869263", "pmid:35843530", "pmid:35813024", "pmid:35793625", "pmid:35766328", "pmid:35752680", "pmid:35746899", "pmid:35726380", "pmid:35675776", "pmid:35661131", "pmid:35633169", "pmid:35625816", "pmid:35599735", "pmid:35594156", "pmid:35592494", "pmid:35589711", "pmid:35568435", "pmid:35525134", "pmid:35462091", "pmid:35383205", "pmid:35379876", "pmid:35379698", "pmid:35314728", "pmid:35295181", "pmid:35259014", "pmid:35189395", "pmid:35182509", "pmid:35171477", "pmid:35152451", "pmid:35096836", "pmid:35091648", "pmid:35052416", "pmid:35047667", "pmid:35026048", "pmid:35007998", "pmid:34978044", "pmid:34949835", "pmid:34915153", "pmid:34853325", "pmid:34848561", "pmid:34827542", "pmid:34791698", "pmid:34723963", "pmid:34717271", "pmid:34705518", "pmid:34687211", "pmid:34677935", "pmid:34654821", "pmid:34638725", "pmid:34573259", "pmid:34542927", "pmid:34534264", "pmid:34526954", "pmid:34475377", "pmid:34450161", "pmid:34440384", "pmid:34435379", "pmid:34431456", "pmid:34404558", "pmid:34397416", "pmid:34389718", "pmid:34389711", "pmid:34386583", "pmid:34382491", "pmid:34376242", "pmid:34328616", "pmid:34318620", "pmid:34310040", "pmid:34305575", "pmid:34297726", "pmid:34233951", "pmid:34229542", "pmid:34209673", "pmid:34187866", "pmid:34179866", "pmid:34174288", "pmid:34172817", "pmid:34170347", "pmid:34168085", "pmid:34157654", "pmid:34152475", "pmid:34140881", "pmid:34133945", "pmid:34118929", "pmid:34099711", "pmid:34093394", "pmid:34051439", "pmid:34048588", "pmid:33977144", "pmid:33967699", "pmid:33935096", "pmid:33906932", "pmid:33892814", "pmid:33889947", "pmid:33857770", "pmid:33837088", "pmid:33833668", "pmid:33830997", "pmid:33815737", "pmid:33789100", "pmid:33788382", "pmid:33741069", "pmid:33739284", "pmid:33737586", "pmid:33730968", "pmid:33726839", "pmid:33709219", "pmid:33705846", "pmid:33663561", "pmid:33661518", "pmid:33619157", "pmid:33601107", "pmid:33588953", "pmid:33558503", "pmid:33554115", "pmid:33482083", "pmid:33431483", "pmid:33414559", "pmid:33409820", "pmid:33378537", "pmid:33377399", "pmid:33376800", "pmid:33363944", "pmid:33329355", "pmid:33300868", "pmid:33276461", "pmid:33253636", "pmid:33196168", "pmid:33168090", "pmid:33168078", "pmid:33149115", "pmid:33131137", "pmid:33129345", "pmid:33123074", "pmid:33058338", "pmid:33055142", "pmid:33022226", "pmid:32989102", "pmid:32961393", "pmid:32958650", "pmid:32954321", "pmid:32949047", "pmid:32921502", "pmid:32894207", "pmid:32878979", "pmid:32865792", "pmid:32845284", "pmid:32843153", "pmid:32843152", "pmid:32830871", "pmid:32823188", "pmid:32821252", "pmid:32769055", "pmid:32759310", "pmid:32755582", "pmid:32721467", "pmid:32683569", "pmid:32675418", "pmid:32638105", "pmid:32628322", "pmid:32554322", "pmid:32521185", "pmid:32504093", "pmid:32500377", "pmid:32485711", "pmid:32483373", "pmid:32441885", "pmid:32421156", "pmid:32410933", "pmid:32385536", "pmid:32375063", "pmid:32375043", "pmid:32347002", "pmid:32338076", "pmid:32296747", "pmid:32284607", "pmid:32281118", "pmid:32278549", "pmid:32226938", "pmid:32223927", "pmid:32184029", "pmid:32180125", "pmid:32175624", "pmid:32151952", "pmid:32132225", "pmid:32125773", "pmid:32123048", "pmid:32119645", "pmid:32100453", "pmid:32093728", "pmid:32084385", "pmid:32082115", "pmid:32070418", "pmid:32059759", "pmid:32042907", "pmid:32035967", "pmid:32035847", "pmid:32000838", "pmid:31991801", "pmid:31930538", "pmid:31925813", "pmid:31858749", "pmid:31852251", "pmid:31847700", "pmid:31843021", "pmid:31836585", "pmid:31831332", "pmid:31810584", "pmid:31800202", "pmid:31791419", "pmid:31702465", "pmid:31676125", "pmid:31651360", "pmid:31649034", "pmid:31647549", "pmid:31642962", "pmid:31637556", "pmid:31633109", "pmid:31625563", "pmid:31624333", "pmid:31619481", "pmid:31594549", "pmid:31587919", "pmid:31586943", "pmid:31582231", "pmid:31579943", "pmid:31578297", "pmid:31561355", "pmid:31559531", "pmid:31551693", "pmid:31530427", "pmid:31499409", "pmid:31475037", "pmid:31444357", "pmid:31439573", "pmid:31432691", "pmid:31375896", "pmid:31358992", "pmid:31327044", "pmid:31325016", "pmid:31205123", "pmid:31176718", "pmid:31156370", "pmid:31127772", "pmid:31086314", "pmid:31041398", "pmid:31036086", "pmid:31019099", "pmid:31019093", "pmid:31009932", "pmid:31007077", "pmid:30992335", "pmid:30992141", "pmid:30992063", "pmid:30985904", "pmid:30981631", "pmid:30979436", "pmid:30945056", "pmid:30938419", "pmid:30863279", "pmid:30861516", "pmid:30859373", "pmid:30846540", "pmid:30790403", "pmid:30777654", "pmid:30767771", "pmid:30739198", "pmid:30714955", "pmid:30711674", "pmid:30685122", "pmid:30643298", "pmid:30617627", "pmid:30617154", "pmid:30610877", "pmid:30554355", "pmid:30550541", "pmid:30530974", "pmid:30528349", "pmid:30527999", "pmid:30454072", "pmid:30447080", "pmid:30396881", "pmid:30356970", "pmid:30349864", "pmid:30347338", "pmid:30337192", "pmid:30336474", "pmid:30320585", "pmid:30312838", "pmid:30310141", "pmid:30261505", "pmid:30252044", "pmid:30239641", "pmid:30233460", "pmid:30213863", "pmid:30210275", "pmid:30150298", "pmid:30126445", "pmid:30109267", "pmid:30099204", "pmid:30093141", "pmid:30090657", "pmid:30075745", "pmid:30023173", "pmid:30022074", "pmid:29973287", "pmid:29957385", "pmid:29942091", "pmid:29912891", "pmid:29895397", "pmid:29889265", "pmid:29866399", "pmid:29861044", "pmid:29859640", "pmid:29855382", "pmid:29848387", "pmid:29801887", "pmid:29761121", "pmid:29750243", "pmid:29748150", "pmid:29738460", "pmid:29628143", "pmid:29610297", "pmid:29598923", "pmid:29525180", "pmid:29507424", "pmid:29493298", "pmid:29480190", "pmid:29480183", "pmid:29479499", "pmid:29476165", "pmid:29449030", "pmid:29441485", "pmid:29439323", "pmid:29400714", "pmid:29380049", "pmid:29367641", "pmid:29352617", "pmid:29352102", "pmid:29316893", "pmid:29302060", "pmid:29281254", "pmid:29274668", "pmid:29264395", "pmid:29222490", "pmid:29216908", "pmid:29196813", "pmid:29170628", "pmid:29166782", "pmid:29149615", "pmid:29131108", "pmid:29113975", "pmid:29095328", "pmid:29080331", "pmid:29056323", "pmid:29055436", "pmid:29049464", "pmid:29036691", "pmid:28973350", "pmid:28889094", "pmid:28887402", "pmid:28827593", "pmid:28808785", "pmid:28803727", "pmid:28749476", "pmid:28720882", "pmid:28714954", "pmid:28677678", "pmid:28666709", "pmid:28660252", "pmid:28642336", "pmid:28637276", "pmid:28614712", "pmid:28606110", "pmid:28570551", "pmid:28551275", "pmid:28550099", "pmid:28542233", "pmid:28539470", "pmid:28527524", "pmid:28508101", "pmid:28491898", "pmid:28482638", "pmid:28481984", "pmid:28462717", "pmid:28452351", "pmid:28439722", "pmid:28431575", "pmid:28420437", "pmid:28408402", "pmid:28387671", "pmid:28365006", "pmid:28356511", "pmid:28351931", "pmid:28334866", "pmid:28322003", "pmid:28320191", "pmid:28306503", "pmid:28222900", "pmid:28197542", "pmid:28192553", "pmid:28160950", "pmid:28158451", "pmid:28132891", "pmid:28131227", "pmid:28124431", "pmid:28116236", "pmid:28105640", "pmid:28103472", "pmid:28089114", "pmid:28088213", "pmid:28010125", "pmid:28003435", "pmid:27936955", "pmid:27933757", "pmid:27875531", "pmid:27797809", "pmid:27796305", "pmid:27790088", "pmid:27688759", "pmid:27739539", "pmid:27773700", "pmid:27595458", "pmid:27768896", "pmid:27756805", "pmid:27720481", "pmid:27732842", "pmid:27671483", "pmid:27666590", "pmid:27663272", "pmid:27652840", "pmid:27646412", "pmid:27623008", "pmid:27617292", "pmid:27516603", "pmid:27480424", "pmid:27473499", "pmid:27461252", "pmid:27413586", "pmid:27400454", "pmid:27388677", "pmid:27375918", "pmid:27369896", "pmid:27334615", "pmid:27327087", "pmid:27288208", "pmid:27274540", "pmid:27245636", "pmid:27241037", "pmid:27195002", "pmid:27193190", "pmid:27151634", "pmid:27112497", "pmid:27097283", "pmid:27079381", "pmid:26998601", "pmid:26979938", "pmid:26967212", "pmid:26931465", "pmid:26925510", "pmid:26919046", "pmid:26915990", "pmid:26903389", "pmid:26878348", "pmid:26862832", "pmid:26839080", "pmid:26810537", "pmid:26785370", "pmid:26777436", "pmid:26769963", "pmid:26746986", "pmid:26735706", "pmid:26733254", "pmid:26728149", "pmid:26725464", "pmid:26723138", "pmid:28337409", "pmid:26691640", "pmid:26690922", "pmid:26674655", "pmid:26637797", "pmid:26632347", "pmid:26599997", "pmid:26584779", "pmid:26551617", "pmid:26547294", "pmid:26538301", "pmid:26526532", "pmid:26497991", "pmid:26481318", "pmid:26463209", "pmid:26437865", "pmid:29213991", "pmid:26408000", "pmid:26401819", "pmid:26374446", "pmid:26350237", "pmid:26348842", "pmid:26347457", "pmid:26308983", "pmid:26308899", "pmid:26308891", "pmid:26304661", "pmid:26275564", "pmid:26254955", "pmid:26234378", "pmid:26233805", "pmid:26174152", "pmid:26166205", "pmid:26146826", "pmid:26142124", "pmid:26108573", "pmid:26099177", "pmid:26095883", "pmid:26083476", "pmid:26044557", "pmid:26031661", "pmid:26022924", "pmid:26016851", "pmid:25977373", "pmid:25943890", "pmid:25943887", "pmid:25934183", "pmid:25835037", "pmid:25795648", "pmid:25791939", "pmid:25788698", "pmid:25756586", "pmid:25732802", "pmid:25716178", "pmid:25712133", "pmid:25637145", "pmid:25618255", "pmid:25617006", "pmid:25595499", "pmid:25585530", "pmid:25531686", "pmid:25467142", "pmid:25457023", "pmid:25442110", "pmid:25436637", "pmid:25433797", "pmid:25433461", "pmid:25388784", "pmid:25377888", "pmid:25326098", "pmid:25319030", "pmid:25308964", "pmid:25284081", "pmid:25281017", "pmid:25273996", "pmid:25248608", "pmid:25239657", "pmid:25210488", "pmid:25207541", "pmid:25203513", "pmid:25185840", "pmid:25182743", "pmid:25179228", "pmid:25173361", "pmid:25158292", "pmid:25156163", "pmid:25147206", "pmid:25132468", "pmid:25123918", "pmid:25120191", "pmid:25115936", "pmid:25111021", "pmid:25108559", "pmid:25098532", "pmid:25085782", "pmid:25081482", "pmid:25034271", "pmid:24950788", "pmid:24928930", "pmid:24908669", "pmid:24908169", "pmid:24898647", "pmid:24866401", "pmid:24866055", "pmid:24861139", "pmid:24819148", "pmid:24806409", "pmid:24803912", "pmid:24798095", "pmid:24756204", "pmid:24733620", "pmid:24706941", "pmid:24704492", "pmid:24667415", "pmid:24650794", "pmid:24612676", "pmid:24598541", "pmid:24573903", "pmid:24559645", "pmid:24549040", "pmid:24530272", "pmid:24445987", "pmid:24442578", "pmid:24439166", "pmid:24417314", "pmid:24387986", "pmid:24387985", "pmid:24385136", "pmid:24378086", "pmid:24363131", "pmid:24355526", "pmid:24329881", "pmid:24319645", "pmid:24309270", "pmid:24286341", "pmid:24269022", "pmid:24269018", "pmid:24252571", "pmid:24252525", "pmid:24248382", "pmid:24212388", "pmid:24179835", "pmid:24170096", "pmid:24169076", "pmid:24166615", "pmid:24154603", "pmid:24139042", "pmid:24129584", "pmid:24126854", "pmid:24121957", "pmid:24107864", "pmid:24096617", "pmid:24080172", "pmid:24077574", "pmid:24068985", "pmid:24057670", "pmid:24053774", "pmid:24052799", "pmid:24027057", "pmid:24011653", "pmid:23998997", "pmid:23987827", "pmid:23973441", "pmid:23962495", "pmid:23922030", "pmid:23894576", "pmid:23884045", "pmid:23870417", "pmid:23869403", "pmid:23845100", "pmid:23836460", "pmid:23836290", "pmid:23818065", "pmid:23771489", "pmid:23731538", "pmid:23720273", "pmid:23695224", "pmid:23686809", "pmid:23597494", "pmid:23588498", "pmid:23588422", "pmid:23587638", "pmid:23566336", "pmid:23553481", "pmid:23551834", "pmid:23548882", "pmid:23473366", "pmid:23437264", "pmid:23435409", "pmid:23434116", "pmid:23423380", "pmid:23421625", "pmid:23415312", "pmid:23413259", "pmid:23383383", "pmid:23381195", "pmid:23358603", "pmid:23352322", "pmid:23338750", "pmid:23338682", "pmid:23329412", "pmid:23284068", "pmid:23273600", "pmid:23261768", "pmid:23254636", "pmid:23216213", "pmid:23199140", "pmid:23151261", "pmid:23141412", "pmid:23117491", "pmid:23116878", "pmid:23107433", "pmid:23088937", "pmid:23085936", "pmid:23084342", "pmid:23063644", "pmid:23053136", "pmid:23053135", "pmid:23036583", "pmid:23035801", "pmid:23016833", "pmid:23012445", "pmid:23006986", "pmid:22993125", "pmid:22985429", "pmid:22964911", "pmid:22936364", "pmid:22918453", "pmid:22898310", "pmid:22892647", "pmid:22878164", "pmid:22875087", "pmid:22875086", "pmid:22843265", "pmid:22840558", "pmid:22818528", "pmid:22815561", "pmid:22766732", "pmid:22766072", "pmid:22742426", "pmid:22739338", "pmid:22727276", "pmid:22721568", "pmid:22720079", "pmid:22708871", "pmid:22702520", "pmid:22692064", "pmid:22673113", "pmid:22650353", "pmid:22645277", "pmid:22637471", "pmid:22637429", "pmid:22571983", "pmid:22564974", "pmid:22550220", "pmid:22507827", "pmid:22502998", "pmid:22499346", "pmid:22483864", "pmid:22459598", "pmid:22426854", "pmid:22418734", "pmid:22410647", "pmid:22406229", "pmid:22399793", "pmid:22366794", "pmid:22366793", "pmid:22366792", "pmid:22366791", "pmid:22343411", "pmid:22305801", "pmid:22300876", "pmid:22300873", "pmid:22228244", "pmid:22216764", "pmid:22181065", "pmid:22154785", "pmid:22101323", "pmid:22083254", "pmid:21944779"] -}, -{ - "id": "SCA6_CACNA1A", - "disease_id": "SCA6", - "gene": "CACNA1A", - "evidence": ["Definitive"], - "chrom": "chr19", - "start_hg38": 13207858, - "stop_hg38": 13207898, - "start_hg19": 13318672, - "stop_hg19": 13318712, - "start_t2t": 13333136, - "stop_t2t": 13333176, - "disease": "Spinocerebellar ataxia type 6", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 6 (SCA6) is the most common subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by late-onset and slowly progressive gait ataxia and other cerebellar signs such as impaired muscle coordination and nystagmus [@mondo:0008457]. Ao et al. have proposed that this expansion may have effects on chronotype, differing by sex and menopausal status, as well as depression severity [@pmid:41358280].", - "hpo_terms": null, - "prevalence": "2.65/100000", - "prevalence_details": "13-15% of global SCA prevalence, estimated to be 0.02-31/100,000 [@genereviews:NBK1140; @pmid:29100084]: resultant estimate is 0.3-5/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1140].", - "age_onset": "Typical: 43-52 [@genereviews:NBK1140]; Range: 16 [@pmid:23331413] - 73 [@genereviews:NBK1140].", - "age_onset_min": 16.0, - "age_onset_max": 73.0, - "typ_age_onset_min": 43.0, - "typ_age_onset_max": 52.0, - "details": "The intermediate range (19-20 motifs) [@pmid:39996131; @genereviews:NBK1140] can be associated with a premutation, reduced penetrance, atypical phenotype, or a disease state when homozygous [@genereviews:NBK1140]. When the longer allele is > 22 motifs, the short allele does not play a role in pathogenicity/age of onset, but expansions of 21-22 motifs have age of onset influenced by the smaller allele [@pmid:39996131]. For individuals with a longest allele of 19-20, the presence of a second allele of 19-20 likely increases the risk of developing SCA6 [@pmid:39996131]. Undiagnosed carriers of pathogenic range repeats in CACNA1A exhibit significant cerebellar volume loss and elevated NEFL levels before clinical diagnosis, also seen in other loci [@pmid:41951733].", - "detection": "Expansions have been detected by PCR fragment analysis [@pmid:35573049].", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyglutamine expansions associated with increased expression of altered product leading to impaired gene binding and transcription factor function as well as cellular toxicity [@genereviews:NBK1140].", - "year": "1997 [@pmid:8988170]", - "location_in_gene": "Coding, Last Exon: 47 or 48", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CTG"], - "pathogenic_motif_reference_orientation": ["CTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 18, - "intermediate_min": 19, - "intermediate_max": 20, - "pathogenic_min": 21, - "pathogenic_max": 33, - "motif_len": 3, - "ref_copies": 13.3, - "novel": "ref", - "gard": ["10351"], - "genereviews": ["NBK1140"], - "malacard": ["SPN309"], - "medgen": ["148458"], - "mondo": ["0008457"], - "omim": ["183086"], - "orphanet": ["98758"], - "gnomad": ["CACNA1A"], - "stripy": ["CACNA1A"], - "tr_atlas": ["TR154515"], - "webstr_hg38": ["5624835"], - "webstr_hg19": ["Expansion_SCA6/CACNA1A"], - "locus_tags": ["length_affects_phenotype", "length_affects_penetrance", "length_affects_onset"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK1140", "pmid:23331413", "doi:10.1212/NXG.0000000000200245", "pmid:41951733", "pmid:29100084", "pmid:8988170", "mondo:0008457", "pmid:41358280"], - "additional_literature": ["pmid:42038259", "pmid:41951733", "pmid:41771688", "pmid:41762523", "pmid:41612618", "pmid:41082794", "pmid:41009775", "pmid:40906330", "pmid:40900235", "pmid:40879304", "pmid:40746751", "pmid:40488180", "pmid:40189664", "pmid:39812846", "pmid:39571249", "pmid:39152783", "pmid:39048885", "pmid:38961870", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37848721", "pmid:37307504", "pmid:37301203", "pmid:36618024", "pmid:36599645", "pmid:36530930", "pmid:35962273", "pmid:35188716", "pmid:35182509", "pmid:35052497", "pmid:34647648", "pmid:34600502", "pmid:34565721", "pmid:34371182", "pmid:34159894", "pmid:33502644", "pmid:33121221", "pmid:32888184", "pmid:32822634", "pmid:31522753", "pmid:30891880", "pmid:30591349", "pmid:30342765", "pmid:30314815", "pmid:30120431", "pmid:30078120", "pmid:29959555", "pmid:29553382", "pmid:29367260", "pmid:29316893", "pmid:29249939", "pmid:29111027", "pmid:29057148", "pmid:28946818", "pmid:28782341", "pmid:28585930", "pmid:28444220", "pmid:28131213", "pmid:27979829", "pmid:27896316", "pmid:27848087", "pmid:27806289", "pmid:27412786", "pmid:27400454", "pmid:27333979", "pmid:26730403", "pmid:26377379", "pmid:26374734", "pmid:26354989", "pmid:26077168", "pmid:26054379", "pmid:25634432", "pmid:25624155", "pmid:25466696", "pmid:24780882", "pmid:24534762", "pmid:24486772", "pmid:24209901", "pmid:23423669", "pmid:23407676", "pmid:23368522", "pmid:23026538", "pmid:22520093", "pmid:26859398", "pmid:26676458", "pmid:21832228", "pmid:21550405", "pmid:20069235", "pmid:19631275", "pmid:19429075", "pmid:19259763", "pmid:19224313", "pmid:18949263", "pmid:18759344", "pmid:18687887", "pmid:18685131", "pmid:18684474", "pmid:18506570", "pmid:18418678", "pmid:18285829", "pmid:18074367", "pmid:17961920", "pmid:17682009", "pmid:17516099", "pmid:17420317", "pmid:16396623", "pmid:16389595", "pmid:16310805", "pmid:16000334", "pmid:15875905", "pmid:15747371", "pmid:15553088", "pmid:15148151", "pmid:15080863", "pmid:15026782", "pmid:14967767", "pmid:14966163", "pmid:14756671", "pmid:14534930", "pmid:12810491", "pmid:12764052", "pmid:12676347", "pmid:12614315", "pmid:12545428", "pmid:11939898", "pmid:11889231", "pmid:11839840", "pmid:11804332", "pmid:11717352", "pmid:11708993", "pmid:11448300", "pmid:11355155", "pmid:11341481", "pmid:11311290", "pmid:11176970", "pmid:11160961", "pmid:10369884", "pmid:11081813", "pmid:11030410", "pmid:10985694", "pmid:10964945", "pmid:10945665", "pmid:10942107", "pmid:10894992", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10690991", "pmid:10674974", "pmid:10601803", "pmid:10453742", "pmid:10442462", "pmid:10369863", "pmid:10369828", "pmid:10366652", "pmid:10225349", "pmid:9973298", "pmid:9915947", "pmid:9879686", "pmid:9855520", "pmid:9779664", "pmid:9758625", "pmid:9741473", "pmid:9696528", "pmid:9674805", "pmid:9613852", "pmid:9600677", "pmid:9559993", "pmid:9507387", "pmid:9436730", "pmid:9385362", "pmid:9371901", "pmid:9371900", "pmid:9403486", "pmid:9403480", "pmid:9345107", "pmid:9339681", "pmid:9302278", "pmid:9311738", "pmid:9259275", "pmid:9259274", "pmid:10464657", "pmid:9043864"] -}, -{ - "id": "JBS_CBL", - "disease_id": "JBS", - "gene": "CBL", - "evidence": ["Definitive"], - "chrom": "chr11", - "start_hg38": 119206289, - "stop_hg38": 119206323, - "start_hg19": 119076999, - "stop_hg19": 119077033, - "start_t2t": 119226662, - "stop_t2t": 119226696, - "disease": "Jacobsen syndrome (FRAX11B fragile site)", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "A multiple congenital anomaly/intellectual disability contiguous gene syndrome caused by partial deletion of the long arm of chromosome 11 [@mondo:0007838].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "1/100,000 births; female/male ratio 2:1 [@pmid:19267933]. Found across ancestries/ethnicities [@omim:147791].", - "age_onset": "Condition at birth.", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "70% of individuals have 11 repeats [@pmid:7603564], but pathogenic expansion can span hundreds of motifs [@pmid:10767345]. The CGG repeat expansion can lead to a fragile site and subsequent deletion of 11q (shown in 2 cases) but total causality is unclear; intermediate alleles are associated with a premutation [@pmid:19267933].", - "detection": null, - "mechanism": "Hypermethylation", - "mechanism_detail": "DNA hypermethylation/11q deletion in sporadic cases [@pmid:38467784].", - "year": "1995 [@pmid:7603564]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CGG"], - "pathogenic_motif_reference_orientation": ["CGG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 79, - "intermediate_min": 80, - "intermediate_max": 100, - "pathogenic_min": 101, - "pathogenic_max": 300, - "motif_len": 3, - "ref_copies": 11.3, - "novel": "ref", - "gard": ["307"], - "genereviews": [], - "malacard": ["JCB001"], - "medgen": ["162878"], - "mondo": ["0007838"], - "omim": ["147791"], - "orphanet": ["2308"], - "gnomad": ["CBL"], - "stripy": ["CBL"], - "tr_atlas": ["TR112816"], - "webstr_hg38": ["6166081", "430025"], - "webstr_hg19": ["STR_266122"], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:38467784", "pmid:7603564", "pmid:10767345", "pmid:19267933", "omim:147791", "mondo:0007838"], - "additional_literature": ["pmid:41964119", "pmid:37422244", "pmid:22131879", "pmid:22084433", "pmid:16474167"] -}, -{ - "id": "MODY8_CEL", - "disease_id": "MODY8", - "gene": "CEL", - "evidence": ["Provisional"], - "chrom": "chr9", - "start_hg38": 133071177, - "stop_hg38": 133071737, - "start_hg19": 135946564, - "stop_hg19": 135947124, - "start_t2t": 145285333, - "stop_t2t": 145285861, - "disease": "Maturity-Onset Diabetes of the Young Type 8", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions [@genereviews:NBK500456]. In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype [@pmid:34850019]. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED) [@pmid:18544793].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265].", - "age_onset": "11-17 [@pmid:19760265]", - "age_onset_min": 11.0, - "age_onset_max": 17.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5 [@pmid:34850019]. One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential [@pmid:38483348]. Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse [@pmid:19760265]. Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs) [@pmid:39361122]. Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved [@pmid:21784842; @pmid:27650499; @pmid:33862081]. Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects [@pmid:38483348].", - "year": "2005", - "location_in_gene": "Exon 11", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG"], - "pathogenic_motif_reference_orientation": ["GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "FTDALS1_C9orf72", + "disease_id": "FTDALS1", + "gene": "C9orf72", + "evidence": [ + "Definitive" + ], + "chrom": "chr9", + "start_hg38": 27573484, + "stop_hg38": 27573546, + "start_hg19": 27573482, + "stop_hg19": 27573544, + "start_t2t": 27584063, + "stop_t2t": 27584155, + "disease": "Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS)", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian", + "Risk" + ], + "disease_description": "Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:31315673]. Related individuals to patients with C9orf72-ALS appear at an increased risk of disease regardless of carrier status [@pmid:38149039; @pmid:39315390]. C9orf72-FTD is estimated to be 0.04-134:100,000 [@genereviews:NBK268647], and by our estimates 0.65-1.56/100,000 for C9orf72-ALS. The expansion has been found across ethnicities/ancestries, with population-dependent prevalence, highest in those with northern European ancestry [@genereviews:NBK268647].", + "age_onset": "Typical: 50-64; Range: 20-91 [@genereviews:NBK268647].", + "age_onset_min": 20, + "age_onset_max": 91, + "typ_age_onset_min": 50, + "typ_age_onset_max": 64, + "details": "FTD and ALS form a clinical spectrum [@pmid:37388914; @pmid:22406228]. The clinical ranges of the C9orf72 locus remain ambiguous [@stripy:C9ORF72][@pmid:41951733]: most healthy controls have alleles up to 24 repeats [@pmid:28319737] yet 24-30 repeats are associated with ALS [@pmid:31315673] and while 60 repeats is frequently used as a threshold for uncertain alleles, the exact threshold of pathogenicity remains unclear [@genereviews:NBK268647; @pmid:38099605]. Repeats of 80 motifs and lower appear to have delayed onset for any phenotype [@pmid:28319737]. >250 repeats are associated with a full FTD/ALS disease state [@pmid:31048495], but pathogenic alleles can range from 30 to more than 4000 repeats [@pmid:38099605; @pmid:39709476]. Somatic C9orf72 repeat expansions may emerge de novo in CNS tissue from alleles below the pathogenic range, potentially contributing to sporadic ALS/FTD [@pmid:41986690]. Penetrance appears to also be age-dependent, with environmental factors and specific phenotypes associated with sex and age at onset [@pmid:28522837]. Methylation appears to increase with expansion length and age [@pmid:39709476], and C9orf72 promoter hypermethylation has been observed in expansion carriers [@pmid:42222887]. ALS caused by repeat expansions in C9orf72 generally has an earlier disease onset and faster progression than other ALS presentations [@pmid:39226712]. C9orf72 expansions have been associated with reduced thalamic volume in undiagnosed carriers, and plasma neurofilament light chain has an approximately linear association with repeat count and motor neuron disease risk [@pmid:41951733; @pmid:42095061]. Pathogenic C9orf72 repeat expansions have also been identified in ambiguous late onset behavioral or psychiatric like presentations including executive deficits, apathy, and stereotyped behavior [@pmid:42158267].", + "detection": "Bidirectional RP-PCR is typically used for detection [@pmid:21944778]. Large pathogenic expansions are difficult to size exactly by PCR, so Southern blot is used to better estimate size [@pmid:23566336], while long-read sequencing provides direct sizing and sequence characterization [@pmid:30126445].", + "mechanism": "Ambiguous", + "mechanism_detail": "The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA/DNA hybrids (R-loops). The structural polymorphism causes a repeat length-dependent accumulation of transcripts aborted in the HRE region [@omim:105500]. Additional mechanisms theorized include protein loss-of-function and RNA gain-of-function [@pmid:37847372]. Multiple cell types in the prefrontal cortex, including oligodendrocytes, microglia, astrocytes, and neurons, appear impacted during pathogenesis [@pmid:39999167]. Drosophila model-system evidence suggests that RAN translated poly(GR) may contribute to toxicity by activating the integrated stress response through eIF2α phosphorylation and promoting stress granule accumulation [@pmid:42087256]. C9orf72 repeat expansions are associated with reduced C9orf72 expression in multiple ALS tissues and altered splicing of the exon 1a isoform [@pmid:42145639]. Reduced C9orf72 expression has also been observed in peripheral blood immune cells from C9orf72-associated ALS, with C9-ALS showing distinct monocyte activation signatures. In ALS spinal cord, activated myeloid cells expressing complement, lipid-processing, and phagocytic genes occur in regions with motor neuron loss and TDP-43 pathology [@pmid:42135512].", + "year": "2011 [@pmid:21944778]", + "location_in_gene": "Intron 1 or 5' UTR depending on transcript", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GGCCCC" + ], + "pathogenic_motif_reference_orientation": [ + "GGCCCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCGGGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 23, + "intermediate_min": 24, + "intermediate_max": 30, + "pathogenic_min": 31, + "pathogenic_max": 4088, + "motif_len": 6, + "ref_copies": 10.8, + "novel": "ref", + "gard": [ + "18396" + ], + "genereviews": [ + "NBK268647" + ], + "malacard": [ + "FRN044" + ], + "medgen": [ + "1830423" + ], + "mondo": [ + "0007105" + ], + "omim": [ + "105500" + ], + "orphanet": [ + "275872" + ], + "gnomad": [ + "C9ORF72" + ], + "stripy": [ + "C9ORF72" + ], + "tr_atlas": [ + "TR92417" + ], + "webstr_hg38": [ + "5877863", + "1502453" + ], + "webstr_hg19": [ + "STR_1475506" + ], + "locus_tags": [ + "length_affects_phenotype", + "length_affects_onset" + ], + "disease_tags": [ + "phenotypic_spectrum" + ], + "references": [ + "genereviews:NBK268647", + "omim:105500", + "pmid:37847372", + "pmid:39999167", + "pmid:37388914", + "pmid:22406228", + "stripy:C9ORF72", + "pmid:41951733", + "pmid:28319737", + "pmid:31315673", + "pmid:38099605", + "pmid:31048495", + "pmid:39709476", + "pmid:41986690", + "pmid:28522837", + "pmid:39226712", + "pmid:38149039", + "pmid:39315390", + "pmid:21944778", + "pmid:39349043", + "pmid:41074692", + "pmid:41957010" + ], + "additional_literature": [ + "pmid:42222887", + "pmid:42221822", + "pmid:42211284", + "pmid:42160515", + "pmid:42158267", + "pmid:42147445", + "pmid:42145639", + "pmid:42135512", + "pmid:42095061", + "pmid:42087256", + "pmid:42033225", + "pmid:41995858", + "pmid:41993388", + "pmid:41987036", + "pmid:41961863", + "pmid:41928938", + "pmid:41917466", + "pmid:41884597", + "pmid:41856038", + "pmid:41810938", + "pmid:41799019", + "pmid:41787388", + "pmid:41766077", + "pmid:41763422", + "pmid:41762523", + "pmid:41760955", + "pmid:41757350", + "pmid:41752089", + "pmid:41751955", + "pmid:41727102", + "pmid:41717003", + "pmid:41692171", + "pmid:41665027", + "pmid:41658940", + "pmid:41643661", + "pmid:41643021", + "pmid:41640102", + "pmid:41623487", + "pmid:41612618", + "pmid:41500252", + "pmid:41440030", + "pmid:41437053", + "pmid:41426430", + "pmid:41423553", + "pmid:41394713", + "pmid:41394638", + "pmid:41379346", + "pmid:41366786", + "pmid:41359433", + "pmid:41358323", + "pmid:41294820", + "pmid:41283823", + "pmid:41278665", + "pmid:41271630", + "pmid:41269363", + "pmid:41256634", + "pmid:41240362", + "pmid:41216140", + "pmid:41196070", + "pmid:41149812", + "pmid:41149783", + "pmid:41141812", + "pmid:41137727", + "pmid:41087751", + "pmid:41063344", + "pmid:41060790", + "pmid:41040221", + "pmid:41030957", + "pmid:41025901", + "pmid:41024438", + "pmid:41009775", + "pmid:41006764", + "pmid:41005474", + "pmid:41004400", + "pmid:40992079", + "pmid:40981770", + "pmid:40966720", + "pmid:40952044", + "pmid:40930530", + "pmid:40908789", + "pmid:40891053", + "pmid:40888599", + "pmid:40875372", + "pmid:40865525", + "pmid:40832293", + "pmid:40790269", + "pmid:40776416", + "pmid:40767591", + "pmid:40765612", + "pmid:40763713", + "pmid:40758885", + "pmid:40746751", + "pmid:40709577", + "pmid:40682810", + "pmid:40621734", + "pmid:40585812", + "pmid:40581653", + "pmid:40541176", + "pmid:40536530", + "pmid:40513650", + "pmid:40504117", + "pmid:40478310", + "pmid:40426848", + "pmid:40424855", + "pmid:40411682", + "pmid:40375307", + "pmid:40349639", + "pmid:40349338", + "pmid:40346885", + "pmid:40260680", + "pmid:40250093", + "pmid:40207633", + "pmid:40203833", + "pmid:40196659", + "pmid:40150989", + "pmid:40138021", + "pmid:40073860", + "pmid:40053600", + "pmid:40050010", + "pmid:40027671", + "pmid:40000803", + "pmid:39975241", + "pmid:39957101", + "pmid:39945490", + "pmid:39920674", + "pmid:39913612", + "pmid:39894561", + "pmid:39893487", + "pmid:39869842", + "pmid:39809899", + "pmid:39779704", + "pmid:39779681", + "pmid:39764003", + "pmid:39747573", + "pmid:39730482", + "pmid:39722074", + "pmid:39711523", + "pmid:39703094", + "pmid:39670345", + "pmid:39669124", + "pmid:39638345", + "pmid:39621905", + "pmid:39589881", + "pmid:39581338", + "pmid:39569145", + "pmid:39437787", + "pmid:39417137", + "pmid:39382125", + "pmid:39345637", + "pmid:39339364", + "pmid:39323877", + "pmid:39316747", + "pmid:39316038", + "pmid:39311028", + "pmid:39289761", + "pmid:39288267", + "pmid:39282230", + "pmid:39268612", + "pmid:39270726", + "pmid:39260140", + "pmid:39256877", + "pmid:39254359", + "pmid:39253499", + "pmid:39246336", + "pmid:39233852", + "pmid:39229486", + "pmid:39222049", + "pmid:39181135", + "pmid:39146722", + "pmid:39106320", + "pmid:39098187", + "pmid:39088455", + "pmid:39059407", + "pmid:39058450", + "pmid:39056697", + "pmid:39042693", + "pmid:39000564", + "pmid:38935506", + "pmid:38915937", + "pmid:38902980", + "pmid:38896262", + "pmid:38884646", + "pmid:38876108", + "pmid:38860430", + "pmid:38852112", + "pmid:38847891", + "pmid:38799643", + "pmid:38796984", + "pmid:38753768", + "pmid:38751620", + "pmid:38746326", + "pmid:38734896", + "pmid:38722513", + "pmid:38684907", + "pmid:38667292", + "pmid:38658168", + "pmid:38641715", + "pmid:38625400", + "pmid:38621131", + "pmid:38615685", + "pmid:38613988", + "pmid:38606777", + "pmid:38585915", + "pmid:38568044", + "pmid:38556190", + "pmid:38495583", + "pmid:38464738", + "pmid:38444607", + "pmid:38431841", + "pmid:38412259", + "pmid:38397958", + "pmid:38394210", + "pmid:38376483", + "pmid:38295729", + "pmid:38312023", + "pmid:38301895", + "pmid:38260655", + "pmid:38242117", + "pmid:38234062", + "pmid:38229533", + "pmid:38191789", + "pmid:38168370", + "pmid:38168171", + "pmid:38112783", + "pmid:38110419", + "pmid:38092738", + "pmid:38064514", + "pmid:38019311", + "pmid:38009843", + "pmid:37948524", + "pmid:37891975", + "pmid:37861203", + "pmid:37845749", + "pmid:37839080", + "pmid:37827570", + "pmid:37808871", + "pmid:37791472", + "pmid:37763163", + "pmid:37736756", + "pmid:37723585", + "pmid:37714849", + "pmid:37693322", + "pmid:37686239", + "pmid:37675986", + "pmid:37648532", + "pmid:37644512", + "pmid:37590144", + "pmid:37574738", + "pmid:37548032", + "pmid:37545231", + "pmid:37527465", + "pmid:37511014", + "pmid:37471224", + "pmid:37461319", + "pmid:37450566", + "pmid:37421883", + "pmid:37399804", + "pmid:37386798", + "pmid:37379724", + "pmid:37365312", + "pmid:37339631", + "pmid:37334257", + "pmid:37333274", + "pmid:37333144", + "pmid:37332610", + "pmid:37317656", + "pmid:37294668", + "pmid:37288312", + "pmid:37223130", + "pmid:37202167", + "pmid:37178170", + "pmid:37173134", + "pmid:37147520", + "pmid:37146135", + "pmid:37138766", + "pmid:37138765", + "pmid:37133535", + "pmid:37107688", + "pmid:37080969", + "pmid:37073950", + "pmid:37043475", + "pmid:37015082", + "pmid:37010807", + "pmid:37006326", + "pmid:36963214", + "pmid:36936421", + "pmid:36857431", + "pmid:36823368", + "pmid:36822200", + "pmid:36799407", + "pmid:36764521", + "pmid:36711601", + "pmid:36650645", + "pmid:36638803", + "pmid:36619668", + "pmid:36549973", + "pmid:36515702", + "pmid:36511680", + "pmid:36511398", + "pmid:36494425", + "pmid:36482247", + "pmid:36458975", + "pmid:36454749", + "pmid:36446586", + "pmid:36443488", + "pmid:36438488", + "pmid:36409902", + "pmid:36379394", + "pmid:36373318", + "pmid:36345033", + "pmid:36322143", + "pmid:36308529", + "pmid:36271076", + "pmid:36252286", + "pmid:36226890", + "pmid:36220889", + "pmid:36219176", + "pmid:36217158", + "pmid:36202819", + "pmid:36151083", + "pmid:36148898", + "pmid:36130523", + "pmid:36108486", + "pmid:36103513", + "pmid:38933387", + "pmid:36070099", + "pmid:36008116", + "pmid:35989899", + "pmid:35974122", + "pmid:35933239", + "pmid:35908282", + "pmid:35906014", + "pmid:35903771", + "pmid:35895140", + "pmid:35876881", + "pmid:35869263", + "pmid:35843530", + "pmid:35813024", + "pmid:35793625", + "pmid:35766328", + "pmid:35752680", + "pmid:35746899", + "pmid:35726380", + "pmid:35675776", + "pmid:35661131", + "pmid:35633169", + "pmid:35625816", + "pmid:35599735", + "pmid:35594156", + "pmid:35592494", + "pmid:35589711", + "pmid:35568435", + "pmid:35525134", + "pmid:35462091", + "pmid:35383205", + "pmid:35379876", + "pmid:35379698", + "pmid:35314728", + "pmid:35295181", + "pmid:35259014", + "pmid:35189395", + "pmid:35182509", + "pmid:35171477", + "pmid:35152451", + "pmid:35096836", + "pmid:35091648", + "pmid:35052416", + "pmid:35047667", + "pmid:35026048", + "pmid:35007998", + "pmid:34978044", + "pmid:34949835", + "pmid:34915153", + "pmid:34853325", + "pmid:34848561", + "pmid:34827542", + "pmid:34791698", + "pmid:34723963", + "pmid:34717271", + "pmid:34705518", + "pmid:34687211", + "pmid:34677935", + "pmid:34654821", + "pmid:34638725", + "pmid:34573259", + "pmid:34542927", + "pmid:34534264", + "pmid:34526954", + "pmid:34475377", + "pmid:34450161", + "pmid:34440384", + "pmid:34435379", + "pmid:34431456", + "pmid:34404558", + "pmid:34397416", + "pmid:34389718", + "pmid:34389711", + "pmid:34386583", + "pmid:34382491", + "pmid:34376242", + "pmid:34328616", + "pmid:34318620", + "pmid:34310040", + "pmid:34305575", + "pmid:34297726", + "pmid:34233951", + "pmid:34229542", + "pmid:34209673", + "pmid:34187866", + "pmid:34179866", + "pmid:34174288", + "pmid:34172817", + "pmid:34170347", + "pmid:34168085", + "pmid:34157654", + "pmid:34152475", + "pmid:34140881", + "pmid:34133945", + "pmid:34118929", + "pmid:34099711", + "pmid:34093394", + "pmid:34051439", + "pmid:34048588", + "pmid:33977144", + "pmid:33967699", + "pmid:33935096", + "pmid:33906932", + "pmid:33892814", + "pmid:33889947", + "pmid:33857770", + "pmid:33837088", + "pmid:33833668", + "pmid:33830997", + "pmid:33815737", + "pmid:33789100", + "pmid:33788382", + "pmid:33741069", + "pmid:33739284", + "pmid:33737586", + "pmid:33730968", + "pmid:33726839", + "pmid:33709219", + "pmid:33705846", + "pmid:33663561", + "pmid:33661518", + "pmid:33619157", + "pmid:33601107", + "pmid:33588953", + "pmid:33558503", + "pmid:33554115", + "pmid:33482083", + "pmid:33431483", + "pmid:33414559", + "pmid:33409820", + "pmid:33378537", + "pmid:33377399", + "pmid:33376800", + "pmid:33363944", + "pmid:33329355", + "pmid:33300868", + "pmid:33276461", + "pmid:33253636", + "pmid:33196168", + "pmid:33168090", + "pmid:33168078", + "pmid:33149115", + "pmid:33131137", + "pmid:33129345", + "pmid:33123074", + "pmid:33058338", + "pmid:33055142", + "pmid:33022226", + "pmid:32989102", + "pmid:32961393", + "pmid:32958650", + "pmid:32954321", + "pmid:32949047", + "pmid:32921502", + "pmid:32894207", + "pmid:32878979", + "pmid:32865792", + "pmid:32845284", + "pmid:32843153", + "pmid:32843152", + "pmid:32830871", + "pmid:32823188", + "pmid:32821252", + "pmid:32769055", + "pmid:32759310", + "pmid:32755582", + "pmid:32721467", + "pmid:32683569", + "pmid:32675418", + "pmid:32638105", + "pmid:32628322", + "pmid:32554322", + "pmid:32521185", + "pmid:32504093", + "pmid:32500377", + "pmid:32485711", + "pmid:32483373", + "pmid:32441885", + "pmid:32421156", + "pmid:32410933", + "pmid:32385536", + "pmid:32375063", + "pmid:32375043", + "pmid:32347002", + "pmid:32338076", + "pmid:32296747", + "pmid:32284607", + "pmid:32281118", + "pmid:32278549", + "pmid:32226938", + "pmid:32223927", + "pmid:32184029", + "pmid:32180125", + "pmid:32175624", + "pmid:32151952", + "pmid:32132225", + "pmid:32125773", + "pmid:32123048", + "pmid:32119645", + "pmid:32100453", + "pmid:32093728", + "pmid:32084385", + "pmid:32082115", + "pmid:32070418", + "pmid:32059759", + "pmid:32042907", + "pmid:32035967", + "pmid:32035847", + "pmid:32000838", + "pmid:31991801", + "pmid:31930538", + "pmid:31925813", + "pmid:31858749", + "pmid:31852251", + "pmid:31847700", + "pmid:31843021", + "pmid:31836585", + "pmid:31831332", + "pmid:31810584", + "pmid:31800202", + "pmid:31791419", + "pmid:31702465", + "pmid:31676125", + "pmid:31651360", + "pmid:31649034", + "pmid:31647549", + "pmid:31642962", + "pmid:31637556", + "pmid:31633109", + "pmid:31625563", + "pmid:31624333", + "pmid:31619481", + "pmid:31594549", + "pmid:31587919", + "pmid:31586943", + "pmid:31582231", + "pmid:31579943", + "pmid:31578297", + "pmid:31561355", + "pmid:31559531", + "pmid:31551693", + "pmid:31530427", + "pmid:31499409", + "pmid:31475037", + "pmid:31444357", + "pmid:31439573", + "pmid:31432691", + "pmid:31375896", + "pmid:31358992", + "pmid:31327044", + "pmid:31325016", + "pmid:31205123", + "pmid:31176718", + "pmid:31156370", + "pmid:31127772", + "pmid:31086314", + "pmid:31041398", + "pmid:31036086", + "pmid:31019099", + "pmid:31019093", + "pmid:31009932", + "pmid:31007077", + "pmid:30992335", + "pmid:30992141", + "pmid:30992063", + "pmid:30985904", + "pmid:30981631", + "pmid:30979436", + "pmid:30945056", + "pmid:30938419", + "pmid:30863279", + "pmid:30861516", + "pmid:30859373", + "pmid:30846540", + "pmid:30790403", + "pmid:30777654", + "pmid:30767771", + "pmid:30739198", + "pmid:30714955", + "pmid:30711674", + "pmid:30685122", + "pmid:30643298", + "pmid:30617627", + "pmid:30617154", + "pmid:30610877", + "pmid:30554355", + "pmid:30550541", + "pmid:30530974", + "pmid:30528349", + "pmid:30527999", + "pmid:30454072", + "pmid:30447080", + "pmid:30396881", + "pmid:30356970", + "pmid:30349864", + "pmid:30347338", + "pmid:30337192", + "pmid:30336474", + "pmid:30320585", + "pmid:30312838", + "pmid:30310141", + "pmid:30261505", + "pmid:30252044", + "pmid:30239641", + "pmid:30233460", + "pmid:30213863", + "pmid:30210275", + "pmid:30150298", + "pmid:30126445", + "pmid:30109267", + "pmid:30099204", + "pmid:30093141", + "pmid:30090657", + "pmid:30075745", + "pmid:30023173", + "pmid:30022074", + "pmid:29973287", + "pmid:29957385", + "pmid:29942091", + "pmid:29912891", + "pmid:29895397", + "pmid:29889265", + "pmid:29866399", + "pmid:29861044", + "pmid:29859640", + "pmid:29855382", + "pmid:29848387", + "pmid:29801887", + "pmid:29761121", + "pmid:29750243", + "pmid:29748150", + "pmid:29738460", + "pmid:29628143", + "pmid:29610297", + "pmid:29598923", + "pmid:29525180", + "pmid:29507424", + "pmid:29493298", + "pmid:29480190", + "pmid:29480183", + "pmid:29479499", + "pmid:29476165", + "pmid:29449030", + "pmid:29441485", + "pmid:29439323", + "pmid:29400714", + "pmid:29380049", + "pmid:29367641", + "pmid:29352617", + "pmid:29352102", + "pmid:29316893", + "pmid:29302060", + "pmid:29281254", + "pmid:29274668", + "pmid:29264395", + "pmid:29222490", + "pmid:29216908", + "pmid:29196813", + "pmid:29170628", + "pmid:29166782", + "pmid:29149615", + "pmid:29131108", + "pmid:29113975", + "pmid:29095328", + "pmid:29080331", + "pmid:29056323", + "pmid:29055436", + "pmid:29049464", + "pmid:29036691", + "pmid:28973350", + "pmid:28889094", + "pmid:28887402", + "pmid:28827593", + "pmid:28808785", + "pmid:28803727", + "pmid:28749476", + "pmid:28720882", + "pmid:28714954", + "pmid:28677678", + "pmid:28666709", + "pmid:28660252", + "pmid:28642336", + "pmid:28637276", + "pmid:28614712", + "pmid:28606110", + "pmid:28570551", + "pmid:28551275", + "pmid:28550099", + "pmid:28542233", + "pmid:28539470", + "pmid:28527524", + "pmid:28508101", + "pmid:28491898", + "pmid:28482638", + "pmid:28481984", + "pmid:28462717", + "pmid:28452351", + "pmid:28439722", + "pmid:28431575", + "pmid:28420437", + "pmid:28408402", + "pmid:28387671", + "pmid:28365006", + "pmid:28356511", + "pmid:28351931", + "pmid:28334866", + "pmid:28322003", + "pmid:28320191", + "pmid:28306503", + "pmid:28222900", + "pmid:28197542", + "pmid:28192553", + "pmid:28160950", + "pmid:28158451", + "pmid:28132891", + "pmid:28131227", + "pmid:28124431", + "pmid:28116236", + "pmid:28105640", + "pmid:28103472", + "pmid:28089114", + "pmid:28088213", + "pmid:28010125", + "pmid:28003435", + "pmid:27936955", + "pmid:27933757", + "pmid:27875531", + "pmid:27797809", + "pmid:27796305", + "pmid:27790088", + "pmid:27688759", + "pmid:27739539", + "pmid:27773700", + "pmid:27595458", + "pmid:27768896", + "pmid:27756805", + "pmid:27720481", + "pmid:27732842", + "pmid:27671483", + "pmid:27666590", + "pmid:27663272", + "pmid:27652840", + "pmid:27646412", + "pmid:27623008", + "pmid:27617292", + "pmid:27516603", + "pmid:27480424", + "pmid:27473499", + "pmid:27461252", + "pmid:27413586", + "pmid:27400454", + "pmid:27388677", + "pmid:27375918", + "pmid:27369896", + "pmid:27334615", + "pmid:27327087", + "pmid:27288208", + "pmid:27274540", + "pmid:27245636", + "pmid:27241037", + "pmid:27195002", + "pmid:27193190", + "pmid:27151634", + "pmid:27112497", + "pmid:27097283", + "pmid:27079381", + "pmid:26998601", + "pmid:26979938", + "pmid:26967212", + "pmid:26931465", + "pmid:26925510", + "pmid:26919046", + "pmid:26915990", + "pmid:26903389", + "pmid:26878348", + "pmid:26862832", + "pmid:26839080", + "pmid:26810537", + "pmid:26785370", + "pmid:26777436", + "pmid:26769963", + "pmid:26746986", + "pmid:26735706", + "pmid:26733254", + "pmid:26728149", + "pmid:26725464", + "pmid:26723138", + "pmid:28337409", + "pmid:26691640", + "pmid:26690922", + "pmid:26674655", + "pmid:26637797", + "pmid:26632347", + "pmid:26599997", + "pmid:26584779", + "pmid:26551617", + "pmid:26547294", + "pmid:26538301", + "pmid:26526532", + "pmid:26497991", + "pmid:26481318", + "pmid:26463209", + "pmid:26437865", + "pmid:29213991", + "pmid:26408000", + "pmid:26401819", + "pmid:26374446", + "pmid:26350237", + "pmid:26348842", + "pmid:26347457", + "pmid:26308983", + "pmid:26308899", + "pmid:26308891", + "pmid:26304661", + "pmid:26275564", + "pmid:26254955", + "pmid:26234378", + "pmid:26233805", + "pmid:26174152", + "pmid:26166205", + "pmid:26146826", + "pmid:26142124", + "pmid:26108573", + "pmid:26099177", + "pmid:26095883", + "pmid:26083476", + "pmid:26044557", + "pmid:26031661", + "pmid:26022924", + "pmid:26016851", + "pmid:25977373", + "pmid:25943890", + "pmid:25943887", + "pmid:25934183", + "pmid:25835037", + "pmid:25795648", + "pmid:25791939", + "pmid:25788698", + "pmid:25756586", + "pmid:25732802", + "pmid:25716178", + "pmid:25712133", + "pmid:25637145", + "pmid:25618255", + "pmid:25617006", + "pmid:25595499", + "pmid:25585530", + "pmid:25531686", + "pmid:25467142", + "pmid:25457023", + "pmid:25442110", + "pmid:25436637", + "pmid:25433797", + "pmid:25433461", + "pmid:25388784", + "pmid:25377888", + "pmid:25326098", + "pmid:25319030", + "pmid:25308964", + "pmid:25284081", + "pmid:25281017", + "pmid:25273996", + "pmid:25248608", + "pmid:25239657", + "pmid:25210488", + "pmid:25207541", + "pmid:25203513", + "pmid:25185840", + "pmid:25182743", + "pmid:25179228", + "pmid:25173361", + "pmid:25158292", + "pmid:25156163", + "pmid:25147206", + "pmid:25132468", + "pmid:25123918", + "pmid:25120191", + "pmid:25115936", + "pmid:25111021", + "pmid:25108559", + "pmid:25098532", + "pmid:25085782", + "pmid:25081482", + "pmid:25034271", + "pmid:24950788", + "pmid:24928930", + "pmid:24908669", + "pmid:24908169", + "pmid:24898647", + "pmid:24866401", + "pmid:24866055", + "pmid:24861139", + "pmid:24819148", + "pmid:24806409", + "pmid:24803912", + "pmid:24798095", + "pmid:24756204", + "pmid:24733620", + "pmid:24706941", + "pmid:24704492", + "pmid:24667415", + "pmid:24650794", + "pmid:24612676", + "pmid:24598541", + "pmid:24573903", + "pmid:24559645", + "pmid:24549040", + "pmid:24530272", + "pmid:24445987", + "pmid:24442578", + "pmid:24439166", + "pmid:24417314", + "pmid:24387986", + "pmid:24387985", + "pmid:24385136", + "pmid:24378086", + "pmid:24363131", + "pmid:24355526", + "pmid:24329881", + "pmid:24319645", + "pmid:24309270", + "pmid:24286341", + "pmid:24269022", + "pmid:24269018", + "pmid:24252571", + "pmid:24252525", + "pmid:24248382", + "pmid:24212388", + "pmid:24179835", + "pmid:24170096", + "pmid:24169076", + "pmid:24166615", + "pmid:24154603", + "pmid:24139042", + "pmid:24129584", + "pmid:24126854", + "pmid:24121957", + "pmid:24107864", + "pmid:24096617", + "pmid:24080172", + "pmid:24077574", + "pmid:24068985", + "pmid:24057670", + "pmid:24053774", + "pmid:24052799", + "pmid:24027057", + "pmid:24011653", + "pmid:23998997", + "pmid:23987827", + "pmid:23973441", + "pmid:23962495", + "pmid:23922030", + "pmid:23894576", + "pmid:23884045", + "pmid:23870417", + "pmid:23869403", + "pmid:23845100", + "pmid:23836460", + "pmid:23836290", + "pmid:23818065", + "pmid:23771489", + "pmid:23731538", + "pmid:23720273", + "pmid:23695224", + "pmid:23686809", + "pmid:23597494", + "pmid:23588498", + "pmid:23588422", + "pmid:23587638", + "pmid:23566336", + "pmid:23553481", + "pmid:23551834", + "pmid:23548882", + "pmid:23473366", + "pmid:23437264", + "pmid:23435409", + "pmid:23434116", + "pmid:23423380", + "pmid:23421625", + "pmid:23415312", + "pmid:23413259", + "pmid:23383383", + "pmid:23381195", + "pmid:23358603", + "pmid:23352322", + "pmid:23338750", + "pmid:23338682", + "pmid:23329412", + "pmid:23284068", + "pmid:23273600", + "pmid:23261768", + "pmid:23254636", + "pmid:23216213", + "pmid:23199140", + "pmid:23151261", + "pmid:23141412", + "pmid:23117491", + "pmid:23116878", + "pmid:23107433", + "pmid:23088937", + "pmid:23085936", + "pmid:23084342", + "pmid:23063644", + "pmid:23053136", + "pmid:23053135", + "pmid:23036583", + "pmid:23035801", + "pmid:23016833", + "pmid:23012445", + "pmid:23006986", + "pmid:22993125", + "pmid:22985429", + "pmid:22964911", + "pmid:22936364", + "pmid:22918453", + "pmid:22898310", + "pmid:22892647", + "pmid:22878164", + "pmid:22875087", + "pmid:22875086", + "pmid:22843265", + "pmid:22840558", + "pmid:22818528", + "pmid:22815561", + "pmid:22766732", + "pmid:22766072", + "pmid:22742426", + "pmid:22739338", + "pmid:22727276", + "pmid:22721568", + "pmid:22720079", + "pmid:22708871", + "pmid:22702520", + "pmid:22692064", + "pmid:22673113", + "pmid:22650353", + "pmid:22645277", + "pmid:22637471", + "pmid:22637429", + "pmid:22571983", + "pmid:22564974", + "pmid:22550220", + "pmid:22507827", + "pmid:22502998", + "pmid:22499346", + "pmid:22483864", + "pmid:22459598", + "pmid:22426854", + "pmid:22418734", + "pmid:22410647", + "pmid:22406229", + "pmid:22399793", + "pmid:22366794", + "pmid:22366793", + "pmid:22366792", + "pmid:22366791", + "pmid:22343411", + "pmid:22305801", + "pmid:22300876", + "pmid:22300873", + "pmid:22228244", + "pmid:22216764", + "pmid:22181065", + "pmid:22154785", + "pmid:22101323", + "pmid:22083254", + "pmid:21944779" + ] + }, { - "motif": "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": null, - "pathogenic_max": null, - "motif_len": 33, - "ref_copies": 17.0, - "novel": null, - "gard": [], - "genereviews": [], - "malacard": ["MTR082"], - "medgen": ["342845"], - "mondo": ["0012348"], - "omim": ["609812"], - "orphanet": ["552"], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": ["contraction", "motif_affects_pathogenicity"], - "disease_tags": [], - "references": ["pmid:19760265", "pmid:16369531", "pmid:39361122", "omim:609812"], - "additional_literature": ["pmid:41894686", "pmid:41057236", "pmid:40840513", "pmid:40641008", "pmid:39710966", "pmid:38483348", "pmid:38473919", "pmid:38458477", "pmid:36379850", "pmid:35583610", "pmid:35215948", "pmid:35156195", "pmid:35082198", "pmid:34850019", "pmid:34507899", "pmid:34100900", "pmid:33862081", "pmid:27802312", "pmid:27650499", "pmid:27773618", "pmid:23395566", "pmid:21784842", "pmid:15841033"] -}, -{ - "id": "DM2_CNBP", - "disease_id": "DM2", - "gene": "CNBP", - "evidence": ["Definitive"], - "chrom": "chr3", - "start_hg38": 129172576, - "stop_hg38": 129172656, - "start_hg19": 128891419, - "stop_hg19": 128891499, - "start_t2t": 131917482, - "stop_t2t": 131917557, - "disease": "Myotonic dystrophy type 2", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Myotonic dystrophy type 2 (MD2), also known as proximal myotonic myopathy, is a very rare genetic multi-system disorder of late childhood or adult-onset characterized by mild myotonia, muscle weakness, and rarely cardiac conduction disorders [@mondo:0011266].", - "hpo_terms": null, - "prevalence": "2.29/100000", - "prevalence_details": "2.29/100,000 [@pmid:35483324]; population specific prevalence [@genereviews:NBK1466]. Most cases have European ancestry, but disease has been reported worldwide [@genereviews:NBK1466].", - "age_onset": "Typical: 28-56 [@pmid:29086017]; Range: 0-73 [@pmid:31159885].", - "age_onset_min": 0.0, - "age_onset_max": 73.0, - "typ_age_onset_min": 28.0, - "typ_age_onset_max": 56.0, - "details": "≤30 uninterrupted CCTG repeats or 11-26 CCTG repeats with GCTC/TCTG interruptions are considered benign; 27-29 repeats with interruptions have currently unknown significance, ~30-~54 repeats are considered premutations, ~55-74 repeats are premutations with possible reduced penetrance, and >74 repeat alleles are considered pathogenic [@genereviews:NBK1466]. Penetrance is age-dependent and approaches 100%. Locus structure is (TG)n(TCTG)n(CCTG)n. CCTG expansion causes DM2 but the other repeat units are also variable. Interruptions include GCTG/TCTG/GGCT [@pmid:35245110]. Many DM2 expansions include a downstream 3' (TCTG)n block after the main array. One cohort found this structure in 88% of DM2 patients [@pmid:39703464].", - "detection": "Bidirectional RP-PCR and Southern blotting are commonly used for detection [@genereviews:NBK1466]. A downstream 3′ (TCTG)n block can cause false negative or unclear results, so TCTG targeted RP-PCR or long-read sequencing has been used to resolve these cases [@pmid:36018009; @pmid:41937177].", - "mechanism": "GoF", - "mechanism_detail": "Aberrant splicing, RAN translation [@pmid:22140091; @pmid:38467784]. Proposed pathogenisis contributions include nucleolar stress, autophagy dysregulation, and stress granule formation [@pmid:42003432].", - "year": "2001 [@pmid:11486088]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CAGG"], - "pathogenic_motif_reference_orientation": ["CAGG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["CAGA"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCTG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["CTGT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "SCA6_CACNA1A", + "disease_id": "SCA6", + "gene": "CACNA1A", + "evidence": [ + "Definitive" + ], + "chrom": "chr19", + "start_hg38": 13207858, + "stop_hg38": 13207898, + "start_hg19": 13318672, + "stop_hg19": 13318712, + "start_t2t": 13333136, + "stop_t2t": 13333176, + "disease": "Spinocerebellar ataxia type 6", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 6 (SCA6) is the most common subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by late-onset and slowly progressive gait ataxia and other cerebellar signs such as impaired muscle coordination and nystagmus [@mondo:0008457]. Ao et al. have proposed that this expansion may have effects on chronotype, differing by sex and menopausal status, as well as depression severity [@pmid:41358280].", + "hpo_terms": null, + "prevalence": "2.65/100000", + "prevalence_details": "13-15% of global SCA prevalence, estimated to be 0.02-31/100,000 [@genereviews:NBK1140; @pmid:29100084]: resultant estimate is 0.3-5/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1140].", + "age_onset": "Typical: 43-52 [@genereviews:NBK1140]; Range: 16 [@pmid:23331413] - 73 [@genereviews:NBK1140].", + "age_onset_min": 16, + "age_onset_max": 73, + "typ_age_onset_min": 43, + "typ_age_onset_max": 52, + "details": "The intermediate range (19-20 motifs) [@pmid:39996131; @genereviews:NBK1140] can be associated with a premutation, reduced penetrance, atypical phenotype, or a disease state when homozygous [@genereviews:NBK1140]. When the longer allele is > 22 motifs, the short allele does not play a role in pathogenicity/age of onset, but expansions of 21-22 motifs have age of onset influenced by the smaller allele [@pmid:39996131]. For individuals with a longest allele of 19-20, the presence of a second allele of 19-20 likely increases the risk of developing SCA6 [@pmid:39996131]. Undiagnosed carriers of pathogenic range repeats in CACNA1A exhibit significant cerebellar volume loss and elevated NEFL levels before clinical diagnosis, also seen in other loci [@pmid:41951733].", + "detection": "Expansions have been detected by PCR fragment analysis [@pmid:35573049].", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyglutamine expansions associated with increased expression of altered product leading to impaired gene binding and transcription factor function as well as cellular toxicity [@genereviews:NBK1140].", + "year": "1997 [@pmid:8988170]", + "location_in_gene": "Coding, Last Exon: 47 or 48", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CTG" + ], + "pathogenic_motif_reference_orientation": [ + "CTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 18, + "intermediate_min": 19, + "intermediate_max": 20, + "pathogenic_min": 21, + "pathogenic_max": 33, + "motif_len": 3, + "ref_copies": 13.3, + "novel": "ref", + "gard": [ + "10351" + ], + "genereviews": [ + "NBK1140" + ], + "malacard": [ + "SPN309" + ], + "medgen": [ + "148458" + ], + "mondo": [ + "0008457" + ], + "omim": [ + "183086" + ], + "orphanet": [ + "98758" + ], + "gnomad": [ + "CACNA1A" + ], + "stripy": [ + "CACNA1A" + ], + "tr_atlas": [ + "TR154515" + ], + "webstr_hg38": [ + "5624835" + ], + "webstr_hg19": [ + "Expansion_SCA6/CACNA1A" + ], + "locus_tags": [ + "length_affects_phenotype", + "length_affects_penetrance", + "length_affects_onset" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK1140", + "pmid:23331413", + "doi:10.1212/NXG.0000000000200245", + "pmid:41951733", + "pmid:29100084", + "pmid:8988170", + "mondo:0008457", + "pmid:41358280" + ], + "additional_literature": [ + "pmid:42038259", + "pmid:41951733", + "pmid:41771688", + "pmid:41762523", + "pmid:41612618", + "pmid:41082794", + "pmid:41009775", + "pmid:40906330", + "pmid:40900235", + "pmid:40879304", + "pmid:40746751", + "pmid:40488180", + "pmid:40189664", + "pmid:39812846", + "pmid:39571249", + "pmid:39152783", + "pmid:39048885", + "pmid:38961870", + "pmid:38227102", + "pmid:38165578", + "pmid:38152578", + "pmid:37848721", + "pmid:37307504", + "pmid:37301203", + "pmid:36618024", + "pmid:36599645", + "pmid:36530930", + "pmid:35962273", + "pmid:35188716", + "pmid:35182509", + "pmid:35052497", + "pmid:34647648", + "pmid:34600502", + "pmid:34565721", + "pmid:34371182", + "pmid:34159894", + "pmid:33502644", + "pmid:33121221", + "pmid:32888184", + "pmid:32822634", + "pmid:31522753", + "pmid:30891880", + "pmid:30591349", + "pmid:30342765", + "pmid:30314815", + "pmid:30120431", + "pmid:30078120", + "pmid:29959555", + "pmid:29553382", + "pmid:29367260", + "pmid:29316893", + "pmid:29249939", + "pmid:29111027", + "pmid:29057148", + "pmid:28946818", + "pmid:28782341", + "pmid:28585930", + "pmid:28444220", + "pmid:28131213", + "pmid:27979829", + "pmid:27896316", + "pmid:27848087", + "pmid:27806289", + "pmid:27412786", + "pmid:27400454", + "pmid:27333979", + "pmid:26730403", + "pmid:26377379", + "pmid:26374734", + "pmid:26354989", + "pmid:26077168", + "pmid:26054379", + "pmid:25634432", + "pmid:25624155", + "pmid:25466696", + "pmid:24780882", + "pmid:24534762", + "pmid:24486772", + "pmid:24209901", + "pmid:23423669", + "pmid:23407676", + "pmid:23368522", + "pmid:23026538", + "pmid:22520093", + "pmid:26859398", + "pmid:26676458", + "pmid:21832228", + "pmid:21550405", + "pmid:20069235", + "pmid:19631275", + "pmid:19429075", + "pmid:19259763", + "pmid:19224313", + "pmid:18949263", + "pmid:18759344", + "pmid:18687887", + "pmid:18685131", + "pmid:18684474", + "pmid:18506570", + "pmid:18418678", + "pmid:18285829", + "pmid:18074367", + "pmid:17961920", + "pmid:17682009", + "pmid:17516099", + "pmid:17420317", + "pmid:16396623", + "pmid:16389595", + "pmid:16310805", + "pmid:16000334", + "pmid:15875905", + "pmid:15747371", + "pmid:15553088", + "pmid:15148151", + "pmid:15080863", + "pmid:15026782", + "pmid:14967767", + "pmid:14966163", + "pmid:14756671", + "pmid:14534930", + "pmid:12810491", + "pmid:12764052", + "pmid:12676347", + "pmid:12614315", + "pmid:12545428", + "pmid:11939898", + "pmid:11889231", + "pmid:11839840", + "pmid:11804332", + "pmid:11717352", + "pmid:11708993", + "pmid:11448300", + "pmid:11355155", + "pmid:11341481", + "pmid:11311290", + "pmid:11176970", + "pmid:11160961", + "pmid:10369884", + "pmid:11081813", + "pmid:11030410", + "pmid:10985694", + "pmid:10964945", + "pmid:10945665", + "pmid:10942107", + "pmid:10894992", + "pmid:10785256", + "pmid:10768629", + "pmid:10766906", + "pmid:10690991", + "pmid:10674974", + "pmid:10601803", + "pmid:10453742", + "pmid:10442462", + "pmid:10369863", + "pmid:10369828", + "pmid:10366652", + "pmid:10225349", + "pmid:9973298", + "pmid:9915947", + "pmid:9879686", + "pmid:9855520", + "pmid:9779664", + "pmid:9758625", + "pmid:9741473", + "pmid:9696528", + "pmid:9674805", + "pmid:9613852", + "pmid:9600677", + "pmid:9559993", + "pmid:9507387", + "pmid:9436730", + "pmid:9385362", + "pmid:9371901", + "pmid:9371900", + "pmid:9403486", + "pmid:9403480", + "pmid:9345107", + "pmid:9339681", + "pmid:9302278", + "pmid:9311738", + "pmid:9259275", + "pmid:9259274", + "pmid:10464657", + "pmid:9043864" + ] + }, { - "motif": "CAGG", - "count": null, - "type": "pathogenic_repeat" + "id": "JBS_CBL", + "disease_id": "JBS", + "gene": "CBL", + "evidence": [ + "Definitive" + ], + "chrom": "chr11", + "start_hg38": 119206289, + "stop_hg38": 119206323, + "start_hg19": 119076999, + "stop_hg19": 119077033, + "start_t2t": 119226662, + "stop_t2t": 119226696, + "disease": "Jacobsen syndrome (FRAX11B fragile site)", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A multiple congenital anomaly/intellectual disability contiguous gene syndrome caused by partial deletion of the long arm of chromosome 11 [@mondo:0007838].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "1/100,000 births; female/male ratio 2:1 [@pmid:19267933]. Found across ancestries/ethnicities [@omim:147791].", + "age_onset": "Condition at birth.", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "70% of individuals have 11 repeats [@pmid:7603564], but pathogenic expansion can span hundreds of motifs [@pmid:10767345]. The CGG repeat expansion can lead to a fragile site and subsequent deletion of 11q (shown in 2 cases) but total causality is unclear; intermediate alleles are associated with a premutation [@pmid:19267933].", + "detection": null, + "mechanism": "Hypermethylation", + "mechanism_detail": "DNA hypermethylation/11q deletion in sporadic cases [@pmid:38467784].", + "year": "1995 [@pmid:7603564]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CGG" + ], + "pathogenic_motif_reference_orientation": [ + "CGG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 79, + "intermediate_min": 80, + "intermediate_max": 100, + "pathogenic_min": 101, + "pathogenic_max": 300, + "motif_len": 3, + "ref_copies": 11.3, + "novel": "ref", + "gard": [ + "307" + ], + "genereviews": [], + "malacard": [ + "JCB001" + ], + "medgen": [ + "162878" + ], + "mondo": [ + "0007838" + ], + "omim": [ + "147791" + ], + "orphanet": [ + "2308" + ], + "gnomad": [ + "CBL" + ], + "stripy": [ + "CBL" + ], + "tr_atlas": [ + "TR112816" + ], + "webstr_hg38": [ + "6166081", + "430025" + ], + "webstr_hg19": [ + "STR_266122" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:38467784", + "pmid:7603564", + "pmid:10767345", + "pmid:19267933", + "omim:147791", + "mondo:0007838" + ], + "additional_literature": [ + "pmid:41964119", + "pmid:37422244", + "pmid:22131879", + "pmid:22084433", + "pmid:16474167" + ] }, { - "motif": "CAGA", - "count": 10, - "type": "flank_repeat" + "id": "MODY8_CEL", + "disease_id": "MODY8", + "gene": "CEL", + "evidence": [ + "Provisional" + ], + "chrom": "chr9", + "start_hg38": 133071177, + "stop_hg38": 133071737, + "start_hg19": 135946564, + "stop_hg19": 135947124, + "start_t2t": 145285333, + "stop_t2t": 145285861, + "disease": "Maturity-Onset Diabetes of the Young Type 8", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions [@genereviews:NBK500456]. In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype [@pmid:34850019]. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED) [@pmid:18544793].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265].", + "age_onset": "11-17 [@pmid:19760265]", + "age_onset_min": 11, + "age_onset_max": 17, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5 [@pmid:34850019]. One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential [@pmid:38483348]. Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse [@pmid:19760265]. Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs) [@pmid:39361122]. Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved [@pmid:21784842; @pmid:27650499; @pmid:33862081]. Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects [@pmid:38483348].", + "year": "2005", + "location_in_gene": "Exon 11", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG" + ], + "pathogenic_motif_reference_orientation": [ + "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": null, + "pathogenic_max": null, + "motif_len": 33, + "ref_copies": 17, + "novel": null, + "gard": [], + "genereviews": [], + "malacard": [ + "MTR082" + ], + "medgen": [ + "342845" + ], + "mondo": [ + "0012348" + ], + "omim": [ + "609812" + ], + "orphanet": [ + "552" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [ + "contraction", + "motif_affects_pathogenicity" + ], + "disease_tags": [], + "references": [ + "pmid:19760265", + "pmid:16369531", + "pmid:39361122", + "omim:609812" + ], + "additional_literature": [ + "pmid:41894686", + "pmid:41057236", + "pmid:40840513", + "pmid:40641008", + "pmid:39710966", + "pmid:38483348", + "pmid:38473919", + "pmid:38458477", + "pmid:36379850", + "pmid:35583610", + "pmid:35215948", + "pmid:35156195", + "pmid:35082198", + "pmid:34850019", + "pmid:34507899", + "pmid:34100900", + "pmid:33862081", + "pmid:27802312", + "pmid:27650499", + "pmid:27773618", + "pmid:23395566", + "pmid:21784842", + "pmid:15841033" + ] }, { - "motif": "CA", - "count": 19, - "type": "flank_repeat" - }], - "benign_min": 11, - "benign_max": 26, - "intermediate_min": 27, - "intermediate_max": 74, - "pathogenic_min": 75, - "pathogenic_max": 11000, - "motif_len": 4, - "ref_copies": 20.8, - "novel": "ref", - "gard": ["9728"], - "genereviews": ["NBK1466"], - "malacard": ["MYT020"], - "medgen": ["419137"], - "mondo": ["0011266"], - "omim": ["602668"], - "orphanet": ["606"], - "gnomad": ["CNBP"], - "stripy": ["CNBP"], - "tr_atlas": ["TR35563", "TR35564", "TR35565"], - "webstr_hg38": ["741073"], - "webstr_hg19": [], - "locus_tags": ["somatic_instability", "motif_affects_instability"], - "disease_tags": ["myotonic_dystrophy"], - "references": ["pmid:29086017", "pmid:31159885", "pmid:22140091", "pmid:38467784", "pmid:42003432", "pmid:39643839", "genereviews:NBK1466", "pmid:35245110", "pmid:39703464", "pmid:35483324", "pmid:11486088", "mondo:0011266"], - "additional_literature": ["pmid:42094143", "pmid:41937177", "pmid:41610137", "pmid:41074692", "pmid:40113266", "pmid:39894140", "pmid:39240646", "pmid:39119544", "pmid:38922834", "pmid:37950892", "pmid:37461657", "pmid:37146135", "pmid:36778282", "pmid:36018009", "pmid:35945246", "pmid:35567413", "pmid:34101465", "pmid:34024776", "pmid:33595997", "pmid:31981476", "pmid:31927948", "pmid:30984523", "pmid:30140252", "pmid:30100878", "pmid:29973908", "pmid:29291944", "pmid:28623239", "pmid:28491317", "pmid:28130447", "pmid:27727437", "pmid:27222292", "pmid:26586700", "pmid:25443993", "pmid:25186227", "pmid:24907641", "pmid:23570879", "pmid:22723857", "pmid:22643181", "pmid:22587749", "pmid:22459146", "pmid:22332444", "pmid:22062891", "pmid:21303839", "pmid:21224892", "pmid:21204798", "pmid:20971734", "pmid:20491895", "pmid:20174632", "pmid:19683984", "pmid:19632331", "pmid:19218442", "pmid:18804219", "pmid:18213375", "pmid:16927100", "pmid:16624843", "pmid:16376058", "pmid:15718211", "pmid:15704146", "pmid:15322428", "pmid:15231584", "pmid:15215218", "pmid:15114529", "pmid:15019706", "pmid:14505273", "pmid:12970845", "pmid:12601109"] -}, -{ - "id": "EDM1-PSACH_COMP", - "disease_id": "EDM1, PSACH", - "gene": "COMP", - "evidence": ["Definitive"], - "chrom": "chr19", - "start_hg38": 18786034, - "stop_hg38": 18786050, - "start_hg19": 18896844, - "stop_hg19": 18896860, - "start_t2t": 18921630, - "stop_t2t": 18921645, - "disease": "Multiple epiphyseal dysplasia, Pseudoachondroplasia", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Pseudoachondroplasia is characterized by severe growth deficiency and deformations such as bow legs and hyperlordosis.; Multiple epiphyseal dysplasia type 1 (MED 1) is a form of multiple epiphyseal dysplasia that is characterized by normal or mild short stature, pain in the hips and/or knees, progressive deformity of extremities and early-onset osteoarthrosis. Specific features to MED 1 include a more pronounced involvement of hip joints and gait abnormality and a shorter adult height. MED1 is allelic to pseudoachondroplasia with which it shares clinical and radiological features. The disease follows an autosomal dominant mode of transmission [@mondo:0008322; @mondo:0007561].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Specific contribution of COMP repeats to EDM1 is unknown (~300 COMP mutation variants for both phenotypes); likely 1:90,000 prevalence for COMP-PSACH that is repeat-specific. Found across ancestries/ethnicities [@genereviews:NBK1123; @genereviews:NBK1487].", - "age_onset": "Typical: 0-2 (COMP-PSACH)/ 1-12 (EDM1); Range: 0 (PSACH) - 13 (EDM1). 3-13 specific to trinucleotide expansions (duplications) [@pmid:29530484], several contractions but unknown exact AoO [@genereviews:NBK1123; @genereviews:NBK1487].", - "age_onset_min": 3.0, - "age_onset_max": 13.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Both expansions to (GTC)6-7 and contractions to (GTC)4 are associated with disease [@genereviews:NBK1487].", - "detection": null, - "mechanism": "LoF/GoF?", - "mechanism_detail": "Poly-aspartic acid expansions, domain dependent [@pmid:29530484]; may involve misfolding but still unestablished [@genereviews:NBK1123].", - "year": "1999 [@pmid:9887340]", - "location_in_gene": "Coding Exon 13", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GTC"], - "pathogenic_motif_reference_orientation": ["GTC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ACG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 5, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 6, - "pathogenic_max": 7, - "motif_len": 3, - "ref_copies": 5.0, - "novel": "ref", - "gard": ["4540", "2180"], - "genereviews": ["NBK1123", "NBK1487"], - "malacard": ["EPP017", "PSD012"], - "medgen": ["98378", "325376"], - "mondo": ["0008322", "0007561"], - "omim": ["132400", "177170"], - "orphanet": ["750", "93308"], - "gnomad": ["COMP"], - "stripy": ["COMP"], - "tr_atlas": ["TR155017"], - "webstr_hg38": ["1317658"], - "webstr_hg19": ["STR_673389"], - "locus_tags": ["contraction"], - "disease_tags": ["phenotypic_spectrum"], - "references": ["pmid:29530484", "genereviews:NBK1123", "genereviews:NBK1487", "pmid:9887340", "mondo:0008322", "mondo:0007561"], - "additional_literature": ["pmid:32097846", "pmid:28924040", "pmid:21644213", "pmid:18353302", "pmid:15014436", "pmid:12483437"] -}, -{ - "id": "EPM_CSNK1E", - "disease_id": "EPM, DEE", - "gene": "CSNK1E", - "evidence": ["Limited"], - "chrom": "chr22", - "start_hg38": 38317282, - "stop_hg38": 38317375, - "start_hg19": 38713287, - "stop_hg19": 38713380, - "start_t2t": 38781587, - "stop_t2t": 38781680, - "disease": "Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Progressive myoclonic epilepsy is a heterogeneous neurodegenerative disorder characterized by early-onset myoclonus, epilepsy, generalized tonic-clonic seizures, and progressive neurological deterioration [@pmid:40751262]. It has also been proposed that this locus is also associated with developmental and epileptic encephalopathies [@pmid:39107278]. We hypothesize that the two diseases may make up an expressivity or phenotypic spectrum and/or that hypermethylation causes changes in onset and severity.", - "hpo_terms": ["HP:0001336 Myoclonous", "HP:0001251 Ataxia", "HP:0002080 Intention Tremor", "HP:0007000 Morning Myoclonic Jerks", "HP:0001260 Dysarthia", "HP:0001249 Intellectual Disability", "HP:0002392 EEG with Polyspike Wave Complexes", "HP:0002070 Limb Ataxia", "HP:0000726 Dementia", "HP:0000992 Cutaneous Photosensitivity"], - "prevalence": null, - "prevalence_details": "EPM found in one Azerbaijani proband [@pmid:40751262] and DEE found in two additional patients [@pmid:39107278]. This expansion has been reported in unaffected individuals [@pmid:40751262].", - "age_onset": "EPM case reports age of onset 10 years [@pmid:40751262] and DEE cases onset in infancy", - "age_onset_min": 0.0, - "age_onset_max": 10.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "CGG repeat in exon 1 of CSNK1E. Longest reported expanded allele of an affected individual is 745, with an unaffected sibling with repeat length 980. Father had a repeat of 8 and mother of 131.", - "detection": "Exome sequencing does not reliably detect expansions at this locus. Reported cases were identified through methylation outlier detection and confirmed by targeted long-read sequencing [@pmid:40751262].", - "mechanism": "Unknown", - "mechanism_detail": "Mechanism of this disease is largely unknown, but hypermethylation is observed. Expanded alleles exhibit hypermethylation and may mediate epigenetic silencing. Unaffected carriers have been observed, indicating variable expressivity or penetrance.", - "year": "2025", - "location_in_gene": "Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CCG"], - "pathogenic_motif_reference_orientation": ["CCG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "DM2_CNBP", + "disease_id": "DM2", + "gene": "CNBP", + "evidence": [ + "Definitive" + ], + "chrom": "chr3", + "start_hg38": 129172576, + "stop_hg38": 129172656, + "start_hg19": 128891419, + "stop_hg19": 128891499, + "start_t2t": 131917482, + "stop_t2t": 131917557, + "disease": "Myotonic dystrophy type 2", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Myotonic dystrophy type 2 (MD2), also known as proximal myotonic myopathy, is a very rare genetic multi-system disorder of late childhood or adult-onset characterized by mild myotonia, muscle weakness, and rarely cardiac conduction disorders [@mondo:0011266].", + "hpo_terms": null, + "prevalence": "2.29/100000", + "prevalence_details": "2.29/100,000 [@pmid:35483324]; population specific prevalence [@genereviews:NBK1466]. Most cases have European ancestry, but disease has been reported worldwide [@genereviews:NBK1466].", + "age_onset": "Typical: 28-56 [@pmid:29086017]; Range: 0-73 [@pmid:31159885].", + "age_onset_min": 0, + "age_onset_max": 73, + "typ_age_onset_min": 28, + "typ_age_onset_max": 56, + "details": "≤30 uninterrupted CCTG repeats or 11-26 CCTG repeats with GCTC/TCTG interruptions are considered benign; 27-29 repeats with interruptions have currently unknown significance, ~30-~54 repeats are considered premutations, ~55-74 repeats are premutations with possible reduced penetrance, and >74 repeat alleles are considered pathogenic [@genereviews:NBK1466]. Penetrance is age-dependent and approaches 100%. Locus structure is (TG)n(TCTG)n(CCTG)n. CCTG expansion causes DM2 but the other repeat units are also variable. Interruptions include GCTG/TCTG/GGCT [@pmid:35245110]. Many DM2 expansions include a downstream 3' (TCTG)n block after the main array. One cohort found this structure in 88% of DM2 patients [@pmid:39703464].", + "detection": "Bidirectional RP-PCR and Southern blotting are commonly used for detection [@genereviews:NBK1466]. A downstream 3′ (TCTG)n block can cause false negative or unclear results, so TCTG targeted RP-PCR or long-read sequencing has been used to resolve these cases [@pmid:36018009; @pmid:41937177].", + "mechanism": "GoF", + "mechanism_detail": "Aberrant splicing, RAN translation [@pmid:22140091; @pmid:38467784]. Proposed pathogenisis contributions include nucleolar stress, autophagy dysregulation, and stress granule formation [@pmid:42003432].", + "year": "2001 [@pmid:11486088]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CAGG" + ], + "pathogenic_motif_reference_orientation": [ + "CAGG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "CAGA" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCTG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "CTGT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "CAGG", + "count": null, + "type": "pathogenic_repeat" + }, + { + "motif": "CAGA", + "count": 10, + "type": "flank_repeat" + }, + { + "motif": "CA", + "count": 19, + "type": "flank_repeat" + } + ], + "benign_min": 11, + "benign_max": 26, + "intermediate_min": 27, + "intermediate_max": 74, + "pathogenic_min": 75, + "pathogenic_max": 11000, + "motif_len": 4, + "ref_copies": 20.8, + "novel": "ref", + "gard": [ + "9728" + ], + "genereviews": [ + "NBK1466" + ], + "malacard": [ + "MYT020" + ], + "medgen": [ + "419137" + ], + "mondo": [ + "0011266" + ], + "omim": [ + "602668" + ], + "orphanet": [ + "606" + ], + "gnomad": [ + "CNBP" + ], + "stripy": [ + "CNBP" + ], + "tr_atlas": [ + "TR35563", + "TR35564", + "TR35565" + ], + "webstr_hg38": [ + "741073" + ], + "webstr_hg19": [], + "locus_tags": [ + "somatic_instability", + "motif_affects_instability" + ], + "disease_tags": [ + "myotonic_dystrophy" + ], + "references": [ + "pmid:29086017", + "pmid:31159885", + "pmid:22140091", + "pmid:38467784", + "pmid:42003432", + "pmid:39643839", + "genereviews:NBK1466", + "pmid:35245110", + "pmid:39703464", + "pmid:35483324", + "pmid:11486088", + "mondo:0011266" + ], + "additional_literature": [ + "pmid:42094143", + "pmid:41937177", + "pmid:41610137", + "pmid:41074692", + "pmid:40113266", + "pmid:39894140", + "pmid:39240646", + "pmid:39119544", + "pmid:38922834", + "pmid:37950892", + "pmid:37461657", + "pmid:37146135", + "pmid:36778282", + "pmid:36018009", + "pmid:35945246", + "pmid:35567413", + "pmid:34101465", + "pmid:34024776", + "pmid:33595997", + "pmid:31981476", + "pmid:31927948", + "pmid:30984523", + "pmid:30140252", + "pmid:30100878", + "pmid:29973908", + "pmid:29291944", + "pmid:28623239", + "pmid:28491317", + "pmid:28130447", + "pmid:27727437", + "pmid:27222292", + "pmid:26586700", + "pmid:25443993", + "pmid:25186227", + "pmid:24907641", + "pmid:23570879", + "pmid:22723857", + "pmid:22643181", + "pmid:22587749", + "pmid:22459146", + "pmid:22332444", + "pmid:22062891", + "pmid:21303839", + "pmid:21224892", + "pmid:21204798", + "pmid:20971734", + "pmid:20491895", + "pmid:20174632", + "pmid:19683984", + "pmid:19632331", + "pmid:19218442", + "pmid:18804219", + "pmid:18213375", + "pmid:16927100", + "pmid:16624843", + "pmid:16376058", + "pmid:15718211", + "pmid:15704146", + "pmid:15322428", + "pmid:15231584", + "pmid:15215218", + "pmid:15114529", + "pmid:15019706", + "pmid:14505273", + "pmid:12970845", + "pmid:12601109" + ] + }, { - "motif": "CCG", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 0, - "benign_max": 48, - "intermediate_min": 49, - "intermediate_max": 131, - "pathogenic_min": 745, - "pathogenic_max": 980, - "motif_len": 3, - "ref_copies": null, - "novel": null, - "gard": ["7140"], - "genereviews": [], - "malacard": ["MYC080"], - "medgen": ["199732"], - "mondo": ["0020074"], - "omim": ["600863"], - "orphanet": [], - "gnomad": ["CSNK1E"], - "stripy": [], - "tr_atlas": ["TR344468"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": ["epilepsy"], - "references": ["pmid:40751262", "pmid:39107278", "pmid: 39107278"], - "additional_literature": [] -}, -{ - "id": "EPM1_CSTB", - "disease_id": "EPM1", - "gene": "CSTB", - "evidence": ["Definitive"], - "chrom": "chr21", - "start_hg38": 43776442, - "stop_hg38": 43776479, - "start_hg19": 45196323, - "stop_hg19": 45196360, - "start_t2t": 42132054, - "stop_t2t": 42132091, - "disease": "Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD)", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Unverricht-Lundborg disease (ULD) is a rare progressive myoclonic epilepsy disorder characterized by action- and stimulus-sensitive myoclonus, and tonic-clonic seizures with ataxia, but with only a mild cognitive decline over time [@mondo:0009698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Worldwide prevalence unknown; Finland prevalence 2-4/100,000. Found across ethnicities/ancestries, with population-dependent prevalence; highest in Tunisia, Algeria, Morocco, and Finland [@genereviews:NBK1142].", - "age_onset": "Typical: 6-15 [@genereviews:NBK1142]; Range: 6-18 [@pmid:18325013].", - "age_onset_min": 6.0, - "age_onset_max": 18.0, - "typ_age_onset_min": 6.0, - "typ_age_onset_max": 15.0, - "details": "Affected individuals have an unstable 12-nucleotide (dodecomer) repeat expansion. Alleles containing 2-3 motifs are considered benign, while alleles with 30-125 repeats are fully penetrant [@pmid:18325013]. Alleles in the range 12-17 repeats have been observed, however the individuals carrying them have not undergone clinical evaluation. Alleles in the range 4-11 and 18-29 repeats have not been reported to date.", - "detection": "short-read sequencing cannot detect pathogenic expansions. Conventional PCR has detected normal range alleles, while Southern blotting approximates expanded allele size [@genereviews:NBK1142].", - "mechanism": "LoF", - "mechanism_detail": "The repeat expansion causes significantly reduced expression of cystatin-B protein [@genereviews:NBK1142].", - "year": "1997 [@pmid:9126745]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CGCGGGGCGGGG"], - "pathogenic_motif_reference_orientation": ["CGCGGGGCGGGG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCCCGCCCCGCG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 3, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 30, - "pathogenic_max": 125, - "motif_len": 12, - "ref_copies": null, - "novel": null, - "gard": ["3876"], - "genereviews": ["NBK1142"], - "malacard": ["MYC080"], - "medgen": ["155923"], - "mondo": ["0009698"], - "omim": ["254800"], - "orphanet": ["308"], - "gnomad": ["CSTB"], - "stripy": [], - "tr_atlas": ["TR163552"], - "webstr_hg38": ["5547429"], - "webstr_hg19": ["STR_886261"], - "locus_tags": ["length_affects_onset", "length_affects_severity"], - "disease_tags": ["ataxia"], - "references": ["genereviews:NBK1142", "pmid:18325013", "pmid:9126745", "mondo:0009698"], - "additional_literature": ["pmid:42094143", "pmid:41268177", "pmid:41074692", "pmid:40442775", "pmid:40340521", "pmid:39156922", "pmid:38135787", "pmid:36398398", "pmid:36359887", "pmid:34474241", "pmid:32920378", "pmid:32875576", "pmid:29352102", "pmid:25752200", "pmid:23883076", "pmid:22581592", "pmid:21757863", "pmid:21075014", "pmid:18358403", "pmid:17003839", "pmid:16379547", "pmid:15483648", "pmid:14517952", "pmid:14510831", "pmid:12215838", "pmid:11790146", "pmid:11697734", "pmid:11571333", "pmid:11524486", "pmid:11240124", "pmid:10927802", "pmid:10721698", "pmid:10660338", "pmid:10515170", "pmid:10441345", "pmid:9529356", "pmid:9090386", "pmid:9054946", "pmid:9012407", "pmid:7885531"] -}, -{ - "id": "SCA37_DAB1", - "disease_id": "SCA37", - "gene": "DAB1", - "evidence": ["Strong"], - "chrom": "chr1", - "start_hg38": 57367043, - "stop_hg38": 57367121, - "start_hg19": 57832715, - "stop_hg19": 57832793, - "start_t2t": 57245935, - "stop_t2t": 57245973, - "disease": "Spinocerebellar ataxia type 37", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 37 (SCA37) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1), characterized by a cerebellar syndrome along with altered vertical eye movements [@mondo:0014410].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "0.20/100,000 specific to Portugal; not yet found in other geographic regions. Founder effect from Iberian Peninsula [@genereviews:NBK541729].", - "age_onset": "Typical: 33-53; Range: 18-64 [@genereviews:NBK541729].", - "age_onset_min": 18.0, - "age_onset_max": 64.0, - "typ_age_onset_min": 33.0, - "typ_age_onset_max": 53.0, - "details": "Pathogenicity only associated with pathogenic motif >30 repeats, flanked by at least 58 repeats of reference motif on either side; reference repeat (AAAAT) can range from 1 to 400 repeats, although typically less than 30 [@genereviews:NBK541729]. The pathogenic motif is unstable, particularly when transmitted by the father [@genereviews:NBK541729].", - "detection": "Short-read sequencing, exome sequencing, and RP-PCR do not accurately detect this repeat, but long-range PCR with targeted Sanger sequencing is commonly used for detection and characterization [@genereviews:NBK541729].", - "mechanism": "GoF", - "mechanism_detail": "Toxic gain-of-function mechanism in protein, associated with alternative splicing, an RNA switch, and an upregulation of reelin-DAB1 signalling [@omim:615945; @pmid:30284037].", - "year": "2017 [@pmid:28686858]", - "location_in_gene": "Intron 1 (most isoforms)", - "gene_strand": "-", - "reference_motif_reference_orientation": ["AAAAT"], - "pathogenic_motif_reference_orientation": ["GAAAT"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["AAAAA"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["TTTTT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "EDM1-PSACH_COMP", + "disease_id": "EDM1, PSACH", + "gene": "COMP", + "evidence": [ + "Definitive" + ], + "chrom": "chr19", + "start_hg38": 18786034, + "stop_hg38": 18786050, + "start_hg19": 18896844, + "stop_hg19": 18896860, + "start_t2t": 18921630, + "stop_t2t": 18921645, + "disease": "Multiple epiphyseal dysplasia, Pseudoachondroplasia", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Pseudoachondroplasia is characterized by severe growth deficiency and deformations such as bow legs and hyperlordosis.; Multiple epiphyseal dysplasia type 1 (MED 1) is a form of multiple epiphyseal dysplasia that is characterized by normal or mild short stature, pain in the hips and/or knees, progressive deformity of extremities and early-onset osteoarthrosis. Specific features to MED 1 include a more pronounced involvement of hip joints and gait abnormality and a shorter adult height. MED1 is allelic to pseudoachondroplasia with which it shares clinical and radiological features. The disease follows an autosomal dominant mode of transmission [@mondo:0008322; @mondo:0007561].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Specific contribution of COMP repeats to EDM1 is unknown (~300 COMP mutation variants for both phenotypes); likely 1:90,000 prevalence for COMP-PSACH that is repeat-specific. Found across ancestries/ethnicities [@genereviews:NBK1123; @genereviews:NBK1487].", + "age_onset": "Typical: 0-2 (COMP-PSACH)/ 1-12 (EDM1); Range: 0 (PSACH) - 13 (EDM1). 3-13 specific to trinucleotide expansions (duplications) [@pmid:29530484], several contractions but unknown exact AoO [@genereviews:NBK1123; @genereviews:NBK1487].", + "age_onset_min": 3, + "age_onset_max": 13, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Both expansions to (GTC)6-7 and contractions to (GTC)4 are associated with disease [@genereviews:NBK1487].", + "detection": null, + "mechanism": "LoF/GoF?", + "mechanism_detail": "Poly-aspartic acid expansions, domain dependent [@pmid:29530484]; may involve misfolding but still unestablished [@genereviews:NBK1123].", + "year": "1999 [@pmid:9887340]", + "location_in_gene": "Coding Exon 13", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GTC" + ], + "pathogenic_motif_reference_orientation": [ + "GTC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ACG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 5, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 6, + "pathogenic_max": 7, + "motif_len": 3, + "ref_copies": 5, + "novel": "ref", + "gard": [ + "4540", + "2180" + ], + "genereviews": [ + "NBK1123", + "NBK1487" + ], + "malacard": [ + "EPP017", + "PSD012" + ], + "medgen": [ + "98378", + "325376" + ], + "mondo": [ + "0008322", + "0007561" + ], + "omim": [ + "132400", + "177170" + ], + "orphanet": [ + "750", + "93308" + ], + "gnomad": [ + "COMP" + ], + "stripy": [ + "COMP" + ], + "tr_atlas": [ + "TR155017" + ], + "webstr_hg38": [ + "1317658" + ], + "webstr_hg19": [ + "STR_673389" + ], + "locus_tags": [ + "contraction" + ], + "disease_tags": [ + "phenotypic_spectrum" + ], + "references": [ + "pmid:29530484", + "genereviews:NBK1123", + "genereviews:NBK1487", + "pmid:9887340", + "mondo:0008322", + "mondo:0007561" + ], + "additional_literature": [ + "pmid:32097846", + "pmid:28924040", + "pmid:21644213", + "pmid:18353302", + "pmid:15014436", + "pmid:12483437" + ] + }, { - "motif": "AAAAT", - "count": 7, - "type": "internal_repeat" + "id": "EPM_CSNK1E", + "disease_id": "EPM, DEE", + "gene": "CSNK1E", + "evidence": [ + "Limited" + ], + "chrom": "chr22", + "start_hg38": 38317282, + "stop_hg38": 38317375, + "start_hg19": 38713287, + "stop_hg19": 38713380, + "start_t2t": 38781587, + "stop_t2t": 38781680, + "disease": "Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Progressive myoclonic epilepsy is a heterogeneous neurodegenerative disorder characterized by early-onset myoclonus, epilepsy, generalized tonic-clonic seizures, and progressive neurological deterioration [@pmid:40751262]. It has also been proposed that this locus is also associated with developmental and epileptic encephalopathies [@pmid:39107278]. We hypothesize that the two diseases may make up an expressivity or phenotypic spectrum and/or that hypermethylation causes changes in onset and severity.", + "hpo_terms": [ + "HP:0001336 Myoclonous", + "HP:0001251 Ataxia", + "HP:0002080 Intention Tremor", + "HP:0007000 Morning Myoclonic Jerks", + "HP:0001260 Dysarthia", + "HP:0001249 Intellectual Disability", + "HP:0002392 EEG with Polyspike Wave Complexes", + "HP:0002070 Limb Ataxia", + "HP:0000726 Dementia", + "HP:0000992 Cutaneous Photosensitivity" + ], + "prevalence": null, + "prevalence_details": "EPM found in one Azerbaijani proband [@pmid:40751262] and DEE found in two additional patients [@pmid:39107278]. This expansion has been reported in unaffected individuals [@pmid:40751262].", + "age_onset": "EPM case reports age of onset 10 years [@pmid:40751262] and DEE cases onset in infancy", + "age_onset_min": 0, + "age_onset_max": 10, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "CGG repeat in exon 1 of CSNK1E. Longest reported expanded allele of an affected individual is 745, with an unaffected sibling with repeat length 980. Father had a repeat of 8 and mother of 131.", + "detection": "Exome sequencing does not reliably detect expansions at this locus. Reported cases were identified through methylation outlier detection and confirmed by targeted long-read sequencing [@pmid:40751262].", + "mechanism": "Unknown", + "mechanism_detail": "Mechanism of this disease is largely unknown, but hypermethylation is observed. Expanded alleles exhibit hypermethylation and may mediate epigenetic silencing. Unaffected carriers have been observed, indicating variable expressivity or penetrance.", + "year": "2025", + "location_in_gene": "Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CCG" + ], + "pathogenic_motif_reference_orientation": [ + "CCG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "CCG", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 0, + "benign_max": 48, + "intermediate_min": 49, + "intermediate_max": 131, + "pathogenic_min": 366, + "pathogenic_max": 980, + "motif_len": 3, + "ref_copies": null, + "novel": null, + "gard": [ + "7140" + ], + "genereviews": [], + "malacard": [ + "MYC080" + ], + "medgen": [ + "199732" + ], + "mondo": [ + "0020074" + ], + "omim": [ + "600863" + ], + "orphanet": [], + "gnomad": [ + "CSNK1E" + ], + "stripy": [], + "tr_atlas": [ + "TR344468" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [ + "epilepsy" + ], + "references": [ + "pmid:40751262", + "pmid:39107278", + "pmid: 39107278" + ], + "additional_literature": [] }, { - "motif": "GAAAT", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 0, - "benign_max": 30, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 31, - "pathogenic_max": 75, - "motif_len": 5, - "ref_copies": 0.0, - "novel": "novel", - "gard": ["12368"], - "genereviews": ["NBK541729"], - "malacard": ["SPN283"], - "medgen": ["855217"], - "mondo": ["0014410"], - "omim": ["615945"], - "orphanet": ["363710"], - "gnomad": ["DAB1"], - "stripy": ["DAB1"], - "tr_atlas": ["TR3445"], - "webstr_hg38": ["1144531"], - "webstr_hg19": ["STR_39393"], - "locus_tags": ["maternal_expansion", "paternal_expansion", "motif_affects_onset", "motif_affects_penetrance"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK541729", "omim:615945", "pmid:30284037", "pmid:28686858", "mondo:0014410"], - "additional_literature": ["pmid:41871099", "pmid:41426430", "pmid:38961870", "pmid:36622139", "pmid:36148898", "pmid:36092952", "pmid:32582864", "pmid:30588707"] -}, -{ - "id": "FRA12A_DIP2B", - "disease_id": "FRA12A", - "gene": "DIP2B", - "evidence": ["Disputed"], - "chrom": "chr12", - "start_hg38": 50505001, - "stop_hg38": 50505024, - "start_hg19": 50898784, - "stop_hg19": 50898807, - "start_t2t": 50468095, - "stop_t2t": 50468118, - "disease": "Intellectual developmental disorder, FRA12A type", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. Impaired intellectual development with or without other anomalies has been described in patients with over 40% of cells expressing FRA12A [@omim:136630]. The DIP2B CGG repeat expansion causes this folate-sensitive site and is associated with a broad phenotypic range, including intellectual disability, ataxia/movement disorder, and epilepsy [@pmid:39854091; @pmid:17236128; @pmid:34622207]; cardiovascular associations have also been reported [@pmid:38418263].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Appears to occur in those of European ancestry/ethnicity [@omim:136630].", - "age_onset": "Typical: 0-1 (small sample size) [@pmid:3742859]. Range: 0-3 [@pmid:4042396].", - "age_onset_min": 0.0, - "age_onset_max": 3.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Repeat ranges reflect affected and unaffected individuals from a cohort study of 70 controls (6-23 repeats), unaffected carriers representing the intermediate alleles (139-206), and affected individuals (273-306) [@pmid:17236128]. It has been hypothesized that unmethylated expansions may correspond to movement-related phenotypes (chorea, dystonia, and ataxia) [@pmid:39854091].", - "detection": "Short-read sequencing can underestimate expansion size. RP-PCR and Southern blotting detect expansions [@pmid:17236128], while long-read sequencing has been reported to accurately size them [@pmid:39854091].", - "mechanism": "LoF", - "mechanism_detail": "Hypermethylation leading to decreased expression, although unmethylated expansion leads to increased expression [@omim:136630; @pmid:37248219].", - "year": "2007 [@pmid:17236128]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGC"], - "pathogenic_motif_reference_orientation": ["GGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 23, - "intermediate_min": 139, - "intermediate_max": 206, - "pathogenic_min": 273, - "pathogenic_max": 306, - "motif_len": 3, - "ref_copies": 7.0, - "novel": "ref", - "gard": [], - "genereviews": ["NBK535148"], - "malacard": ["INT482"], - "medgen": ["369613"], - "mondo": ["0007634"], - "omim": ["136630"], - "orphanet": [], - "gnomad": ["DIP2B"], - "stripy": ["DIP2B"], - "tr_atlas": ["TR116656"], - "webstr_hg38": ["5075695"], - "webstr_hg19": ["Expansion_FRA12A_MR/DIP2B"], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:3742859", "pmid:4042396", "omim:136630", "pmid:37248219", "pmid:17236128", "pmid:39854091", "pmid:34622207", "pmid:38418263"], - "additional_literature": ["pmid:42205056", "pmid:37090938"] -}, -{ - "id": "DMD_DMD", - "disease_id": "DMD", - "gene": "DMD", - "evidence": ["Refuted"], - "chrom": "chrX", - "start_hg38": 31284557, - "stop_hg38": 31284605, - "start_hg19": 31302674, - "stop_hg19": 31302722, - "start_t2t": 30882677, - "stop_t2t": 30882743, - "disease": "Duchenne muscular dystrophy", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "Duchenne muscular dystrophy (DMD) is a neuromuscular disease characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle [@mondo:0010679].", - "hpo_terms": null, - "prevalence": "4.8/100000", - "prevalence_details": "Believed to be 0 for disease specific to STR expansion. 1/3500-4700 male births (incidence) for overall DMD (one of the most common and severe congenital myopathies) [@genereviews:NBK1119]. 4.8/100,000 prevalence [@pmid:35168641]. DMD repeat locus expansion only identified in one Greek family [@pmid:27417533].", - "age_onset": "Typical: 6-7 (usual disease is 0-3) [@pmid:27417533].", - "age_onset_min": 6.0, - "age_onset_max": 7.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "There is conflicting evidence for the association between this repeat expansion and Duchenne muscular dystrophy. The association was reported in a single family, from which the benign and pathogenic ranges were inferred from affected and unaffected family members [@pmid:27417533]. The population frequency of the proposed pathogenic allele is much higher than expected for a highly penetrant early-onset condition.", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Functional defect in dystrophin/dystroglycan [@pmid:16969582].", - "year": "2016 [@pmid:27417533]", - "location_in_gene": "Intron 62", - "gene_strand": "-", - "reference_motif_reference_orientation": ["TTC"], - "pathogenic_motif_reference_orientation": ["TTC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AAG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "EPM1_CSTB", + "disease_id": "EPM1", + "gene": "CSTB", + "evidence": [ + "Definitive" + ], + "chrom": "chr21", + "start_hg38": 43776442, + "stop_hg38": 43776479, + "start_hg19": 45196323, + "stop_hg19": 45196360, + "start_t2t": 42132054, + "stop_t2t": 42132091, + "disease": "Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD)", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Unverricht-Lundborg disease (ULD) is a rare progressive myoclonic epilepsy disorder characterized by action- and stimulus-sensitive myoclonus, and tonic-clonic seizures with ataxia, but with only a mild cognitive decline over time [@mondo:0009698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Worldwide prevalence unknown; Finland prevalence 2-4/100,000. Found across ethnicities/ancestries, with population-dependent prevalence; highest in Tunisia, Algeria, Morocco, and Finland [@genereviews:NBK1142].", + "age_onset": "Typical: 6-15 [@genereviews:NBK1142]; Range: 6-18 [@pmid:18325013].", + "age_onset_min": 6, + "age_onset_max": 18, + "typ_age_onset_min": 6, + "typ_age_onset_max": 15, + "details": "Affected individuals have an unstable 12-nucleotide (dodecomer) repeat expansion. Alleles containing 2-3 motifs are considered benign, while alleles with 30-125 repeats are fully penetrant [@pmid:18325013]. Alleles in the range 12-17 repeats have been observed, however the individuals carrying them have not undergone clinical evaluation. Alleles in the range 4-11 and 18-29 repeats have not been reported to date.", + "detection": "short-read sequencing cannot detect pathogenic expansions. Conventional PCR has detected normal range alleles, while Southern blotting approximates expanded allele size [@genereviews:NBK1142].", + "mechanism": "LoF", + "mechanism_detail": "The repeat expansion causes significantly reduced expression of cystatin-B protein [@genereviews:NBK1142].", + "year": "1997 [@pmid:9126745]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CGCGGGGCGGGG" + ], + "pathogenic_motif_reference_orientation": [ + "CGCGGGGCGGGG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCCCGCCCCGCG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 3, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 30, + "pathogenic_max": 125, + "motif_len": 12, + "ref_copies": null, + "novel": null, + "gard": [ + "3876" + ], + "genereviews": [ + "NBK1142" + ], + "malacard": [ + "MYC080" + ], + "medgen": [ + "155923" + ], + "mondo": [ + "0009698" + ], + "omim": [ + "254800" + ], + "orphanet": [ + "308" + ], + "gnomad": [ + "CSTB" + ], + "stripy": [], + "tr_atlas": [ + "TR163552" + ], + "webstr_hg38": [ + "5547429" + ], + "webstr_hg19": [ + "STR_886261" + ], + "locus_tags": [ + "length_affects_onset", + "length_affects_severity" + ], + "disease_tags": [ + "ataxia" + ], + "references": [ + "genereviews:NBK1142", + "pmid:18325013", + "pmid:9126745", + "mondo:0009698" + ], + "additional_literature": [ + "pmid:42094143", + "pmid:41268177", + "pmid:41074692", + "pmid:40442775", + "pmid:40340521", + "pmid:39156922", + "pmid:38135787", + "pmid:36398398", + "pmid:36359887", + "pmid:34474241", + "pmid:32920378", + "pmid:32875576", + "pmid:29352102", + "pmid:25752200", + "pmid:23883076", + "pmid:22581592", + "pmid:21757863", + "pmid:21075014", + "pmid:18358403", + "pmid:17003839", + "pmid:16379547", + "pmid:15483648", + "pmid:14517952", + "pmid:14510831", + "pmid:12215838", + "pmid:11790146", + "pmid:11697734", + "pmid:11571333", + "pmid:11524486", + "pmid:11240124", + "pmid:10927802", + "pmid:10721698", + "pmid:10660338", + "pmid:10515170", + "pmid:10441345", + "pmid:9529356", + "pmid:9090386", + "pmid:9054946", + "pmid:9012407", + "pmid:7885531" + ] + }, { - "motif": "TTC", - "count": null, - "type": "pathogenic_repeat" + "id": "SCA37_DAB1", + "disease_id": "SCA37", + "gene": "DAB1", + "evidence": [ + "Strong" + ], + "chrom": "chr1", + "start_hg38": 57367043, + "stop_hg38": 57367121, + "start_hg19": 57832715, + "stop_hg19": 57832793, + "start_t2t": 57245935, + "stop_t2t": 57245973, + "disease": "Spinocerebellar ataxia type 37", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 37 (SCA37) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1), characterized by a cerebellar syndrome along with altered vertical eye movements [@mondo:0014410].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "0.20/100,000 specific to Portugal; not yet found in other geographic regions. Founder effect from Iberian Peninsula [@genereviews:NBK541729].", + "age_onset": "Typical: 33-53; Range: 18-64 [@genereviews:NBK541729].", + "age_onset_min": 18, + "age_onset_max": 64, + "typ_age_onset_min": 33, + "typ_age_onset_max": 53, + "details": "Pathogenicity only associated with pathogenic motif >30 repeats, flanked by at least 58 repeats of reference motif on either side; reference repeat (AAAAT) can range from 1 to 400 repeats, although typically less than 30 [@genereviews:NBK541729]. The pathogenic motif is unstable, particularly when transmitted by the father [@genereviews:NBK541729].", + "detection": "Short-read sequencing, exome sequencing, and RP-PCR do not accurately detect this repeat, but long-range PCR with targeted Sanger sequencing is commonly used for detection and characterization [@genereviews:NBK541729].", + "mechanism": "GoF", + "mechanism_detail": "Toxic gain-of-function mechanism in protein, associated with alternative splicing, an RNA switch, and an upregulation of reelin-DAB1 signalling [@omim:615945; @pmid:30284037].", + "year": "2017 [@pmid:28686858]", + "location_in_gene": "Intron 1 (most isoforms)", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "AAAAT" + ], + "pathogenic_motif_reference_orientation": [ + "GAAAT" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "AAAAA" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "TTTTT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "AAAAT", + "count": 7, + "type": "internal_repeat" + }, + { + "motif": "GAAAT", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 0, + "benign_max": 30, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 31, + "pathogenic_max": 75, + "motif_len": 5, + "ref_copies": 0, + "novel": "novel", + "gard": [ + "12368" + ], + "genereviews": [ + "NBK541729" + ], + "malacard": [ + "SPN283" + ], + "medgen": [ + "855217" + ], + "mondo": [ + "0014410" + ], + "omim": [ + "615945" + ], + "orphanet": [ + "363710" + ], + "gnomad": [ + "DAB1" + ], + "stripy": [ + "DAB1" + ], + "tr_atlas": [ + "TR3445" + ], + "webstr_hg38": [ + "1144531" + ], + "webstr_hg19": [ + "STR_39393" + ], + "locus_tags": [ + "maternal_expansion", + "paternal_expansion", + "motif_affects_onset", + "motif_affects_penetrance" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK541729", + "omim:615945", + "pmid:30284037", + "pmid:28686858", + "mondo:0014410" + ], + "additional_literature": [ + "pmid:41871099", + "pmid:41426430", + "pmid:38961870", + "pmid:36622139", + "pmid:36148898", + "pmid:36092952", + "pmid:32582864", + "pmid:30588707" + ] }, { - "motif": "T", - "count": 8, - "type": "flank_repeat" - }], - "benign_min": 16, - "benign_max": 33, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 59, - "pathogenic_max": 82, - "motif_len": 3, - "ref_copies": 16.7, - "novel": "ref", - "gard": ["6291"], - "genereviews": ["NBK535148"], - "malacard": ["MSC157"], - "medgen": ["3925"], - "mondo": ["0010679"], - "omim": ["310200"], - "orphanet": ["98896"], - "gnomad": ["DMD"], - "stripy": ["DMD"], - "tr_atlas": ["TR167703"], - "webstr_hg38": [], - "webstr_hg19": ["STR_1545664"], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:27417533", "pmid:16969582", "genereviews:NBK1119", "pmid:35168641", "mondo:0010679"], - "additional_literature": ["pmid:41906116", "pmid:41691287", "pmid:41244984", "pmid:41173008", "pmid:39874107", "pmid:39803454", "pmid:39713478", "pmid:39251998", "pmid:38290145", "pmid:37829280", "pmid:37270548", "pmid:37090938", "pmid:36975100", "pmid:36048237", "pmid:35615378", "pmid:35093299", "pmid:34371182", "pmid:34238289", "pmid:33349121", "pmid:30914715", "pmid:30349485", "pmid:29687370", "pmid:27924830", "pmid:27178005", "pmid:27529242", "pmid:27276190", "pmid:24411039", "pmid:25804023", "pmid:24191945", "pmid:23894429", "pmid:23695957", "pmid:23659897", "pmid:23574351", "pmid:23538453", "pmid:21901138", "pmid:21305566", "pmid:22830166", "pmid:19927354", "pmid:19907931", "pmid:19309270", "pmid:19158820", "pmid:19108751", "pmid:18393226", "pmid:18359022", "pmid:17439955", "pmid:16553208", "pmid:16415967", "pmid:12132577", "pmid:11807410", "pmid:11593558", "pmid:11280167", "pmid:11185740", "pmid:10445321", "pmid:9894797", "pmid:8588583", "pmid:7633442", "pmid:7705851"] -}, -{ - "id": "DM1_DMPK", - "disease_id": "DM1", - "gene": "DMPK", - "evidence": ["Definitive"], - "chrom": "chr19", - "start_hg38": 45770204, - "stop_hg38": 45770266, - "start_hg19": 46273462, - "stop_hg19": 46273524, - "start_t2t": 48597739, - "stop_t2t": 48597756, - "disease": "Myotonic dystrophy type 1", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Steinert disease, also known as myotonic dystrophy type 1, is a muscle disease characterized by myotonia and by multiorgan damage that combines various degrees of muscle weakness, arrhythmia and/or cardiac conduction disorders, cataract, endocrine damage, sleep disorders and baldness [@mondo:0008056]. It has also been linked to Autism and related traits, especially in individuals with earlier onset [@pmid:40259070; @pmid:29361396; @pmid:8810716; @pmid:27695335; @pmid:29871899; @pmid:37209486].", - "hpo_terms": null, - "prevalence": "9.27/100000", - "prevalence_details": "5-20/100,000 [@genereviews:NBK1165]. 0.5-18.1/100,000 [@pmid:29100084]; 6.5/100,000 [@pmid:31159885]. 9.27 cases (95% CI: 4.73-15.21) per 100,000, ranging from 0.37 to 36.29 cases per 100,000 [@pmid:35483324]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1165].", - "age_onset": "Typical: 10-30 [@genereviews:NBK1165]; Range: 0-74 [@pmid:38454488].", - "age_onset_min": 0.0, - "age_onset_max": 74.0, - "typ_age_onset_min": 10.0, - "typ_age_onset_max": 30.0, - "details": "Intermediate alleles (35-49) associated with premutation [@genereviews:NBK1165]. 3%-8% of DM1 expansions contain interrupting variant repeats such as CCG and CGG, associated with later onset and milder phenotype; the variant repeat GCGGCA has also been reported [@pmid:32851192; @pmid:39710066]. In another study, interruptions of the CTG repeat with CCG, GGC, CTC or CAG motifs are estimated to occur in 3-11% of DM1 patients [@pmid:35741732]. Expansions within gene ZNF850 may function as DM1 modifiers [@pmid:39679849].", - "detection": "Flanking PCR has detected alleles up to ~150 repeats, while RP-PCR may detect missed expanded alleles [@genereviews:NBK1165; @pmid:24795756]. Southern blotting has approximated the size of large expansions [@pmid:22643181], while long-read sequencing has resolved repeat size and structure [@pmid:41974889].", - "mechanism": "GoF", - "mechanism_detail": "RNA gain-of-function: RNA gelation leading to misregulation of alternative splicing [@pmid:36169768]. Expanded DMPK r(CUG)n RNA forms a hairpin containing periodic 1*1 U/U internal loops that engage/sequester MBNL family RNA-binding proteins, especially MBNL1 [@pmid:42182465], disrupting pre mRNA processing and contributing to cardiac phenotypes [@pmid:39932794]. Loss of MBNL proteins has been linked to mis-splicing of Autism spectrum-risk genes such as SCN2A, ANK2, and SHANK2, possibly leading to Autism-related traits [@pmid:40259070]. Evidence suggests that disulfide bond-dependent MBNL1/MBNL2 dimerization maintains toxic RNA foci [@pmid:41929128].", - "year": "1992 [@pmid:1310900]", - "location_in_gene": "3' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CTG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 34, - "intermediate_min": 35, - "intermediate_max": 49, - "pathogenic_min": 50, - "pathogenic_max": 4000, - "motif_len": 3, - "ref_copies": 20.7, - "novel": "ref", - "gard": ["8310"], - "genereviews": ["NBK1165"], - "malacard": ["MYT021"], - "medgen": ["886881"], - "mondo": ["0008056"], - "omim": ["160900"], - "orphanet": ["273"], - "gnomad": ["DMPK"], - "stripy": ["DMPK"], - "tr_atlas": ["TR156684"], - "webstr_hg38": ["5650727"], - "webstr_hg19": ["Expansion_DM1/DMPK"], - "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "length_affects_onset", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability", "motif_affects_onset", "motif_affects_phenotype", "motif_affects_severity"], - "disease_tags": ["myotonic_dystrophy"], - "references": ["genereviews:NBK1165", "pmid:38454488", "pmid:36169768", "pmid:39932794", "pmid:40259070", "pmid:41929128", "pmid:39643839", "pmid:32851192", "doi:10.1016/j.mcp.2024.102005", "pmid:35741732", "doi:10.1093/hmg/ddae186", "pmid:29100084", "pmid:31159885", "pmid:35483324", "pmid:1310900", "mondo:0008056", "pmid:29361396", "pmid:8810716", "pmid:27695335", "pmid:29871899", "pmid:37209486"], - "additional_literature": ["pmid:41996006", "pmid:41974889", "pmid:41951733", "pmid:41946260", "pmid:41855125", "pmid:41848171", "pmid:41766784", "pmid:41762523", "pmid:41722569", "pmid:41710065", "pmid:41707138", "pmid:41672630", "pmid:41610137", "pmid:41533635", "pmid:41379996", "pmid:41260620", "pmid:41250834", "pmid:41226829", "pmid:41212113", "pmid:41161721", "pmid:41074692", "pmid:40903903", "pmid:40896579", "pmid:40879030", "pmid:40712995", "pmid:40606545", "pmid:40599975", "pmid:40417743", "pmid:40296143", "pmid:40113266", "pmid:40092662", "pmid:40004498", "pmid:39710066", "pmid:39679849", "pmid:39492694", "pmid:39433769", "pmid:39415708", "pmid:39391712", "pmid:39383229", "pmid:39278936", "pmid:39267217", "pmid:39273681", "pmid:39232665", "pmid:39180495", "pmid:39126705", "pmid:38709060", "pmid:38704930", "pmid:38490135", "pmid:38314057", "pmid:37829280", "pmid:37744174", "pmid:37645891", "pmid:37638448", "pmid:37521782", "pmid:37397246", "pmid:37373276", "pmid:37352653", "pmid:37200862", "pmid:37146135", "pmid:37143315", "pmid:36892629", "pmid:36778282", "pmid:36701310", "pmid:36627397", "pmid:36352383", "pmid:36230978", "pmid:36222125", "pmid:36099027", "pmid:36084803", "pmid:36011377", "pmid:35770133", "pmid:35767654", "pmid:35567413", "pmid:35328504", "pmid:35243403", "pmid:35182509", "pmid:34976437", "pmid:34915310", "pmid:34513303", "pmid:34472530", "pmid:34432028", "pmid:34386887", "pmid:34372915", "pmid:34371182", "pmid:34262431", "pmid:34114350", "pmid:34025359", "pmid:33682722", "pmid:33624941", "pmid:33575482", "pmid:33526774", "pmid:33497365", "pmid:33363709", "pmid:33362853", "pmid:33235377", "pmid:32929188", "pmid:32823742", "pmid:32717741", "pmid:32656337", "pmid:32607474", "pmid:32350131", "pmid:32203199", "pmid:32109384", "pmid:32063450", "pmid:31996899", "pmid:31873063", "pmid:31759551", "pmid:31649961", "pmid:31624084", "pmid:31570586", "pmid:31395669", "pmid:31334355", "pmid:31316546", "pmid:31253581", "pmid:31227653", "pmid:31220271", "pmid:31164682", "pmid:31027145", "pmid:30891637", "pmid:30700578", "pmid:30615214", "pmid:30546383", "pmid:30425655", "pmid:30304901", "pmid:30216892", "pmid:30140252", "pmid:29967337", "pmid:29947794", "pmid:29592894", "pmid:29551391", "pmid:29381654", "pmid:29334465", "pmid:29274549", "pmid:29246312", "pmid:29114849", "pmid:28942489", "pmid:28886202", "pmid:28810563", "pmid:28782311", "pmid:28623239", "pmid:28435090", "pmid:28363916", "pmid:28211918", "pmid:28129118", "pmid:28102759", "pmid:27854230", "pmid:27727437", "pmid:27358583", "pmid:27245480", "pmid:27222292", "pmid:26708183", "pmid:26640575", "pmid:26586700", "pmid:26498872", "pmid:26190529", "pmid:25958258", "pmid:25712547", "pmid:25655594", "pmid:25606394", "pmid:25307018", "pmid:25303993", "pmid:25168381", "pmid:24824895", "pmid:24795756", "pmid:24781112", "pmid:24715907", "pmid:24705798", "pmid:24455202", "pmid:24269018", "pmid:24196578", "pmid:24092878", "pmid:23811192", "pmid:23570879", "pmid:23308382", "pmid:26317000", "pmid:23263591", "pmid:23209425", "pmid:23183533", "pmid:23161457", "pmid:23159592", "pmid:23139243", "pmid:22643181", "pmid:22595968", "pmid:22459146", "pmid:22427994", "pmid:22078098", "pmid:22062891", "pmid:21971425", "pmid:21949239", "pmid:21511730", "pmid:21303839", "pmid:21245981", "pmid:21204798", "pmid:21103235", "pmid:20801043", "pmid:20635151", "pmid:20603324", "pmid:20346670", "pmid:20228473", "pmid:20179953", "pmid:20171614", "pmid:20074967", "pmid:19946639", "pmid:19715468", "pmid:19632331", "pmid:19516957", "pmid:19470458", "pmid:18798829", "pmid:18729234", "pmid:18611984", "pmid:18563724", "pmid:18561181", "pmid:18559347", "pmid:18299519", "pmid:18228241", "pmid:18213375", "pmid:17987120", "pmid:17950578", "pmid:17877752", "pmid:17728322", "pmid:17487865", "pmid:17158949", "pmid:17150182", "pmid:17145685", "pmid:17114933", "pmid:16978612", "pmid:16927100", "pmid:16716318", "pmid:16624843", "pmid:16401743", "pmid:16376058", "pmid:16193250", "pmid:16027111", "pmid:15972723", "pmid:15961406", "pmid:15750273", "pmid:15684391", "pmid:15576360", "pmid:15489504", "pmid:15462191", "pmid:15459182", "pmid:15336691", "pmid:15215218", "pmid:15114529", "pmid:15019706", "pmid:14734627", "pmid:14597103", "pmid:12970845", "pmid:12630069", "pmid:12614928", "pmid:12427866", "pmid:11978764", "pmid:11809728", "pmid:11793472", "pmid:11726559", "pmid:11686919", "pmid:11592825", "pmid:11590133", "pmid:11555624", "pmid:11526199", "pmid:11260612", "pmid:11124939", "pmid:11013451", "pmid:11001736", "pmid:10970838", "pmid:10958655", "pmid:10951446", "pmid:10909850", "pmid:10802668", "pmid:10802667", "pmid:10767343", "pmid:10699184", "pmid:10668800", "pmid:10480373", "pmid:10454725", "pmid:10435210", "pmid:10332037", "pmid:10332033", "pmid:9950368", "pmid:9887331", "pmid:9858828", "pmid:9668171", "pmid:9537423", "pmid:9402536", "pmid:9401353", "pmid:9371827", "pmid:9294109", "pmid:9241283", "pmid:9241282", "pmid:9207101", "pmid:8948631", "pmid:8923304", "pmid:8673131", "pmid:8659513", "pmid:8784809", "pmid:8595416", "pmid:7626046", "pmid:7590731", "pmid:7726160", "pmid:7896884", "pmid:8288237"] -}, -{ - "id": "RCPS_EIF4A3", - "disease_id": "RCPS", - "gene": "EIF4A3", - "evidence": ["Definitive"], - "chrom": "chr17", - "start_hg38": 80147009, - "stop_hg38": 80147139, - "start_hg19": 78120808, - "stop_hg19": 78120938, - "start_t2t": 81047404, - "stop_t2t": 81047534, - "disease": "Richieri-Costa-Pereira syndrome", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Richieri Costa-Pereira syndrome is characterized by short stature, Robin sequence, cleft mandible, pre/postaxial hand anomalies (including hypoplastic thumbs), and clubfoot. It has been described in 14 Brazilian families and in one unrelated French patient. Prominent low set ears and a highly arched palate were also observed. Transmission is autosomal recessive [@mondo:0009998].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "49 cases as of Nov 2023 [@doi:10.1016/j.omsc.2023.100340]. Found in Brazilian families and one unrelated French patient [@mondo:0009998].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": 0.0, - "typ_age_onset_max": 0.0, - "details": "Complex repeat of 18-20 nucleotides expands to cause disease: disease is found in individuals with 14-16 repeats [@pmid:24360810], while controls have typically 3-12 repeats with as low as 1 repeat [@genereviews:NBK535148; @gnomad:EIF4A3]. Significance of intermediate alleles is unknown [@pmid:29112243].", - "detection": "Short-read sequencing and exome sequencing do not reliably detect this expansion. Targeted 5′ UTR PCR with Sanger sequencing is the common detection methodology [@pmid:29112243; @pmid:24360810].", - "mechanism": "LoF", - "mechanism_detail": "LoF from a hypomorphic allele [@pmid:24360810].", - "year": "2014 [@pmid:24360810]; syndrome described in 1992 [@pmid:1632438]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CCTCGCTGTGCCGCTGCCGA"], - "pathogenic_motif_reference_orientation": ["CCTCGCTGTGCCGCTGCCGA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ACAGCGAGGTCGGCAGCGGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 1, - "benign_max": 12, - "intermediate_min": 13, - "intermediate_max": 13, - "pathogenic_min": 14, - "pathogenic_max": 16, - "motif_len": 20, - "ref_copies": null, - "novel": "ref", - "gard": ["4718"], - "genereviews": ["NBK535148"], - "malacard": ["RBN014"], - "medgen": ["336581"], - "mondo": ["0009998"], - "omim": ["268305"], - "orphanet": ["3102"], - "gnomad": ["EIF4A3"], - "stripy": [], - "tr_atlas": ["TR148462"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:24360810", "genereviews:NBK535148", "gnomad:EIF4A3", "pmid:29112243", "doi:10.1016/j.omsc.2023.100340", "mondo:0009998", "pmid:1632438"], - "additional_literature": [] -}, -{ - "id": "OPDM_FAM193B", - "disease_id": "OPDM", - "gene": "FAM193B", - "evidence": ["Provisional"], - "chrom": "chr5", - "start_hg38": 177554489, - "stop_hg38": 177554531, - "start_hg19": 176981490, - "stop_hg19": 176981532, - "start_t2t": 178096748, - "stop_t2t": 178096792, - "disease": "Oculopharyngodistal myopathy", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "This is a newly proposed locus for OPDM, it does not have a type number yet and has not been validated. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in two siblings in a UDN family [@pmid:38297326; @pmid:40357124].", - "age_onset": "49-51 based on two siblings [@pmid:39868092].", - "age_onset_min": 49.0, - "age_onset_max": 51.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (<50) inferred from cohort data, but exact upper bound was not reported. Two affected patients had repeat lengths of 194 and 198, with an unaffected parent with a repeat length of 158 [@pmid:39868092]. The unaffected parent makes the inheritance pattern uncertain, but it appears to be autosomal dominant.", - "detection": null, - "mechanism": null, - "mechanism_detail": "Accumulation of toxic RAN proteins is a proposed mechanism [@pmid:38585781]", - "year": "2026 [@pmid:39868092]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 0, - "benign_max": 50, - "intermediate_min": 158, - "intermediate_max": 158, - "pathogenic_min": 194, - "pathogenic_max": 198, - "motif_len": 3, - "ref_copies": null, - "novel": "ref", - "gard": ["12592"], - "genereviews": [], - "malacard": [], - "medgen": ["320250"], - "mondo": [], - "omim": ["615813"], - "orphanet": ["98897"], - "gnomad": ["FAM193B"], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": ["oculopharyngodistal_myopathy"], - "references": ["pmid:39868092", "pmid:38585781", "pmid:38297326", "pmid:40357124", "mondo:0025193"], - "additional_literature": [] -}, -{ - "id": "SCA27B_FGF14", - "disease_id": "SCA27B", - "gene": "FGF14", - "evidence": ["Definitive"], - "chrom": "chr13", - "start_hg38": 102161574, - "stop_hg38": 102161726, - "start_hg19": 102813924, - "stop_hg19": 102814076, - "start_t2t": 101377549, - "stop_t2t": 101377792, - "disease": "Spinocerebellar ataxia 27B", - "inheritance": ["AD"], - "association_type": ["Mendelian", "Risk"], - "disease_description": "Late-onset ataxia, may have episodic onset, downbeat nystagmus, vertigo, dysarthria, visual disturbances, and neuropathy [@pmid:39349043; @pmid:42044943]. Involvement of the superior cerebellar peduncles is frequent and may aid in diagnostic efforts [@pmid:39996128].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Intermediate expansions 1-2% of population, but non-GAA-pure without relation to ataxia [@genereviews:NBK599589]. Found in multiple ethnicities [@pmid:38876750]; diagnosed patients in America, Brazil, Japan, Germany, Spain, Canada, France, Austria, Australia, Italy, and Poland [@genereviews:NBK599589; @pmid:38886208; @pmid:37267898; @pmid:42096001]. Prevalence is population dependent, ranging from 1.83% to 61% of different ataxia cohorts, with specific enrichment in French-Canadian populations [@pmid:36516086; @pmid:42090775].", - "age_onset": "Typical: 42-70; Range: 21-87 [@genereviews:NBK599589; @pmid:39263992].", - "age_onset_min": 21.0, - "age_onset_max": 87.0, - "typ_age_onset_min": 42.0, - "typ_age_onset_max": 70.0, - "details": "Higher repeat size is associated with earlier age of onset [@pmid:39263992]. The 250-300 repeats range is linked to incomplete penetrance and >300 repeats with complete penetrance in some studies and resources [@genereviews:NBK599589; @pmid:37399286; @pmid:39227614]. However, our thresholds are taken from suggestions made by Mohren et al upon evaluation of 169 cases and 802 controls; the authors propose lower thresholds based on pathogenic cases of shorter pure repeats [@pmid:39227614]. Additionally, this study suggests that benign motifs may disrupt the formation of secondary structures in DNA/RNA, leading to reduced pathogenicity. The effects of interruptions on penetrance and onset have been demonstrated in patients, with uninterrupted expansions apparently necessary for disease [@pmid:40007153]. Interruptions of GAG, GAAGGA, GAAGAAAGAA, GAAAAGAAGAAGGAAGAAGGAA, GAAAAGAAGAAGGAA, and GCAGAAGAAGAAGAA have been reported [@pmid:40379261]. Variation in flanking regions appears to correlate with repeat size [@pmid:39227614; @pmid:38937606]. Intermediate alleles may increase ataxia susceptibility in combination with other factors or be associated with a phenotypic spectrum (multiple system atrophy) [@pmid:39227614; @pmid:39604554]. A complex (TTC/TGC) ≥300 repeat expansion has been associated as a risk factor for Parkinson's disease [@pmid:41327893; @pmid:41277530]. Expansions can sometimes present as apparently sporadic adult-onset ataxia despite autosomal dominant inheritance [@pmid:42204984].", - "detection": "Short-read genome and exome sequencing are reported to be inaccurate in detecting these expansions [@genereviews:NBK599589]. Long-range PCR and bidirectional RP-PCR have been used for detection, while long-read sequencing has determined repeat structure and purity [@genereviews:NBK599589; @pmid:36516086].", - "mechanism": "LoF", - "mechanism_detail": "Reduced transcript 2 [@pmid:36516086].", - "year": "2023 [@pmid:36493768]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GAA"], - "pathogenic_motif_reference_orientation": ["GAA"], - "benign_motif_reference_orientation": ["GGA", "GCA"], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["GAG", "GAAGGA", "GAAGAAAGAA", "GAAAAGAAGAAGGAAGAAGGAA", "GAAAAGAAGAAGGAA", "GCAGAAGAAGAAGAA"], - "pathogenic_motif_gene_orientation": ["CTT"], - "benign_motif_gene_orientation": ["CCT", "CTG"], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["CCT", "CCTTCT", "CTTCTTCTTT", "CCTTCTTCCTTCTTCTTTTCTT", "CCTTCTTCTTTTCTT", "CTGCTTCTTCTTCTT"], - "locus_structure": [], - "benign_min": 8, - "benign_max": 179, - "intermediate_min": 180, - "intermediate_max": 319, - "pathogenic_min": 320, - "pathogenic_max": 937, - "motif_len": 3, - "ref_copies": 50.3, - "novel": "ref", - "gard": [], - "genereviews": ["NBK599589"], - "malacard": ["SPN469"], - "medgen": ["1824051"], - "mondo": ["0859340"], - "omim": ["620174"], - "orphanet": ["675216"], - "gnomad": ["FGF14"], - "stripy": ["FGF14"], - "tr_atlas": [], - "webstr_hg38": ["1272528"], - "webstr_hg19": [], - "locus_tags": ["maternal_expansion", "length_affects_onset", "length_affects_penetrance", "motif_affects_penetrance", "length_affects_phenotype"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["genereviews:NBK599589", "pmid:39263992", "pmid:36516086", "pmid:37399286", "pmid:39227614", "pmid:40007153", "pmid:40379261", "pmid:38937606", "pmid:39604554", "pmid:41327893", "pmid:41277530", "pmid:38876750", "pmid:38886208", "pmid:37267898", "pmid:36493768", "pmid:39349043", "pmid:42044943", "doi:10.1212/NXG.0000000000200253"], - "additional_literature": ["pmid:42055934", "pmid:42044943", "pmid:41698164", "pmid:41504274", "pmid:41118032", "pmid:41065930", "pmid:41055766", "pmid:40974444", "pmid:40906330", "pmid:40898875", "pmid:40894141", "pmid:40879304", "pmid:40835733", "pmid:40679574", "pmid:40637932", "pmid:40623333", "pmid:40579842", "pmid:40556471", "pmid:40488180", "pmid:40273470", "pmid:40239008", "pmid:40191983", "pmid:40141365", "pmid:40024931", "pmid:40017559", "pmid:39996128", "pmid:39821862", "pmid:39801711", "pmid:39723156", "pmid:39666057", "pmid:39666053", "pmid:39574782", "pmid:39571249", "pmid:39392764", "pmid:39378335", "pmid:39152783", "pmid:39006414", "pmid:38976084", "pmid:38949032", "pmid:38866925", "pmid:38816190", "pmid:38513302", "pmid:38487929", "pmid:38472396", "pmid:38405699", "pmid:38381176", "pmid:38221848", "pmid:38170134", "pmid:38150853", "pmid:38058854", "pmid:37916889", "pmid:37646005", "pmid:37578187", "pmid:37577458", "pmid:37322040", "pmid:37165652", "pmid:32717741", "pmid:30017992", "pmid:28444220", "pmid:26677414", "pmid:26149656", "pmid:15470364", "pmid:15148151"] -}, -{ - "id": "FXS_FMR1", - "disease_id": "FXS, FXTAS, POF1", - "gene": "FMR1", - "evidence": ["Definitive"], - "chrom": "chrX", - "start_hg38": 147912049, - "stop_hg38": 147912111, - "start_hg19": 146993567, - "stop_hg19": 146993629, - "start_t2t": 146176677, - "stop_t2t": 146176769, - "disease": "Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1", - "inheritance": ["XD"], - "association_type": ["Mendelian"], - "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X messenger ribonucleoprotein 1 (FMR1) protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].", - "hpo_terms": null, - "prevalence": "14/100000", - "prevalence_details": "Incidence of full mutation in males 19/100,000; prevalence 14/100,000 [@genereviews:NBK1384]. Female prevalence 9/100,000 [@pmid:24700618]. Known carrier frequency is approximately 300-500/100,000 but detected was 11/100,000 [@pmid:29100084]. FXS prevalence 1:7000 males, 1:11,000 females; FX premutation carriers 1:290-855 males, 1:148-300 females [@isbn:978-3-031-66932-3]. Found worldwide [@genereviews:NBK1384]. In Thailand, 1 in 600 women carry a premutation, and 1 in 400 carry a 'gray zone' allele [@pmid:39320553].", - "age_onset": "Typical: FXS 1 to 'first several years of life', FXTAS 60-65 [@genereviews:NBK1384]; Range: 0 [@url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents] - 78 [@pmid:17427188]; detailed description of typical symptom onset and diagnosis available from Arnold et al [@isbn:978-3-031-66932-3].", - "age_onset_min": 0.0, - "age_onset_max": 78.0, - "typ_age_onset_min": 1.0, - "typ_age_onset_max": 65.0, - "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108]. Women with the premutation have been reported showing episodic memory deficits, similar to those seen in AD [@pmid:41555826]. AGG interruptions are frequently reported in all associated diseases and appear to stabilize alleles; the length of the longest pure stretch predicts repeat instability [@pmid:7987398]. Elevated POI risk was observed starting at 36 repeats, increasing continuously with repeat length [@pmid:42001465].", - "detection": "Modern PCR techniques detect virtually all FMR1 expansion sizes, while RP-PCR detects AGG interspersions. Southern blotting has been used to approximate size and indicate methylation status [@genereviews:NBK1384]. Long-read sequencing has characterized repeat size, interruptions, methylation, and mosaicism [@pmid:29868108; @pmid:31740840].", - "mechanism": "LoF/GoF", - "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768]. PRKGG appears to modulate neurotoxicity [@pmid:41507195].", - "year": "1992 [@pmid:1605194]; causative gene discovered in 1991 [@pmid:1710175]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CGG"], - "pathogenic_motif_reference_orientation": ["CGG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["AGG", "CTG"], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AGG", "CTG"], - "locus_structure": [], - "benign_min": 5, - "benign_max": 44, - "intermediate_min": 45, - "intermediate_max": 200, - "pathogenic_min": 201, - "pathogenic_max": 2000, - "motif_len": 3, - "ref_copies": 20.6667, - "novel": "ref", - "gard": ["6464", "16806"], - "genereviews": ["NBK1384"], - "malacard": ["FRG001", "FRG008", "PRM405"], - "medgen": ["8912", "1644269", "333403"], - "mondo": ["0010383", "0010706", "0010382"], - "omim": ["300624", "300623"], - "orphanet": ["908", "642691", "93256"], - "gnomad": ["FMR1"], - "stripy": ["FMR1"], - "tr_atlas": ["TR173944"], - "webstr_hg38": ["885222"], - "webstr_hg19": ["Expansion_FXS/FMR1"], - "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability"], - "disease_tags": ["phenotypic_spectrum", "ataxia"], - "references": ["genereviews:NBK1384", "url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents", "pmid:17427188", "isbn:978-3-031-66932-3", "pmid:16205714", "pmid:36169768", "pmid:41507195", "pmid:32463542", "pmid:29868108", "pmid:41555826", "pmid:7987398", "pmid:42001465", "pmid:24700618", "pmid:29100084", "pmid:39320553", "pmid:1605194", "pmid:1710175", "mondo:0010383", "mondo:0010706", "mondo:0010382"], - "additional_literature": ["pmid:42041789", "pmid:42001465", "pmid:41952192", "pmid:41929501", "pmid:41917775", "pmid:41806827", "pmid:41792844", "pmid:41777701", "pmid:41762523", "pmid:41717020", "pmid:41672630", "pmid:41648852", "pmid:41557506", "pmid:41523206", "pmid:41514368", "pmid:41409170", "pmid:41386846", "pmid:41385812", "pmid:41372183", "pmid:41351347", "pmid:41278766", "pmid:41256123", "pmid:41167304", "pmid:41145158", "pmid:41120736", "pmid:41098569", "pmid:41074692", "pmid:41028987", "pmid:41015363", "pmid:40980401", "pmid:40940631", "pmid:40877251", "pmid:40869951", "pmid:40879637", "pmid:40778130", "pmid:40653294", "pmid:40600017", "pmid:40534679", "pmid:40488180", "pmid:40480633", "pmid:40459253", "pmid:40455869", "pmid:40418066", "pmid:40417743", "pmid:40296143", "pmid:40287634", "pmid:40244008", "pmid:40243429", "pmid:40243408", "pmid:40220918", "pmid:40166285", "pmid:40149430", "pmid:40141467", "pmid:40141297", "pmid:39945490", "pmid:39934227", "pmid:39839505", "pmid:39684429", "pmid:39654947", "pmid:39588919", "pmid:39574643", "pmid:39553953", "pmid:39492694", "pmid:39482338", "pmid:39488698", "pmid:39095619", "pmid:38997701", "pmid:38961870", "pmid:38946987", "pmid:38865241", "pmid:38772058", "pmid:38714961", "pmid:38522837", "pmid:38412259", "pmid:38307002", "pmid:38164622", "pmid:38162443", "pmid:38134876", "pmid:37970883", "pmid:37936174", "pmid:37906407", "pmid:37776526", "pmid:37745859", "pmid:37628570", "pmid:37583466", "pmid:37551886", "pmid:37551173", "pmid:37508562", "pmid:37364131", "pmid:37352983", "pmid:37347418", "pmid:37333274", "pmid:37209683", "pmid:37200782", "pmid:37146135", "pmid:37120588", "pmid:36882476", "pmid:36816716", "pmid:36250920", "pmid:36227727", "pmid:36012355", "pmid:35977823", "pmid:35948990", "pmid:35904811", "pmid:35729184", "pmid:35701103", "pmid:35681093", "pmid:35609145", "pmid:35182509", "pmid:35152460", "pmid:35129870", "pmid:35101584", "pmid:35072235", "pmid:35038595", "pmid:35026985", "pmid:34938155", "pmid:34926684", "pmid:34924936", "pmid:34880790", "pmid:34845661", "pmid:34828275", "pmid:34738199", "pmid:34690787", "pmid:34679478", "pmid:34646309", "pmid:34641814", "pmid:34641644", "pmid:34542254", "pmid:34456771", "pmid:34421690", "pmid:34372915", "pmid:34358321", "pmid:34321326", "pmid:34296199", "pmid:34276797", "pmid:34193467", "pmid:34153466", "pmid:34117786", "pmid:34111553", "pmid:34077515", "pmid:34054431", "pmid:34046842", "pmid:33998336", "pmid:33856019", "pmid:33854084", "pmid:33772546", "pmid:33709078", "pmid:33692361", "pmid:33642901", "pmid:33627639", "pmid:33585555", "pmid:33523882", "pmid:33497798", "pmid:33381520", "pmid:33374331", "pmid:33296661", "pmid:33195422", "pmid:33181255", "pmid:33151065", "pmid:33039683", "pmid:33008014", "pmid:33007370", "pmid:32787884", "pmid:32716213", "pmid:32695777", "pmid:32688058", "pmid:32589669", "pmid:32478017", "pmid:32446918", "pmid:32281281", "pmid:32258228", "pmid:32089525", "pmid:32066985", "pmid:32048109", "pmid:32012997", "pmid:31991700", "pmid:31989181", "pmid:31891607", "pmid:31887710", "pmid:31880363", "pmid:31866572", "pmid:31804632", "pmid:31733943", "pmid:31671347", "pmid:31665086", "pmid:31632248", "pmid:31586346", "pmid:31566610", "pmid:31512951", "pmid:31481131", "pmid:31468394", "pmid:31347257", "pmid:31336350", "pmid:31332380", "pmid:31299981", "pmid:31294106", "pmid:31264835", "pmid:31159589", "pmid:31096929", "pmid:31026518", "pmid:30984240", "pmid:30900173", "pmid:30847793", "pmid:30840878", "pmid:30832215", "pmid:30808398", "pmid:30665341", "pmid:30619448", "pmid:30606610", "pmid:30576349", "pmid:30567555", "pmid:30566867", "pmid:30538724", "pmid:30509972", "pmid:30396881", "pmid:30396281", "pmid:30312299", "pmid:30311737", "pmid:30211570", "pmid:30197656", "pmid:30173918", "pmid:30160796", "pmid:30158855", "pmid:30147707", "pmid:30030199", "pmid:29990673", "pmid:29981579", "pmid:29971092", "pmid:29880767", "pmid:29844802", "pmid:29766042", "pmid:29760651", "pmid:29379561", "pmid:29375310", "pmid:29316893", "pmid:29275276", "pmid:29267266", "pmid:29209628", "pmid:29188551", "pmid:28967713", "pmid:28895261", "pmid:28829283", "pmid:28815939", "pmid:28812997", "pmid:28697590", "pmid:28504725", "pmid:28454580", "pmid:28391068", "pmid:28369393", "pmid:28278294", "pmid:28233916", "pmid:28193118", "pmid:28173181", "pmid:28103472", "pmid:28065649", "pmid:28005950", "pmid:27883256", "pmid:27862088", "pmid:27841182", "pmid:27841172", "pmid:27840045", "pmid:27822316", "pmid:27816231", "pmid:27784894", "pmid:27646161", "pmid:27768763", "pmid:27761921", "pmid:27667322", "pmid:27616423", "pmid:27713816", "pmid:27708271", "pmid:27696642", "pmid:27696273", "pmid:27695335", "pmid:27540028", "pmid:27427765", "pmid:27375073", "pmid:27372099", "pmid:27355815", "pmid:27355445", "pmid:27335370", "pmid:27315125", "pmid:27294193", "pmid:27066582", "pmid:27042357", "pmid:27041225", "pmid:27001315", "pmid:26940792", "pmid:26825750", "pmid:26743003", "pmid:26716517", "pmid:26694146", "pmid:26554012", "pmid:26537920", "pmid:26463479", "pmid:26440889", "pmid:26420841", "pmid:26345686", "pmid:26322075", "pmid:26298472", "pmid:26194536", "pmid:26099177", "pmid:26029703", "pmid:25954027", "pmid:25953684", "pmid:25886163", "pmid:25875842", "pmid:25788698", "pmid:25776194", "pmid:25763861", "pmid:25726753", "pmid:25693964", "pmid:25689687", "pmid:25606365", "pmid:25436181", "pmid:25399540", "pmid:25366135", "pmid:25346430", "pmid:25290064", "pmid:25278957", "pmid:25250047", "pmid:25179629", "pmid:25171808", "pmid:25170346", "pmid:25147555", "pmid:25110527", "pmid:25093044", "pmid:25085749", "pmid:25013385", "pmid:24998620", "pmid:24963073", "pmid:24958193", "pmid:24938362", "pmid:24920338", "pmid:24912415", "pmid:24875778", "pmid:24858908", "pmid:24821701", "pmid:24816393", "pmid:24814676", "pmid:24787137", "pmid:24763282", "pmid:24743386", "pmid:24718368", "pmid:24715853", "pmid:24657592", "pmid:24654675", "pmid:24630283", "pmid:24591415", "pmid:24578575", "pmid:24463622", "pmid:24455203", "pmid:24448548", "pmid:24428240", "pmid:24424424", "pmid:24401315", "pmid:24352881", "pmid:24289922", "pmid:24261641", "pmid:24249225", "pmid:24177047", "pmid:24130133", "pmid:23949867", "pmid:23896050", "pmid:23792063", "pmid:23753897", "pmid:23731704", "pmid:23719910", "pmid:23683082", "pmid:23602499", "pmid:23574351", "pmid:23553633", "pmid:23497562", "pmid:23478018", "pmid:23464607", "pmid:23440729", "pmid:23250915", "pmid:23198693", "pmid:23148490", "pmid:23146966", "pmid:23015788", "pmid:22924671", "pmid:22918986", "pmid:22887750", "pmid:22796595", "pmid:22707411", "pmid:22612820", "pmid:22619118", "pmid:22581803", "pmid:22507827", "pmid:22498846", "pmid:22489017", "pmid:22466801", "pmid:22427040", "pmid:22393900", "pmid:22387066", "pmid:22311273", "pmid:22251309", "pmid:22241100", "pmid:22224633", "pmid:22223546", "pmid:22211843", "pmid:22177572", "pmid:22161987", "pmid:22149120", "pmid:22022567", "pmid:22004265", "pmid:21944929", "pmid:21808616", "pmid:21807882", "pmid:21775729", "pmid:21767618", "pmid:21720528", "pmid:21671049", "pmid:21646280", "pmid:21636656", "pmid:21617890", "pmid:21596781", "pmid:21572337", "pmid:21567456", "pmid:21499798", "pmid:21476992", "pmid:21445959", "pmid:21430544", "pmid:21389081", "pmid:21329465", "pmid:21270637", "pmid:21267007", "pmid:21254876", "pmid:21170301", "pmid:21051337", "pmid:20938029", "pmid:20935171", "pmid:20858229", "pmid:20801083", "pmid:20799337", "pmid:20736975", "pmid:20702130", "pmid:20616364", "pmid:20431035", "pmid:20425835", "pmid:20410144", "pmid:20364100", "pmid:20221430", "pmid:20213777", "pmid:20168238", "pmid:20118148", "pmid:20051238", "pmid:20011099", "pmid:20001115", "pmid:19927162", "pmid:19846466", "pmid:19804849", "pmid:19796183", "pmid:19778484", "pmid:19760650", "pmid:19710035", "pmid:19684044", "pmid:19562332", "pmid:19525339", "pmid:19514725", "pmid:19460939", "pmid:19460937", "pmid:19440516", "pmid:19404994", "pmid:19204162", "pmid:19097038", "pmid:19045956", "pmid:19026394", "pmid:19014369", "pmid:18565783", "pmid:18563710", "pmid:18553360", "pmid:18535897", "pmid:18472227", "pmid:18428348", "pmid:18413472", "pmid:18403614", "pmid:18384775", "pmid:18373410", "pmid:18357616", "pmid:18310361", "pmid:18281036", "pmid:18165971", "pmid:18165276", "pmid:18160412", "pmid:18057320", "pmid:17724287", "pmid:17698009", "pmid:17674408", "pmid:17635840", "pmid:17591512", "pmid:17516099", "pmid:17442505", "pmid:17322660", "pmid:17295053", "pmid:17279084", "pmid:17266074", "pmid:17152065", "pmid:17150213", "pmid:17089161", "pmid:17044853", "pmid:16780889", "pmid:16761284", "pmid:16361284", "pmid:16337617", "pmid:16258159", "pmid:16164596", "pmid:16047092", "pmid:15971024", "pmid:15947063", "pmid:15876460", "pmid:15811008", "pmid:15741991", "pmid:15659577", "pmid:15649335", "pmid:15629215", "pmid:15483045", "pmid:15377638", "pmid:15302914", "pmid:15068386", "pmid:14755444", "pmid:14735162", "pmid:14722156", "pmid:14560307", "pmid:14519687", "pmid:14517952", "pmid:12948442", "pmid:12905066", "pmid:12853612", "pmid:12681986", "pmid:12659659", "pmid:12634803", "pmid:12515381", "pmid:12379314", "pmid:12232854", "pmid:12160728", "pmid:12111644", "pmid:11992571", "pmid:11886710", "pmid:11807410", "pmid:11551101", "pmid:11499669", "pmid:11487573", "pmid:11410685", "pmid:11256870", "pmid:11229516", "pmid:11142761", "pmid:11142752", "pmid:11119302", "pmid:11097353", "pmid:11073538", "pmid:11070156", "pmid:11005143", "pmid:10995510", "pmid:10987654", "pmid:10941804", "pmid:10915764", "pmid:10870330", "pmid:10855793", "pmid:10780779", "pmid:10773084", "pmid:10710419", "pmid:10674158", "pmid:10631132", "pmid:10587583", "pmid:10567518", "pmid:10545610", "pmid:10521303", "pmid:10462618", "pmid:10447261", "pmid:10445321", "pmid:10424820", "pmid:10409756", "pmid:10369109", "pmid:10331601", "pmid:10331600", "pmid:10204857", "pmid:9916838", "pmid:9856500", "pmid:9811938", "pmid:9806479", "pmid:9792200", "pmid:9761677", "pmid:9738717", "pmid:9653650", "pmid:9624140", "pmid:9630071", "pmid:9604772", "pmid:9603608", "pmid:9529778", "pmid:9485421", "pmid:9514250", "pmid:9507388", "pmid:9415473", "pmid:9437788", "pmid:9399905", "pmid:9358013", "pmid:9341861", "pmid:9382110", "pmid:9299309", "pmid:9279752", "pmid:9254854", "pmid:9207038", "pmid:9201980", "pmid:9195158", "pmid:9640603", "pmid:9131013", "pmid:8798682", "pmid:8808600", "pmid:8792815", "pmid:8792813", "pmid:8844091", "pmid:8844089", "pmid:8844077", "pmid:8844068", "pmid:8844065", "pmid:8844064", "pmid:8755928", "pmid:8698331", "pmid:8826482", "pmid:8826479", "pmid:8725793", "pmid:8636996", "pmid:8673086", "pmid:8664297", "pmid:8644711", "pmid:8626781", "pmid:8872026", "pmid:8800930", "pmid:8519769", "pmid:8634688", "pmid:7499428", "pmid:8589687", "pmid:7581460", "pmid:8593539", "pmid:8579216", "pmid:8559749", "pmid:7541938", "pmid:7761473", "pmid:7758107", "pmid:7732383", "pmid:7783163", "pmid:8750357", "pmid:7825564", "pmid:7717734", "pmid:7881407", "pmid:7864047", "pmid:7927336", "pmid:7849707", "pmid:8023854", "pmid:8197163", "pmid:8162055", "pmid:8275089", "pmid:8244331", "pmid:8237919", "pmid:7902319", "pmid:7692601", "pmid:8242066", "pmid:8334699", "pmid:1642231", "pmid:1605199"] -}, -{ - "id": "BPES_FOXL2", - "disease_id": "BPES", - "gene": "FOXL2", - "evidence": ["Definitive"], - "chrom": "chr3", - "start_hg38": 138946019, - "stop_hg38": 138946062, - "start_hg19": 138664861, - "stop_hg19": 138664904, - "start_t2t": 141687011, - "stop_t2t": 141687054, - "disease": "Blepharophimosis, epicanthus inversus, and ptosis", - "inheritance": ["AD", "AR"], - "association_type": ["Mendelian"], - "disease_description": "Blepharophimosis, Ptosis, and Epicanthus Inversus syndrome (BPES) is an ophthalmic disorder characterized by blepharophimosis, ptosis, epicanthus inversus, and telecanthus, that can appear associated with (type I) or without premature ovarian failure (POF) (type II) [@mondo:0007201].", - "hpo_terms": null, - "prevalence": "0.3/50000", - "prevalence_details": "1 in 50,000 births globally for all BPES, with FOXL2 expansions ~30% of pathogenic variants [@genereviews:NBK1441; @genereviews:NBK535148; @pmid:12529855]. Found worldwide, without differences in prevalence based on sex/ethnicity [@genereviews:NBK1441].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": 0.0, - "typ_age_onset_max": 0.0, - "details": "14 repeats appears highly constrained in humans: homozygous expansions from 14 polyalanines to 19 leads to disease, which can be limited to isolated palpebral defects [@pmid:15591279]. Heterozygous expansions to 24 polyalanines also lead to disease [@pmid:15591279]. Locus start can differ between catalogs, which can affect genotyping.", - "detection": null, - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyalanine expansion leads to haploinsufficiency, likely due to decreased protein availability due to mislocalization following nuclear inclusion [@genereviews:NBK1441; @pmid:15591279]", - "year": "2003 [@pmid:12529855]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 14, - "benign_max": 14, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 15, - "pathogenic_max": 24, - "motif_len": 3, - "ref_copies": 14.0, - "novel": "ref", - "gard": ["23"], - "genereviews": ["NBK1441"], - "malacard": ["BLP046"], - "medgen": ["66312"], - "mondo": ["0007201"], - "omim": ["110100"], - "orphanet": ["126"], - "gnomad": ["FOXL2"], - "stripy": ["FOXL2"], - "tr_atlas": ["TR36092"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["genereviews:NBK1441", "pmid:15591279", "genereviews:NBK535148", "pmid:12529855", "mondo:0007201"], - "additional_literature": ["pmid:22926839", "pmid:18158309", "pmid:17089161", "pmid:7633459"] -}, -{ - "id": "FRDA_FXN", - "disease_id": "FRDA", - "gene": "FXN", - "evidence": ["Definitive"], - "chrom": "chr9", - "start_hg38": 69037286, - "stop_hg38": 69037304, - "start_hg19": 71652202, - "stop_hg19": 71652220, - "start_t2t": 81210834, - "stop_t2t": 81210861, - "disease": "Friedreich ataxia", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", - "hpo_terms": null, - "prevalence": "1/50000", - "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", - "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", - "age_onset_min": 2.0, - "age_onset_max": 80.0, - "typ_age_onset_min": 10.0, - "typ_age_onset_max": 15.0, - "details": "96% of FA patients have biallelic GAA expansions in intron 1 (compared to compound heterozygous with another mutation type), in which the reference allele is conventionally 5-33 repeats [@genereviews:NBK1281]. Intermediate alleles (34-55) are associated with premutations, but may lead to disease as exact pathogenicity/penetrance thresholds have not been demarcated [@genereviews:NBK1281]. The expanded repeats can be interrupted with GAAGAG, GAAGGA, or GAAGAAAA sequences, leading to differential phenotypes [@pmid:11748752]. Allele size is correlated with disease severity and inversely correlated to age of onset, and expansions can reach 1700 repeats [@pmid:8815938].", - "detection": "RP-PCR and long-range PCR have been used to detect expansions [@pmid:35595154]. Long-read sequencing has sized large alleles and resolved sequence organization [@pmid:35595154].", - "mechanism": "LoF", - "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", - "year": "1996 [@pmid:8596916]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GAA"], - "pathogenic_motif_reference_orientation": ["GAA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AAG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "FRA12A_DIP2B", + "disease_id": "FRA12A", + "gene": "DIP2B", + "evidence": [ + "Disputed" + ], + "chrom": "chr12", + "start_hg38": 50505001, + "stop_hg38": 50505024, + "start_hg19": 50898784, + "stop_hg19": 50898807, + "start_t2t": 50468095, + "stop_t2t": 50468118, + "disease": "Intellectual developmental disorder, FRA12A type", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. Impaired intellectual development with or without other anomalies has been described in patients with over 40% of cells expressing FRA12A [@omim:136630]. The DIP2B CGG repeat expansion causes this folate-sensitive site and is associated with a broad phenotypic range, including intellectual disability, ataxia/movement disorder, and epilepsy [@pmid:39854091; @pmid:17236128; @pmid:34622207]; cardiovascular associations have also been reported [@pmid:38418263].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Appears to occur in those of European ancestry/ethnicity [@omim:136630].", + "age_onset": "Typical: 0-1 (small sample size) [@pmid:3742859]. Range: 0-3 [@pmid:4042396].", + "age_onset_min": 0, + "age_onset_max": 3, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Repeat ranges reflect affected and unaffected individuals from a cohort study of 70 controls (6-23 repeats), unaffected carriers representing the intermediate alleles (139-206), and affected individuals (273-306) [@pmid:17236128]. It has been hypothesized that unmethylated expansions may correspond to movement-related phenotypes (chorea, dystonia, and ataxia) [@pmid:39854091].", + "detection": "Short-read sequencing can underestimate expansion size. RP-PCR and Southern blotting detect expansions [@pmid:17236128], while long-read sequencing has been reported to accurately size them [@pmid:39854091].", + "mechanism": "LoF", + "mechanism_detail": "Hypermethylation leading to decreased expression, although unmethylated expansion leads to increased expression [@omim:136630; @pmid:37248219].", + "year": "2007 [@pmid:17236128]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGC" + ], + "pathogenic_motif_reference_orientation": [ + "GGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 23, + "intermediate_min": 139, + "intermediate_max": 206, + "pathogenic_min": 273, + "pathogenic_max": 306, + "motif_len": 3, + "ref_copies": 7, + "novel": "ref", + "gard": [], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "INT482" + ], + "medgen": [ + "369613" + ], + "mondo": [ + "0007634" + ], + "omim": [ + "136630" + ], + "orphanet": [], + "gnomad": [ + "DIP2B" + ], + "stripy": [ + "DIP2B" + ], + "tr_atlas": [ + "TR116656" + ], + "webstr_hg38": [ + "5075695" + ], + "webstr_hg19": [ + "Expansion_FRA12A_MR/DIP2B" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:3742859", + "pmid:4042396", + "omim:136630", + "pmid:37248219", + "pmid:17236128", + "pmid:39854091", + "pmid:34622207", + "pmid:38418263" + ], + "additional_literature": [ + "pmid:42205056", + "pmid:37090938" + ] + }, { - "motif": "A", - "count": 16, - "type": "flank_repeat" + "id": "DMD_DMD", + "disease_id": "DMD", + "gene": "DMD", + "evidence": [ + "Refuted" + ], + "chrom": "chrX", + "start_hg38": 31284557, + "stop_hg38": 31284605, + "start_hg19": 31302674, + "stop_hg19": 31302722, + "start_t2t": 30882677, + "stop_t2t": 30882743, + "disease": "Duchenne muscular dystrophy", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Duchenne muscular dystrophy (DMD) is a neuromuscular disease characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle [@mondo:0010679].", + "hpo_terms": null, + "prevalence": "4.8/100000", + "prevalence_details": "Believed to be 0 for disease specific to STR expansion. 1/3500-4700 male births (incidence) for overall DMD (one of the most common and severe congenital myopathies) [@genereviews:NBK1119]. 4.8/100,000 prevalence [@pmid:35168641]. DMD repeat locus expansion only identified in one Greek family [@pmid:27417533].", + "age_onset": "Typical: 6-7 (usual disease is 0-3) [@pmid:27417533].", + "age_onset_min": 6, + "age_onset_max": 7, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "There is conflicting evidence for the association between this repeat expansion and Duchenne muscular dystrophy. The association was reported in a single family, from which the benign and pathogenic ranges were inferred from affected and unaffected family members [@pmid:27417533]. The population frequency of the proposed pathogenic allele is much higher than expected for a highly penetrant early-onset condition.", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Functional defect in dystrophin/dystroglycan [@pmid:16969582].", + "year": "2016 [@pmid:27417533]", + "location_in_gene": "Intron 62", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "TTC" + ], + "pathogenic_motif_reference_orientation": [ + "TTC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AAG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "TTC", + "count": null, + "type": "pathogenic_repeat" + }, + { + "motif": "T", + "count": 8, + "type": "flank_repeat" + } + ], + "benign_min": 16, + "benign_max": 33, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 59, + "pathogenic_max": 82, + "motif_len": 3, + "ref_copies": 16.7, + "novel": "ref", + "gard": [ + "6291" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "MSC157" + ], + "medgen": [ + "3925" + ], + "mondo": [ + "0010679" + ], + "omim": [ + "310200" + ], + "orphanet": [ + "98896" + ], + "gnomad": [ + "DMD" + ], + "stripy": [ + "DMD" + ], + "tr_atlas": [ + "TR167703" + ], + "webstr_hg38": [], + "webstr_hg19": [ + "STR_1545664" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:27417533", + "pmid:16969582", + "genereviews:NBK1119", + "pmid:35168641", + "mondo:0010679" + ], + "additional_literature": [ + "pmid:41906116", + "pmid:41691287", + "pmid:41244984", + "pmid:41173008", + "pmid:39874107", + "pmid:39803454", + "pmid:39713478", + "pmid:39251998", + "pmid:38290145", + "pmid:37829280", + "pmid:37270548", + "pmid:37090938", + "pmid:36975100", + "pmid:36048237", + "pmid:35615378", + "pmid:35093299", + "pmid:34371182", + "pmid:34238289", + "pmid:33349121", + "pmid:30914715", + "pmid:30349485", + "pmid:29687370", + "pmid:27924830", + "pmid:27178005", + "pmid:27529242", + "pmid:27276190", + "pmid:24411039", + "pmid:25804023", + "pmid:24191945", + "pmid:23894429", + "pmid:23695957", + "pmid:23659897", + "pmid:23574351", + "pmid:23538453", + "pmid:21901138", + "pmid:21305566", + "pmid:22830166", + "pmid:19927354", + "pmid:19907931", + "pmid:19309270", + "pmid:19158820", + "pmid:19108751", + "pmid:18393226", + "pmid:18359022", + "pmid:17439955", + "pmid:16553208", + "pmid:16415967", + "pmid:12132577", + "pmid:11807410", + "pmid:11593558", + "pmid:11280167", + "pmid:11185740", + "pmid:10445321", + "pmid:9894797", + "pmid:8588583", + "pmid:7633442", + "pmid:7705851" + ] }, { - "motif": "GAA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 5, - "benign_max": 33, - "intermediate_min": 34, - "intermediate_max": 55, - "pathogenic_min": 56, - "pathogenic_max": 1700, - "motif_len": 3, - "ref_copies": 6.0, - "novel": "ref", - "gard": ["6468"], - "genereviews": ["NBK1281"], - "malacard": ["FRD001"], - "medgen": ["383962"], - "mondo": ["0100340"], - "omim": ["229300"], - "orphanet": ["95"], - "gnomad": ["FXN"], - "stripy": ["FXN"], - "tr_atlas": ["TR93516"], - "webstr_hg38": ["1509872"], - "webstr_hg19": [], - "locus_tags": ["somatic_instability", "maternal_expansion", "length_affects_onset", "length_affects_phenotype", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance"], - "disease_tags": ["ataxia"], - "references": ["genereviews:NBK1281", "pmid:16205714", "pmid:36169768", "pmid:11748752", "pmid:8815938", "omim:229300", "pmid:29100084", "pmid:8596916"], - "additional_literature": ["pmid:42134333", "pmid:42094143", "pmid:42018061", "pmid:41954755", "pmid:41919005", "pmid:41890103", "pmid:41640354", "pmid:41432640", "pmid:41426430", "pmid:41318543", "pmid:41301739", "pmid:41278766", "pmid:41176519", "pmid:41137390", "pmid:41074692", "pmid:41014100", "pmid:40994821", "pmid:40970480", "pmid:40898875", "pmid:40880907", "pmid:40507780", "pmid:40488180", "pmid:40419681", "pmid:40404357", "pmid:40296143", "pmid:40141365", "pmid:39812846", "pmid:39810753", "pmid:39574782", "pmid:39571249", "pmid:39519164", "pmid:39496895", "pmid:39324476", "pmid:39235665", "pmid:39219417", "pmid:39062522", "pmid:38936158", "pmid:38495102", "pmid:38484450", "pmid:38396238", "pmid:38367363", "pmid:38352270", "pmid:38141359", "pmid:38063871", "pmid:38014032", "pmid:37891254", "pmid:37585105", "pmid:37006329", "pmid:36928898", "pmid:36800320", "pmid:36780807", "pmid:36777637", "pmid:36638893", "pmid:36635061", "pmid:36618024", "pmid:36511872", "pmid:36369844", "pmid:36133907", "pmid:36036008", "pmid:35850241", "pmid:35708503", "pmid:35595154", "pmid:35301072", "pmid:35182509", "pmid:34920960", "pmid:34849883", "pmid:34786480", "pmid:34747814", "pmid:34687355", "pmid:34643298", "pmid:34600502", "pmid:34408077", "pmid:34372915", "pmid:34299126", "pmid:34214898", "pmid:33820410", "pmid:33629768", "pmid:33624863", "pmid:33599954", "pmid:33592237", "pmid:33529321", "pmid:33354116", "pmid:33151022", "pmid:33028632", "pmid:32746884", "pmid:32744307", "pmid:32717741", "pmid:32608417", "pmid:32586831", "pmid:32582297", "pmid:32481586", "pmid:32385683", "pmid:32291635", "pmid:31911468", "pmid:31904895", "pmid:31877117", "pmid:31673878", "pmid:31650522", "pmid:31446150", "pmid:31279523", "pmid:30874991", "pmid:30828501", "pmid:30761510", "pmid:30635474", "pmid:30596685", "pmid:30590615", "pmid:30552117", "pmid:30519163", "pmid:30464193", "pmid:30425621", "pmid:30358880", "pmid:30237783", "pmid:30159187", "pmid:30097477", "pmid:30076049", "pmid:30065630", "pmid:29666341", "pmid:29529236", "pmid:29261783", "pmid:29125828", "pmid:29070698", "pmid:28904984", "pmid:28812047", "pmid:28716278", "pmid:28451558", "pmid:28282710", "pmid:28109580", "pmid:27518705", "pmid:27668106", "pmid:27648458", "pmid:27644330", "pmid:27522354", "pmid:27425605", "pmid:27386501", "pmid:27228352", "pmid:27206881", "pmid:27142428", "pmid:26906906", "pmid:26896803", "pmid:28392990", "pmid:26704351", "pmid:26414159", "pmid:26401053", "pmid:26393353", "pmid:26379101", "pmid:26339677", "pmid:26338206", "pmid:26301374", "pmid:26149656", "pmid:26099177", "pmid:25845763", "pmid:25831023", "pmid:25814655", "pmid:25758173", "pmid:25685137", "pmid:25681319", "pmid:25616511", "pmid:25207996", "pmid:25198290", "pmid:25112975", "pmid:25022367", "pmid:24971578", "pmid:24962209", "pmid:24858524", "pmid:24819921", "pmid:24816001", "pmid:24787137", "pmid:24714088", "pmid:24691413", "pmid:24667739", "pmid:24665325", "pmid:24613765", "pmid:24586819", "pmid:24455203", "pmid:24371004", "pmid:24327207", "pmid:24209901", "pmid:24023969", "pmid:23996585", "pmid:23943791", "pmid:23925595", "pmid:23922695", "pmid:23879205", "pmid:23838345", "pmid:23775342", "pmid:23691127", "pmid:23640016", "pmid:23625326", "pmid:23474817", "pmid:23418481", "pmid:23382970", "pmid:23280845", "pmid:25499576", "pmid:23269675", "pmid:23242090", "pmid:23071719", "pmid:22798143", "pmid:22787155", "pmid:22764244", "pmid:22752483", "pmid:22691228", "pmid:22447512", "pmid:22414340", "pmid:22409940", "pmid:22289650", "pmid:22262734", "pmid:21830088", "pmid:21776984", "pmid:21745819", "pmid:21652007", "pmid:21486239", "pmid:21397024", "pmid:21181307", "pmid:21127046", "pmid:21051337", "pmid:21040903", "pmid:20675166", "pmid:20559546", "pmid:20506029", "pmid:20373285", "pmid:20098685", "pmid:20090835", "pmid:19956589", "pmid:19876374", "pmid:19733517", "pmid:19485941", "pmid:19370769", "pmid:19259763", "pmid:19043662", "pmid:18820300", "pmid:18697824", "pmid:18597733", "pmid:18045775", "pmid:17703324", "pmid:17498922", "pmid:28182935", "pmid:17262846", "pmid:17235301", "pmid:17024371", "pmid:16989817", "pmid:16919418", "pmid:16857735", "pmid:16764889", "pmid:16644517", "pmid:16120311", "pmid:15376485", "pmid:15340363", "pmid:15233994", "pmid:15201464", "pmid:15180699", "pmid:14978261", "pmid:14962663", "pmid:12516053", "pmid:12112211", "pmid:11939898", "pmid:11843702", "pmid:11809170", "pmid:11428460", "pmid:11340071", "pmid:11325966", "pmid:11240567", "pmid:11071107", "pmid:11054139", "pmid:10982543", "pmid:10982187", "pmid:10969848", "pmid:10896266", "pmid:10732799", "pmid:10681084", "pmid:10556290", "pmid:10230399", "pmid:10102712", "pmid:10077729", "pmid:9811933", "pmid:9779809", "pmid:9737785", "pmid:9667602", "pmid:9577387", "pmid:9443873", "pmid:9486868", "pmid:9448568", "pmid:9416816", "pmid:9409356", "pmid:9326946", "pmid:9339708", "pmid:9339680", "pmid:9270667", "pmid:9270608", "pmid:9241271", "pmid:9177790", "pmid:9153531", "pmid:9153129", "pmid:10464657", "pmid:9331900", "pmid:8751856"] -}, -{ - "id": "OPDM2_GIPC1", - "disease_id": "OPDM2", - "gene": "GIPC1", - "evidence": ["Definitive"], - "chrom": "chr19", - "start_hg38": 14496041, - "stop_hg38": 14496075, - "start_hg19": 14606853, - "stop_hg19": 14606887, - "start_t2t": 14622655, - "stop_t2t": 14622692, - "disease": "Oculopharyngodistal myopathy type 2", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750]; Slowly progressive distal weakness, ophthalmoplegia, facial and bulbar weakness [@pmid:39349043]. Two probands presented with ataxia and mild cognitive impairment [@pmid:41975469].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Population dependent; presumed rare. Predominantly found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 20-34 [@pmid:32413282]; Range: 2 [@pmid:41975469] - 70 [@pmid:33374016].", - "age_onset_min": 2.0, - "age_onset_max": 70.0, - "typ_age_onset_min": 20.0, - "typ_age_onset_max": 34.0, - "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Findings suggest that alternative initiation sites and an upstream CTG codon serve as the initiation site for RAN translation [@pmid:41121761]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784]. One proband with ataxia and repeat size 11/112 had an asymptomatic father with 650 repeats and higher methylation [@pmid:41975469].", - "detection": "Short-read WGS or exome sequencing have been reported to be inaccurate in detecting these expansions [@pmid:32413282]. RP-PCR has detected most repeats, while long-read sequencing accurately resolved size and structure [@pmid:32413282].", - "mechanism": "LoF/GoF?", - "mechanism_detail": "Findings suggest that the mechanism is likely not LoF, but the mechanism is otherwise unknown [@pmid:41121761]. This expansion appears to be predominantly RAN translated into a toxic protein [@pmid:41121761]. This protein has been reported to impair cell proliferation, induce cytotoxicity and apoptosis in multiple cell lines, and caused phenotypic defects in a zebrafish model [@pmid:41121761].", - "year": "2020 [@pmid:32413282]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CCG"], - "pathogenic_motif_reference_orientation": ["CCG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 0, - "benign_max": 32, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 73, - "pathogenic_max": 164, - "motif_len": 3, - "ref_copies": 14.7, - "novel": "ref", - "gard": ["16397"], - "genereviews": ["NBK535148"], - "malacard": ["OCL080"], - "medgen": ["1718769"], - "mondo": ["0030134"], - "omim": ["618940"], - "orphanet": [], - "gnomad": ["GIPC1"], - "stripy": ["GIPC1"], - "tr_atlas": ["TR154638"], - "webstr_hg38": ["5626440"], - "webstr_hg19": ["STR_668861"], - "locus_tags": ["length_affects_onset", "length_affects_severity"], - "disease_tags": ["oculopharyngodistal_myopathy", "ataxia"], - "references": ["pmid:32413282", "pmid:41975469", "pmid:33374016", "pmid:41121761", "gnomad:GIPC1", "genereviews:NBK535148", "pmid:38876750", "pmid:35245110", "pmid:38467784", "pmid:39349043"], - "additional_literature": ["pmid:42057638", "pmid:41888971", "pmid:41792844", "pmid:41555317", "pmid:40645757", "pmid:40084170", "pmid:39936620", "pmid:39492694", "pmid:39418922", "pmid:39013564", "pmid:38871700", "pmid:37923380", "pmid:37550168", "pmid:36108428", "pmid:36055118", "pmid:35700120", "pmid:35521937", "pmid:35314910", "pmid:35152460", "pmid:35148830", "pmid:34927285", "pmid:33693509", "pmid:33239111", "pmid:22521844"] -}, -{ - "id": "GDPAG_GLS", - "disease_id": "GDPAG", - "gene": "GLS", - "evidence": ["Definitive"], - "chrom": "chr2", - "start_hg38": 190880872, - "stop_hg38": 190880920, - "start_hg19": 191745598, - "stop_hg19": 191745646, - "start_t2t": 191369982, - "stop_t2t": 191370024, - "disease": "Glutaminase deficiency", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Glutaminase deficiency is characterized by refractory seizures, respiratory failure, brain abnormalities and death in the neonatal period, though milder cases with spastic ataxia-dysarthria have also been reported. This condition is caused by mutations in the glutaminase (GLS) gene [@mondo:0600001].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "As of 2019, only 7 cases total of GLS deficiency, including non-repeat. Identified unrelated patients have been Canadian [@pmid:30970188], Kurdish (Turkey) [@pmid:35913761], and US-American (Northern European/Native American descent) [@pmid:35913761].", - "age_onset": "Early childhood (2-4) [@pmid:30970188; @pmid:35913761].", - "age_onset_min": 2.0, - "age_onset_max": 4.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Pathogenic range from 3 unrelated probands; benign range inferred from mutation data [@genereviews:NBK535148]. Disease cases can be caused by homozygosity or compound heterozygotes [@omim:618412].", - "detection": "Exome sequencing does not reliably detect these expansions. Short-read sequencing has flagged expanded alleles while RP-PCR has confirmed them. Complex alleles may require optical genome mapping or long-read sequencing to resolve size and structure [@pmid:30970188; @pmid:35913761].", - "mechanism": "LoF", - "mechanism_detail": "Change in histone modification decreases transcription [@omim:618412].", - "year": "2019 [@pmid:30970188]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCA"], - "pathogenic_motif_reference_orientation": ["GCA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 38, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 680, - "pathogenic_max": 1500, - "motif_len": 3, - "ref_copies": 16.0, - "novel": "ref", - "gard": [], - "genereviews": ["NBK535148"], - "malacard": ["SPS235"], - "medgen": ["987241"], - "mondo": ["0600001"], - "omim": ["618412"], - "orphanet": ["557056"], - "gnomad": ["GLS"], - "stripy": ["GLS"], - "tr_atlas": ["TR24838"], - "webstr_hg38": ["333878", "5494902"], - "webstr_hg19": ["STR_803303"], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:30970188", "pmid:35913761", "omim:618412", "genereviews:NBK535148", "mondo:0600001"], - "additional_literature": ["pmid:41501457", "pmid:40488180", "pmid:40417743", "pmid:39699045", "pmid:39651202", "pmid:38877099", "pmid:38871700", "pmid:38260514", "pmid:34285061", "pmid:34013182", "pmid:33691262", "pmid:33413375", "pmid:14510958", "pmid:7729621"] -}, -{ - "id": "aFTLD-U_GOLGA8A", - "disease_id": "aFTLD-U", - "gene": "GOLGA8A", - "evidence": ["Provisional"], - "chrom": "chr15", - "start_hg38": 34419425, - "stop_hg38": 34419451, - "start_hg19": 34711626, - "stop_hg19": 34711652, - "start_t2t": 32225152, - "stop_t2t": 32225178, - "disease": "Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U)", - "inheritance": [], - "association_type": ["Risk"], - "disease_description": "A rare subtype of Frontotemporal Lobar Degeneration with FET protein inclusions (FTLD-FET). Categorized clinically by behavioral variant frontotemporal dementia (bvFTD) with TAF15/FUS/EWSR1 positive inclusions. Associated with psychiatric symptoms and frontal/striatal atrophy [@pmid:41820575].", - "hpo_terms": ["HP:0002145 Frontotemporal dementia"], - "prevalence": null, - "prevalence_details": "FTLD-FET makes up ~5–10% of FTLD, and aFTLD-U is the most common FTLD-FET subtype. Prevalence estimates are challenging because diagnosis typically requires neuropathology at autopsy. Risk haplotypes are enriched in Amish and non-Finnish europeans [@pmid:41820575].", - "age_onset": "Typical: 34-55; Range: 21-72 [@pmid:41820575].", - "age_onset_min": 21.0, - "age_onset_max": 72.0, - "typ_age_onset_min": 34.0, - "typ_age_onset_max": 55.0, - "details": "Variation in repeat length, motif length, and motif sequence, with long CT-dimer expansions strongly associated with aFTLD-U risk. CCTT and CCCTCT motif expansions have been observed in unaffected individuals. CCCCT repeats were present in one aFTLD-U case. Proposed risk-associated expansions are typically >450 bp with >80% CT content and/or contain >190 CT dimers, though unaffected carriers have also been observed. Although the functional consequence of this repeat remains unknown, its presence in nearly 60% of aFTLD-U cases points to a major role in disease pathogenesis [@pmid:41820575].", - "detection": null, - "mechanism": "Unknown [@pmid:41820575].", - "mechanism_detail": null, - "year": "2026 [@pmid:41820575]", - "location_in_gene": null, - "gene_strand": "-", - "reference_motif_reference_orientation": ["TTTC"], - "pathogenic_motif_reference_orientation": ["CT"], - "benign_motif_reference_orientation": ["CCTT", "CCCTCT"], - "unknown_motif_reference_orientation": ["CCCCT"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AG"], - "benign_motif_gene_orientation": ["AAGG", "AGAGGG"], - "unknown_motif_gene_orientation": ["AGGGG"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "DM1_DMPK", + "disease_id": "DM1", + "gene": "DMPK", + "evidence": [ + "Definitive" + ], + "chrom": "chr19", + "start_hg38": 45770204, + "stop_hg38": 45770266, + "start_hg19": 46273462, + "stop_hg19": 46273524, + "start_t2t": 48597739, + "stop_t2t": 48597756, + "disease": "Myotonic dystrophy type 1", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Steinert disease, also known as myotonic dystrophy type 1, is a muscle disease characterized by myotonia and by multiorgan damage that combines various degrees of muscle weakness, arrhythmia and/or cardiac conduction disorders, cataract, endocrine damage, sleep disorders and baldness [@mondo:0008056]. It has also been linked to Autism and related traits, especially in individuals with earlier onset [@pmid:40259070; @pmid:29361396; @pmid:8810716; @pmid:27695335; @pmid:29871899; @pmid:37209486].", + "hpo_terms": null, + "prevalence": "9.27/100000", + "prevalence_details": "5-20/100,000 [@genereviews:NBK1165]. 0.5-18.1/100,000 [@pmid:29100084]; 6.5/100,000 [@pmid:31159885]. 9.27 cases (95% CI: 4.73-15.21) per 100,000, ranging from 0.37 to 36.29 cases per 100,000 [@pmid:35483324]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1165].", + "age_onset": "Typical: 10-30 [@genereviews:NBK1165]; Range: 0-74 [@pmid:38454488].", + "age_onset_min": 0, + "age_onset_max": 74, + "typ_age_onset_min": 10, + "typ_age_onset_max": 30, + "details": "Intermediate alleles (35-49) associated with premutation [@genereviews:NBK1165]. 3%-8% of DM1 expansions contain interrupting variant repeats such as CCG and CGG, associated with later onset and milder phenotype; the variant repeat GCGGCA has also been reported [@pmid:32851192; @pmid:39710066]. In another study, interruptions of the CTG repeat with CCG, GGC, CTC or CAG motifs are estimated to occur in 3-11% of DM1 patients [@pmid:35741732]. Expansions within gene ZNF850 may function as DM1 modifiers [@pmid:39679849].", + "detection": "Flanking PCR has detected alleles up to ~150 repeats, while RP-PCR may detect missed expanded alleles [@genereviews:NBK1165; @pmid:24795756]. Southern blotting has approximated the size of large expansions [@pmid:22643181], while long-read sequencing has resolved repeat size and structure [@pmid:41974889].", + "mechanism": "GoF", + "mechanism_detail": "RNA gain-of-function: RNA gelation leading to misregulation of alternative splicing [@pmid:36169768]. Expanded DMPK r(CUG)n RNA forms a hairpin containing periodic 1*1 U/U internal loops that engage/sequester MBNL family RNA-binding proteins, especially MBNL1 [@pmid:42182465], disrupting pre mRNA processing and contributing to cardiac phenotypes [@pmid:39932794]. Loss of MBNL proteins has been linked to mis-splicing of Autism spectrum-risk genes such as SCN2A, ANK2, and SHANK2, possibly leading to Autism-related traits [@pmid:40259070]. Evidence suggests that disulfide bond-dependent MBNL1/MBNL2 dimerization maintains toxic RNA foci [@pmid:41929128].", + "year": "1992 [@pmid:1310900]", + "location_in_gene": "3' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CTG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 34, + "intermediate_min": 35, + "intermediate_max": 49, + "pathogenic_min": 50, + "pathogenic_max": 4000, + "motif_len": 3, + "ref_copies": 20.7, + "novel": "ref", + "gard": [ + "8310" + ], + "genereviews": [ + "NBK1165" + ], + "malacard": [ + "MYT021" + ], + "medgen": [ + "886881" + ], + "mondo": [ + "0008056" + ], + "omim": [ + "160900" + ], + "orphanet": [ + "273" + ], + "gnomad": [ + "DMPK" + ], + "stripy": [ + "DMPK" + ], + "tr_atlas": [ + "TR156684" + ], + "webstr_hg38": [ + "5650727" + ], + "webstr_hg19": [ + "Expansion_DM1/DMPK" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "maternal_expansion", + "length_affects_onset", + "length_affects_phenotype", + "length_affects_severity", + "motif_affects_instability", + "motif_affects_onset", + "motif_affects_phenotype", + "motif_affects_severity" + ], + "disease_tags": [ + "myotonic_dystrophy" + ], + "references": [ + "genereviews:NBK1165", + "pmid:38454488", + "pmid:36169768", + "pmid:39932794", + "pmid:40259070", + "pmid:41929128", + "pmid:39643839", + "pmid:32851192", + "doi:10.1016/j.mcp.2024.102005", + "pmid:35741732", + "doi:10.1093/hmg/ddae186", + "pmid:29100084", + "pmid:31159885", + "pmid:35483324", + "pmid:1310900", + "mondo:0008056", + "pmid:29361396", + "pmid:8810716", + "pmid:27695335", + "pmid:29871899", + "pmid:37209486" + ], + "additional_literature": [ + "pmid:41996006", + "pmid:41974889", + "pmid:41951733", + "pmid:41946260", + "pmid:41855125", + "pmid:41848171", + "pmid:41766784", + "pmid:41762523", + "pmid:41722569", + "pmid:41710065", + "pmid:41707138", + "pmid:41672630", + "pmid:41610137", + "pmid:41533635", + "pmid:41379996", + "pmid:41260620", + "pmid:41250834", + "pmid:41226829", + "pmid:41212113", + "pmid:41161721", + "pmid:41074692", + "pmid:40903903", + "pmid:40896579", + "pmid:40879030", + "pmid:40712995", + "pmid:40606545", + "pmid:40599975", + "pmid:40417743", + "pmid:40296143", + "pmid:40113266", + "pmid:40092662", + "pmid:40004498", + "pmid:39710066", + "pmid:39679849", + "pmid:39492694", + "pmid:39433769", + "pmid:39415708", + "pmid:39391712", + "pmid:39383229", + "pmid:39278936", + "pmid:39267217", + "pmid:39273681", + "pmid:39232665", + "pmid:39180495", + "pmid:39126705", + "pmid:38709060", + "pmid:38704930", + "pmid:38490135", + "pmid:38314057", + "pmid:37829280", + "pmid:37744174", + "pmid:37645891", + "pmid:37638448", + "pmid:37521782", + "pmid:37397246", + "pmid:37373276", + "pmid:37352653", + "pmid:37200862", + "pmid:37146135", + "pmid:37143315", + "pmid:36892629", + "pmid:36778282", + "pmid:36701310", + "pmid:36627397", + "pmid:36352383", + "pmid:36230978", + "pmid:36222125", + "pmid:36099027", + "pmid:36084803", + "pmid:36011377", + "pmid:35770133", + "pmid:35767654", + "pmid:35567413", + "pmid:35328504", + "pmid:35243403", + "pmid:35182509", + "pmid:34976437", + "pmid:34915310", + "pmid:34513303", + "pmid:34472530", + "pmid:34432028", + "pmid:34386887", + "pmid:34372915", + "pmid:34371182", + "pmid:34262431", + "pmid:34114350", + "pmid:34025359", + "pmid:33682722", + "pmid:33624941", + "pmid:33575482", + "pmid:33526774", + "pmid:33497365", + "pmid:33363709", + "pmid:33362853", + "pmid:33235377", + "pmid:32929188", + "pmid:32823742", + "pmid:32717741", + "pmid:32656337", + "pmid:32607474", + "pmid:32350131", + "pmid:32203199", + "pmid:32109384", + "pmid:32063450", + "pmid:31996899", + "pmid:31873063", + "pmid:31759551", + "pmid:31649961", + "pmid:31624084", + "pmid:31570586", + "pmid:31395669", + "pmid:31334355", + "pmid:31316546", + "pmid:31253581", + "pmid:31227653", + "pmid:31220271", + "pmid:31164682", + "pmid:31027145", + "pmid:30891637", + "pmid:30700578", + "pmid:30615214", + "pmid:30546383", + "pmid:30425655", + "pmid:30304901", + "pmid:30216892", + "pmid:30140252", + "pmid:29967337", + "pmid:29947794", + "pmid:29592894", + "pmid:29551391", + "pmid:29381654", + "pmid:29334465", + "pmid:29274549", + "pmid:29246312", + "pmid:29114849", + "pmid:28942489", + "pmid:28886202", + "pmid:28810563", + "pmid:28782311", + "pmid:28623239", + "pmid:28435090", + "pmid:28363916", + "pmid:28211918", + "pmid:28129118", + "pmid:28102759", + "pmid:27854230", + "pmid:27727437", + "pmid:27358583", + "pmid:27245480", + "pmid:27222292", + "pmid:26708183", + "pmid:26640575", + "pmid:26586700", + "pmid:26498872", + "pmid:26190529", + "pmid:25958258", + "pmid:25712547", + "pmid:25655594", + "pmid:25606394", + "pmid:25307018", + "pmid:25303993", + "pmid:25168381", + "pmid:24824895", + "pmid:24795756", + "pmid:24781112", + "pmid:24715907", + "pmid:24705798", + "pmid:24455202", + "pmid:24269018", + "pmid:24196578", + "pmid:24092878", + "pmid:23811192", + "pmid:23570879", + "pmid:23308382", + "pmid:26317000", + "pmid:23263591", + "pmid:23209425", + "pmid:23183533", + "pmid:23161457", + "pmid:23159592", + "pmid:23139243", + "pmid:22643181", + "pmid:22595968", + "pmid:22459146", + "pmid:22427994", + "pmid:22078098", + "pmid:22062891", + "pmid:21971425", + "pmid:21949239", + "pmid:21511730", + "pmid:21303839", + "pmid:21245981", + "pmid:21204798", + "pmid:21103235", + "pmid:20801043", + "pmid:20635151", + "pmid:20603324", + "pmid:20346670", + "pmid:20228473", + "pmid:20179953", + "pmid:20171614", + "pmid:20074967", + "pmid:19946639", + "pmid:19715468", + "pmid:19632331", + "pmid:19516957", + "pmid:19470458", + "pmid:18798829", + "pmid:18729234", + "pmid:18611984", + "pmid:18563724", + "pmid:18561181", + "pmid:18559347", + "pmid:18299519", + "pmid:18228241", + "pmid:18213375", + "pmid:17987120", + "pmid:17950578", + "pmid:17877752", + "pmid:17728322", + "pmid:17487865", + "pmid:17158949", + "pmid:17150182", + "pmid:17145685", + "pmid:17114933", + "pmid:16978612", + "pmid:16927100", + "pmid:16716318", + "pmid:16624843", + "pmid:16401743", + "pmid:16376058", + "pmid:16193250", + "pmid:16027111", + "pmid:15972723", + "pmid:15961406", + "pmid:15750273", + "pmid:15684391", + "pmid:15576360", + "pmid:15489504", + "pmid:15462191", + "pmid:15459182", + "pmid:15336691", + "pmid:15215218", + "pmid:15114529", + "pmid:15019706", + "pmid:14734627", + "pmid:14597103", + "pmid:12970845", + "pmid:12630069", + "pmid:12614928", + "pmid:12427866", + "pmid:11978764", + "pmid:11809728", + "pmid:11793472", + "pmid:11726559", + "pmid:11686919", + "pmid:11592825", + "pmid:11590133", + "pmid:11555624", + "pmid:11526199", + "pmid:11260612", + "pmid:11124939", + "pmid:11013451", + "pmid:11001736", + "pmid:10970838", + "pmid:10958655", + "pmid:10951446", + "pmid:10909850", + "pmid:10802668", + "pmid:10802667", + "pmid:10767343", + "pmid:10699184", + "pmid:10668800", + "pmid:10480373", + "pmid:10454725", + "pmid:10435210", + "pmid:10332037", + "pmid:10332033", + "pmid:9950368", + "pmid:9887331", + "pmid:9858828", + "pmid:9668171", + "pmid:9537423", + "pmid:9402536", + "pmid:9401353", + "pmid:9371827", + "pmid:9294109", + "pmid:9241283", + "pmid:9241282", + "pmid:9207101", + "pmid:8948631", + "pmid:8923304", + "pmid:8673131", + "pmid:8659513", + "pmid:8784809", + "pmid:8595416", + "pmid:7626046", + "pmid:7590731", + "pmid:7726160", + "pmid:7896884", + "pmid:8288237" + ] + }, { - "motif": "CT", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 190, - "pathogenic_max": 600, - "motif_len": 2, - "ref_copies": 6.75, - "novel": "novel", - "gard": ["8436"], - "genereviews": [], - "malacard": ["FRN066"], - "medgen": ["83266"], - "mondo": [], - "omim": ["616180"], - "orphanet": [], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": ["STR_459855"], - "locus_tags": ["somatic_instability"], - "disease_tags": [], - "references": ["pmid:41820575"], - "additional_literature": [] -}, -{ - "id": "HFG_HOXA13-I", - "disease_id": "HFG-I", - "gene": "HOXA13", - "evidence": ["Limited"], - "chrom": "chr7", - "start_hg38": 27199924, - "stop_hg38": 27199966, - "start_hg19": 27239543, - "stop_hg19": 27239585, - "start_t2t": 27335912, - "stop_t2t": 27335954, - "disease": "Hand-foot-genital syndrome 1", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", - "detection": "PCR amplification of tract I, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short-read sequencing may miss expanded repeats [@genereviews:NBK1423].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", - "year": "2004 [@pmid:15385446]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 14, - "benign_max": 14, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 22, - "motif_len": 3, - "ref_copies": 14.0, - "novel": "ref", - "gard": ["2594"], - "genereviews": ["NBK1423"], - "malacard": ["HND004"], - "medgen": ["331103"], - "mondo": ["0007698"], - "omim": ["140000"], - "orphanet": ["2438"], - "gnomad": ["HOXA13_1"], - "stripy": ["HOXA13_1"], - "tr_atlas": ["TR74138"], - "webstr_hg38": ["5679832"], - "webstr_hg19": ["STR_1311037"], - "locus_tags": [], - "disease_tags": ["hand_foot_genital_syndrome"], - "references": ["genereviews:NBK1423", "pmid:15385446", "pmid:17935235", "mondo:0007698"], - "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] -}, -{ - "id": "HFG_HOXA13-II", - "disease_id": "HFG-II", - "gene": "HOXA13", - "evidence": ["Limited"], - "chrom": "chr7", - "start_hg38": 27199825, - "stop_hg38": 27199861, - "start_hg19": 27239444, - "stop_hg19": 27239480, - "start_t2t": 27335813, - "stop_t2t": 27335849, - "disease": "Hand-foot-genital syndrome 2", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", - "detection": "PCR amplification of tract II, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", - "year": "2003 [@pmid:12676922]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 12, - "benign_max": 12, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 18, - "pathogenic_max": 18, - "motif_len": 3, - "ref_copies": 12.0, - "novel": "ref", - "gard": ["2594"], - "genereviews": ["NBK1423"], - "malacard": ["HND004"], - "medgen": ["331103"], - "mondo": ["0007698"], - "omim": ["140000"], - "orphanet": ["2438"], - "gnomad": ["HOXA13_2"], - "stripy": ["HOXA13_2"], - "tr_atlas": ["TR74137"], - "webstr_hg38": ["5679831"], - "webstr_hg19": ["STR_1311036"], - "locus_tags": [], - "disease_tags": ["hand_foot_genital_syndrome"], - "references": ["genereviews:NBK1423", "pmid:15385446", "pmid:17935235", "pmid:12676922", "mondo:0007698"], - "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] -}, -{ - "id": "HFG_HOXA13-III", - "disease_id": "HFG-III", - "gene": "HOXA13", - "evidence": ["Limited"], - "chrom": "chr7", - "start_hg38": 27199678, - "stop_hg38": 27199732, - "start_hg19": 27239297, - "stop_hg19": 27239351, - "start_t2t": 27335684, - "stop_t2t": 27335720, - "disease": "Hand-foot-genital syndrome 3", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Anticipation does not occur, and expansions appear fully penetrant; it is unknown if contractions also lead to phenotypic variation [@genereviews:NBK1423].", - "detection": "PCR amplification of tract III, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", - "year": "2000 [@pmid:10839976]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 8, - "benign_max": 18, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 32, - "motif_len": 3, - "ref_copies": 18.0, - "novel": "ref", - "gard": ["2594"], - "genereviews": ["NBK1423"], - "malacard": ["HND004"], - "medgen": ["331103"], - "mondo": ["0007698"], - "omim": ["140000"], - "orphanet": ["2438"], - "gnomad": ["HOXA13_3"], - "stripy": ["HOXA13_3"], - "tr_atlas": ["TR74136"], - "webstr_hg38": ["1365344"], - "webstr_hg19": ["STR_1311035"], - "locus_tags": [], - "disease_tags": ["hand_foot_genital_syndrome"], - "references": ["genereviews:NBK1423", "pmid:15385446", "pmid:17935235", "pmid:10839976", "mondo:0007698"], - "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] -}, -{ - "id": "SD5_HOXD13", - "disease_id": "SD5", - "gene": "HOXD13", - "evidence": ["Definitive"], - "chrom": "chr2", - "start_hg38": 176093058, - "stop_hg38": 176093103, - "start_hg19": 176957786, - "stop_hg19": 176957831, - "start_t2t": 176581179, - "stop_t2t": 176581224, - "disease": "Syndactyly", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Synpolydactyly (SPD), or syndactyly type II, is defined as a connection between the middle and ring fingers and fourth and fifth toes, variably associated with postaxial polydactyly in the same digits. Minor local anomalies and various metacarpal or metatarsal abnormalities may be present [@omim:186000].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Syndactyly is found across dozens of unrelated families worldwide [@pmid:24038517]. However, syndactyly-5 specific to STR expansion has been found in 3 individuals [@genereviews:NBK535148].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign alleles are highly conserved to be 15 repeats, with disease observed in individuals with 22-23 repeats [@pmid:8614804; @pmid:22406499] as well as in individuals with 8-11 repeats [@genereviews:NBK535148].", - "detection": "Targeted PCR across exon 1 has detected expansions, and subcloning with Sanger sequencing has characterized them [@pmid:9223304].", - "mechanism": "GoF", - "mechanism_detail": "Polyalanine expansion leading to GoF [@pmid:38467784]", - "year": "1996 [@pmid:8614804]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 23, - "motif_len": 3, - "ref_copies": 14.0, - "novel": "ref", - "gard": ["17358"], - "genereviews": ["NBK535148"], - "malacard": ["SYN084"], - "medgen": ["1809573"], - "mondo": ["0008513"], - "omim": ["186000"], - "orphanet": ["295195"], - "gnomad": ["HOXD13"], - "stripy": ["HOXD13"], - "tr_atlas": ["TR24032"], - "webstr_hg38": ["5486677"], - "webstr_hg19": ["STR_796395"], - "locus_tags": ["contraction"], - "disease_tags": [], - "references": ["pmid:38467784", "pmid:8614804", "pmid:22406499", "genereviews:NBK535148", "pmid:24038517", "omim:186000"], - "additional_literature": ["pmid:34159400", "pmid:32652111", "pmid:32386547", "pmid:19841179", "pmid:19546318", "pmid:17935235", "pmid:12414828", "pmid:12116248", "pmid:11543619"] -}, -{ - "id": "HD_HTT", - "disease_id": "HD", - "gene": "HTT", - "evidence": ["Definitive"], - "chrom": "chr4", - "start_hg38": 3074876, - "stop_hg38": 3074933, - "start_hg19": 3076603, - "stop_hg19": 3076660, - "start_t2t": 3073603, - "stop_t2t": 3073687, - "disease": "Huntington disease", - "inheritance": ["AD"], - "association_type": ["Mendelian", "Risk"], - "disease_description": "Huntington disease (HD) is a rare neurodegenerative disorder of the central nervous system characterized by unwanted choreatic movements, behavioral and psychiatric disturbances and dementia [@mondo:0007739].", - "hpo_terms": null, - "prevalence": "1/10000", - "prevalence_details": "6.5-15/100,000 [@pmid:29100084]. 9.71-17:100,000 (European) vs. 0.1-2/100,000 (African), as many as 1 in 400 have reduced penetrance (0.2-2% for 36-38 CAG) HTT alleles [@genereviews:NBK1305]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1305].", - "age_onset": "Typical: 35-44 [@genereviews:NBK1305]; Range: 1-85 [@pmid:39441074; @pmid:21171977].", - "age_onset_min": 1.0, - "age_onset_max": 85.0, - "typ_age_onset_min": 35.0, - "typ_age_onset_max": 44.0, - "details": "27-35 motifs are unstable/premutations, while 36-39 motifs are associated with reduced penetrance and mild phenotypes [@pmid:39572770], and alleles over 40 repeats are typically fully penetrant [@genereviews:NBK1305]. >60 motifs associated with onset age <20 years [@genereviews:NBK1305]. Only CAG expansions are considered pathogenic, but interruptions impact pathogenicity (CAA) [@pmid:35245110; @pmid:39673793]. Only fathers with premutations are considered at risk of transmitting pathogenic alleles [@pmid:19507258]. CAG repeat size 21-35 may continuously modulate brain structure and psychiatric disease risk in an age-dependent manner [@pmid:39572770] [@doi:https://doi.org/10.64898/2026.05.08.26352223]. Somatic expansion of HTT CAG repeats in vulnerable tissues is proposed to contribute to age-dependent onset and neurodegeneration, with greater repeat instability associated with earlier disease onset [@pmid:41926793; @pmid:39824182]. Undiagnosed carriers of premutation and pathogenic HTT expansions, exhibit reduced striatal brain volumes and elevated neurofilament light chain levels before clinical diagnosis, consistent with findings observed across other loci [@pmid:41951733].", - "detection": "PCR methods have reliably detected expansions up to ~115 repeats, but very large expansions may require Southern blotting [@genereviews:NBK1305]. Long-read sequencing has resolved interruptions and validated sizing [@pmid:41512049].", - "mechanism": "GoF/LoF", - "mechanism_detail": "While the primary pathogenic mechanism is gain of function of the protein product, pathogenesis is complex and multifactorial [@pmid:27940602]. Reduced SCN4B expression in striatal neurons has been implicated as a modifier of HD-associated phenotype severity, potentially contributing to dysfunction in motor associated striatal neuronal populations [@pmid:41959367].", - "year": "1993 [@pmid:8458085]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["CAA"], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AAC"], - "locus_structure": [ + "id": "RCPS_EIF4A3", + "disease_id": "RCPS", + "gene": "EIF4A3", + "evidence": [ + "Definitive" + ], + "chrom": "chr17", + "start_hg38": 80147009, + "stop_hg38": 80147139, + "start_hg19": 78120808, + "stop_hg19": 78120938, + "start_t2t": 81047404, + "stop_t2t": 81047534, + "disease": "Richieri-Costa-Pereira syndrome", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Richieri Costa-Pereira syndrome is characterized by short stature, Robin sequence, cleft mandible, pre/postaxial hand anomalies (including hypoplastic thumbs), and clubfoot. It has been described in 14 Brazilian families and in one unrelated French patient. Prominent low set ears and a highly arched palate were also observed. Transmission is autosomal recessive [@mondo:0009998].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "49 cases as of Nov 2023 [@doi:10.1016/j.omsc.2023.100340]. Found in Brazilian families and one unrelated French patient [@mondo:0009998].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": 0, + "typ_age_onset_max": 0, + "details": "Complex repeat of 18-20 nucleotides expands to cause disease: disease is found in individuals with 14-16 repeats [@pmid:24360810], while controls have typically 3-12 repeats with as low as 1 repeat [@genereviews:NBK535148; @gnomad:EIF4A3]. Significance of intermediate alleles is unknown [@pmid:29112243].", + "detection": "Short-read sequencing and exome sequencing do not reliably detect this expansion. Targeted 5′ UTR PCR with Sanger sequencing is the common detection methodology [@pmid:29112243; @pmid:24360810].", + "mechanism": "LoF", + "mechanism_detail": "LoF from a hypomorphic allele [@pmid:24360810].", + "year": "2014 [@pmid:24360810]; syndrome described in 1992 [@pmid:1632438]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CCTCGCTGTGCCGCTGCCGA" + ], + "pathogenic_motif_reference_orientation": [ + "CCTCGCTGTGCCGCTGCCGA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ACAGCGAGGTCGGCAGCGGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 1, + "benign_max": 12, + "intermediate_min": 13, + "intermediate_max": 13, + "pathogenic_min": 14, + "pathogenic_max": 16, + "motif_len": 20, + "ref_copies": null, + "novel": "ref", + "gard": [ + "4718" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "RBN014" + ], + "medgen": [ + "336581" + ], + "mondo": [ + "0009998" + ], + "omim": [ + "268305" + ], + "orphanet": [ + "3102" + ], + "gnomad": [ + "EIF4A3" + ], + "stripy": [], + "tr_atlas": [ + "TR148462" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:24360810", + "genereviews:NBK535148", + "gnomad:EIF4A3", + "pmid:29112243", + "doi:10.1016/j.omsc.2023.100340", + "mondo:0009998", + "pmid:1632438" + ], + "additional_literature": [] + }, { - "motif": "CAG", - "count": null, - "type": "pathogenic_repeat" + "id": "OPDM_FAM193B", + "disease_id": "OPDM", + "gene": "FAM193B", + "evidence": [ + "Provisional" + ], + "chrom": "chr5", + "start_hg38": 177554489, + "stop_hg38": 177554531, + "start_hg19": 176981490, + "stop_hg19": 176981532, + "start_t2t": 178096748, + "stop_t2t": 178096792, + "disease": "Oculopharyngodistal myopathy", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "This is a newly proposed locus for OPDM, it does not have a type number yet and has not been validated. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in two siblings in a UDN family [@pmid:38297326; @pmid:40357124].", + "age_onset": "49-51 based on two siblings [@pmid:39868092].", + "age_onset_min": 49, + "age_onset_max": 51, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (<50) inferred from cohort data, but exact upper bound was not reported. Two affected patients had repeat lengths of 194 and 198, with an unaffected parent with a repeat length of 158 [@pmid:39868092]. The unaffected parent makes the inheritance pattern uncertain, but it appears to be autosomal dominant.", + "detection": null, + "mechanism": null, + "mechanism_detail": "Accumulation of toxic RAN proteins is a proposed mechanism [@pmid:38585781]", + "year": "2026 [@pmid:39868092]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 0, + "benign_max": 50, + "intermediate_min": 158, + "intermediate_max": 158, + "pathogenic_min": 194, + "pathogenic_max": 198, + "motif_len": 3, + "ref_copies": null, + "novel": "ref", + "gard": [ + "12592" + ], + "genereviews": [], + "malacard": [], + "medgen": [ + "320250" + ], + "mondo": [], + "omim": [ + "615813" + ], + "orphanet": [ + "98897" + ], + "gnomad": [ + "FAM193B" + ], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [ + "oculopharyngodistal_myopathy" + ], + "references": [ + "pmid:39868092", + "pmid:38585781", + "pmid:38297326", + "pmid:40357124", + "mondo:0025193" + ], + "additional_literature": [] }, { - "motif": "CAACAG", - "count": 1, - "type": "interruption" + "id": "SCA27B_FGF14", + "disease_id": "SCA27B", + "gene": "FGF14", + "evidence": [ + "Definitive" + ], + "chrom": "chr13", + "start_hg38": 102161574, + "stop_hg38": 102161726, + "start_hg19": 102813924, + "stop_hg19": 102814076, + "start_t2t": 101377549, + "stop_t2t": 101377792, + "disease": "Spinocerebellar ataxia 27B", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian", + "Risk" + ], + "disease_description": "Late-onset ataxia, may have episodic onset, downbeat nystagmus, vertigo, dysarthria, visual disturbances, and neuropathy [@pmid:39349043; @pmid:42044943]. Involvement of the superior cerebellar peduncles is frequent and may aid in diagnostic efforts [@pmid:39996128].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Intermediate expansions 1-2% of population, but non-GAA-pure without relation to ataxia [@genereviews:NBK599589]. Found in multiple ethnicities [@pmid:38876750]; diagnosed patients in America, Brazil, Japan, Germany, Spain, Canada, France, Austria, Australia, Italy, and Poland [@genereviews:NBK599589; @pmid:38886208; @pmid:37267898; @pmid:42096001]. Prevalence is population dependent, ranging from 1.83% to 61% of different ataxia cohorts, with specific enrichment in French-Canadian populations [@pmid:36516086; @pmid:42090775].", + "age_onset": "Typical: 42-70; Range: 21-87 [@genereviews:NBK599589; @pmid:39263992].", + "age_onset_min": 21, + "age_onset_max": 87, + "typ_age_onset_min": 42, + "typ_age_onset_max": 70, + "details": "Higher repeat size is associated with earlier age of onset [@pmid:39263992]. The 250-300 repeats range is linked to incomplete penetrance and >300 repeats with complete penetrance in some studies and resources [@genereviews:NBK599589; @pmid:37399286; @pmid:39227614]. However, our thresholds are taken from suggestions made by Mohren et al upon evaluation of 169 cases and 802 controls; the authors propose lower thresholds based on pathogenic cases of shorter pure repeats [@pmid:39227614]. Additionally, this study suggests that benign motifs may disrupt the formation of secondary structures in DNA/RNA, leading to reduced pathogenicity. The effects of interruptions on penetrance and onset have been demonstrated in patients, with uninterrupted expansions apparently necessary for disease [@pmid:40007153]. Interruptions of GAG, GAAGGA, GAAGAAAGAA, GAAAAGAAGAAGGAAGAAGGAA, GAAAAGAAGAAGGAA, and GCAGAAGAAGAAGAA have been reported [@pmid:40379261]. Variation in flanking regions appears to correlate with repeat size [@pmid:39227614; @pmid:38937606]. Intermediate alleles may increase ataxia susceptibility in combination with other factors or be associated with a phenotypic spectrum (multiple system atrophy) [@pmid:39227614; @pmid:39604554]. A complex (TTC/TGC) ≥300 repeat expansion has been associated as a risk factor for Parkinson's disease [@pmid:41327893; @pmid:41277530]. Expansions can sometimes present as apparently sporadic adult-onset ataxia despite autosomal dominant inheritance [@pmid:42204984].", + "detection": "Short-read genome and exome sequencing are reported to be inaccurate in detecting these expansions [@genereviews:NBK599589]. Long-range PCR and bidirectional RP-PCR have been used for detection, while long-read sequencing has determined repeat structure and purity [@genereviews:NBK599589; @pmid:36516086].", + "mechanism": "LoF", + "mechanism_detail": "Reduced transcript 2 [@pmid:36516086].", + "year": "2023 [@pmid:36493768]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GAA" + ], + "pathogenic_motif_reference_orientation": [ + "GAA" + ], + "benign_motif_reference_orientation": [ + "GGA", + "GCA" + ], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "GAG", + "GAAGGA", + "GAAGAAAGAA", + "GAAAAGAAGAAGGAAGAAGGAA", + "GAAAAGAAGAAGGAA", + "GCAGAAGAAGAAGAA" + ], + "pathogenic_motif_gene_orientation": [ + "CTT" + ], + "benign_motif_gene_orientation": [ + "CCT", + "CTG" + ], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "CCT", + "CCTTCT", + "CTTCTTCTTT", + "CCTTCTTCCTTCTTCTTTTCTT", + "CCTTCTTCTTTTCTT", + "CTGCTTCTTCTTCTT" + ], + "locus_structure": [], + "benign_min": 8, + "benign_max": 179, + "intermediate_min": 180, + "intermediate_max": 319, + "pathogenic_min": 320, + "pathogenic_max": 937, + "motif_len": 3, + "ref_copies": 50.3, + "novel": "ref", + "gard": [], + "genereviews": [ + "NBK599589" + ], + "malacard": [ + "SPN469" + ], + "medgen": [ + "1824051" + ], + "mondo": [ + "0859340" + ], + "omim": [ + "620174" + ], + "orphanet": [ + "675216" + ], + "gnomad": [ + "FGF14" + ], + "stripy": [ + "FGF14" + ], + "tr_atlas": [], + "webstr_hg38": [ + "1272528" + ], + "webstr_hg19": [], + "locus_tags": [ + "maternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "motif_affects_penetrance", + "length_affects_phenotype" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "genereviews:NBK599589", + "pmid:39263992", + "pmid:36516086", + "pmid:37399286", + "pmid:39227614", + "pmid:40007153", + "pmid:40379261", + "pmid:38937606", + "pmid:39604554", + "pmid:41327893", + "pmid:41277530", + "pmid:38876750", + "pmid:38886208", + "pmid:37267898", + "pmid:36493768", + "pmid:39349043", + "pmid:42044943", + "doi:10.1212/NXG.0000000000200253" + ], + "additional_literature": [ + "pmid:42055934", + "pmid:42044943", + "pmid:41698164", + "pmid:41504274", + "pmid:41118032", + "pmid:41065930", + "pmid:41055766", + "pmid:40974444", + "pmid:40906330", + "pmid:40898875", + "pmid:40894141", + "pmid:40879304", + "pmid:40835733", + "pmid:40679574", + "pmid:40637932", + "pmid:40623333", + "pmid:40579842", + "pmid:40556471", + "pmid:40488180", + "pmid:40273470", + "pmid:40239008", + "pmid:40191983", + "pmid:40141365", + "pmid:40024931", + "pmid:40017559", + "pmid:39996128", + "pmid:39821862", + "pmid:39801711", + "pmid:39723156", + "pmid:39666057", + "pmid:39666053", + "pmid:39574782", + "pmid:39571249", + "pmid:39392764", + "pmid:39378335", + "pmid:39152783", + "pmid:39006414", + "pmid:38976084", + "pmid:38949032", + "pmid:38866925", + "pmid:38816190", + "pmid:38513302", + "pmid:38487929", + "pmid:38472396", + "pmid:38405699", + "pmid:38381176", + "pmid:38221848", + "pmid:38170134", + "pmid:38150853", + "pmid:38058854", + "pmid:37916889", + "pmid:37646005", + "pmid:37578187", + "pmid:37577458", + "pmid:37322040", + "pmid:37165652", + "pmid:32717741", + "pmid:30017992", + "pmid:28444220", + "pmid:26677414", + "pmid:26149656", + "pmid:15470364", + "pmid:15148151" + ] }, { - "motif": "CCG", - "count": 12, - "type": "flank_repeat" - }], - "benign_min": 6, - "benign_max": 26, - "intermediate_min": 27, - "intermediate_max": 35, - "pathogenic_min": 36, - "pathogenic_max": 250, - "motif_len": 3, - "ref_copies": 21.3, - "novel": "ref", - "gard": ["6677"], - "genereviews": ["NBK1305"], - "malacard": ["HNT016"], - "medgen": ["5654"], - "mondo": ["0007739"], - "omim": ["143100"], - "orphanet": ["399"], - "gnomad": ["HTT"], - "stripy": ["HTT"], - "tr_atlas": ["TR40017", "TR40018"], - "webstr_hg38": ["4701738", "86468", "86467"], - "webstr_hg19": ["Expansion_HD/HTT"], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance", "proposed_modifier"], - "disease_tags": [], - "references": ["genereviews:NBK1305", "pmid:39441074", "pmid:21171977", "pmid:27940602", "pmid:41959367", "pmid:39572770", "pmid:35245110", "pmid:39673793", "pmid:19507258", "doi:https://doi.org/10.64898/2026.05.08.26352223", "pmid:41926793", "pmid:39824182", "pmid:41951733", "pmid:29100084", "pmid:8458085", "mondo:0007739"], - "additional_literature": ["pmid:42210302", "pmid:42202221", "pmid:42196324", "pmid:42185880", "pmid:42183198", "pmid:42182232", "pmid:42181265", "pmid:42152675", "pmid:42109206", "pmid:42091595", "pmid:42007924", "pmid:41957010", "pmid:41916314", "pmid:41906693", "pmid:41884622", "pmid:41883719", "pmid:41850723", "pmid:41849610", "pmid:41849583", "pmid:41841355", "pmid:41838909", "pmid:41828602", "pmid:41786746", "pmid:41770933", "pmid:41762523", "pmid:41741274", "pmid:41736717", "pmid:41736445", "pmid:41697960", "pmid:41640354", "pmid:41622913", "pmid:41620818", "pmid:41612618", "pmid:41557250", "pmid:41545439", "pmid:41520110", "pmid:41462929", "pmid:41427302", "pmid:41426430", "pmid:41424860", "pmid:41418088", "pmid:41389205", "pmid:41361856", "pmid:41358280", "pmid:41346861", "pmid:41332649", "pmid:41279265", "pmid:41256123", "pmid:41254939", "pmid:41240184", "pmid:41239019", "pmid:41147028", "pmid:41139934", "pmid:41126427", "pmid:41095675", "pmid:41095094", "pmid:41084658", "pmid:41074680", "pmid:41030958", "pmid:41003760", "pmid:40985165", "pmid:40945646", "pmid:40926977", "pmid:40905034", "pmid:40898018", "pmid:40844528", "pmid:40838126", "pmid:40801627", "pmid:40796049", "pmid:40791503", "pmid:40777434", "pmid:40777236", "pmid:40752726", "pmid:40748251", "pmid:40748199", "pmid:40746751", "pmid:40702881", "pmid:40702852", "pmid:40667291", "pmid:40662609", "pmid:40643497", "pmid:40626527", "pmid:40620227", "pmid:40585812", "pmid:40563832", "pmid:40560365", "pmid:40559333", "pmid:40546037", "pmid:40520366", "pmid:40501897", "pmid:40501854", "pmid:40490511", "pmid:40450087", "pmid:40443124", "pmid:40429681", "pmid:40426848", "pmid:40419681", "pmid:40417743", "pmid:40369544", "pmid:40330856", "pmid:40319093", "pmid:40300581", "pmid:40267238", "pmid:40258535", "pmid:40221975", "pmid:40161725", "pmid:40081335", "pmid:40060574", "pmid:40055280", "pmid:40040448", "pmid:40004498", "pmid:40002561", "pmid:39984289", "pmid:39973385", "pmid:39938516", "pmid:39937881", "pmid:39923663", "pmid:39897579", "pmid:39849121", "pmid:39843658", "pmid:39825149", "pmid:39812810", "pmid:39803497", "pmid:39801710", "pmid:39772743", "pmid:39768315", "pmid:39763784", "pmid:39762660", "pmid:39713241", "pmid:39669608", "pmid:39666103", "pmid:39662690", "pmid:39651202", "pmid:39627841", "pmid:39621338", "pmid:39617003", "pmid:39614274", "pmid:39592326", "pmid:39574844", "pmid:39473968", "pmid:39457479", "pmid:39331414", "pmid:39309355", "pmid:39298485", "pmid:39270726", "pmid:39250876", "pmid:39242198", "pmid:39229124", "pmid:39185703", "pmid:39155290", "pmid:39155061", "pmid:39153206", "pmid:39115048", "pmid:39112488", "pmid:39096606", "pmid:39026894", "pmid:39023561", "pmid:38977715", "pmid:38974999", "pmid:38948755", "pmid:38931834", "pmid:38897956", "pmid:38895438", "pmid:38869243", "pmid:38841617", "pmid:38803421", "pmid:38786052", "pmid:38774633", "pmid:38749429", "pmid:38744826", "pmid:38734203", "pmid:38660915", "pmid:38627751", "pmid:38609352", "pmid:38595854", "pmid:38585669", "pmid:38544341", "pmid:38459427", "pmid:38449714", "pmid:38418081", "pmid:38416505", "pmid:38383663", "pmid:38379425", "pmid:38352602", "pmid:38291334", "pmid:38280392", "pmid:38267530", "pmid:38237588", "pmid:38195181", "pmid:38137557", "pmid:38092667", "pmid:38035176", "pmid:38007671", "pmid:38003344", "pmid:37993517", "pmid:37992538", "pmid:37961595", "pmid:37961108", "pmid:37855597", "pmid:37840138", "pmid:37831730", "pmid:37830620", "pmid:37827155", "pmid:37761940", "pmid:37751638", "pmid:37745577", "pmid:37744022", "pmid:37727506", "pmid:37716514", "pmid:37700320", "pmid:37582307", "pmid:37547003", "pmid:37535888", "pmid:37501188", "pmid:37481821", "pmid:37407555", "pmid:37379724", "pmid:37333326", "pmid:37315918", "pmid:37315450", "pmid:37306313", "pmid:37302585", "pmid:37288993", "pmid:37231148", "pmid:37199581", "pmid:37177784", "pmid:37162872", "pmid:37148558", "pmid:37146135", "pmid:37117485", "pmid:37005488", "pmid:36994811", "pmid:36958627", "pmid:36902304", "pmid:36839842", "pmid:36825038", "pmid:36797418", "pmid:36793800", "pmid:36711022", "pmid:36691277", "pmid:36658243", "pmid:36599645", "pmid:36599142", "pmid:36585400", "pmid:36550260", "pmid:36458209", "pmid:36427954", "pmid:36352624", "pmid:36344508", "pmid:36335527", "pmid:36335491", "pmid:36285345", "pmid:36262216", "pmid:36252286", "pmid:36220612", "pmid:36179426", "pmid:36130218", "pmid:36099320", "pmid:36098485", "pmid:36087538", "pmid:36075537", "pmid:36066723", "pmid:36064847", "pmid:36063627", "pmid:36009409", "pmid:35997316", "pmid:35935919", "pmid:35928225", "pmid:35926480", "pmid:35915275", "pmid:35914128", "pmid:35852957", "pmid:35803234", "pmid:35793238", "pmid:35661131", "pmid:35659303", "pmid:35628406", "pmid:35580427", "pmid:35440014", "pmid:35395816", "pmid:35379994", "pmid:35370826", "pmid:35357736", "pmid:35275350", "pmid:35241644", "pmid:35224162", "pmid:35182509", "pmid:35146388", "pmid:35143966", "pmid:35114102", "pmid:35099257", "pmid:35095420", "pmid:35058188", "pmid:35055435", "pmid:35046408", "pmid:35036881", "pmid:38835439", "pmid:34948242", "pmid:34942093", "pmid:34884469", "pmid:34880419", "pmid:34851867", "pmid:34829752", "pmid:34806402", "pmid:34800149", "pmid:34747792", "pmid:34718701", "pmid:34681268", "pmid:34663519", "pmid:34659371", "pmid:34658796", "pmid:34631219", "pmid:34608934", "pmid:34539331", "pmid:34536046", "pmid:34520257", "pmid:34504195", "pmid:34492254", "pmid:34473992", "pmid:34469738", "pmid:34423286", "pmid:34423068", "pmid:34390268", "pmid:34389718", "pmid:34376056", "pmid:34372915", "pmid:34366363", "pmid:34330701", "pmid:34301881", "pmid:34296279", "pmid:34200421", "pmid:34183222", "pmid:34180418", "pmid:34115782", "pmid:34093422", "pmid:34077591", "pmid:34071882", "pmid:34028139", "pmid:34003958", "pmid:33989290", "pmid:33983118", "pmid:33949657", "pmid:33918672", "pmid:33909994", "pmid:33907289", "pmid:33892278", "pmid:33824468", "pmid:33805940", "pmid:33766994", "pmid:33751106", "pmid:33731741", "pmid:33722743", "pmid:33710799", "pmid:33692166", "pmid:33684424", "pmid:33681777", "pmid:33675499", "pmid:33611676", "pmid:33606279", "pmid:33602179", "pmid:33581487", "pmid:33579864", "pmid:33576024", "pmid:33567536", "pmid:33556538", "pmid:33547932", "pmid:33521985", "pmid:33517535", "pmid:33500176", "pmid:33487499", "pmid:33376800", "pmid:33329316", "pmid:33310753", "pmid:33250715", "pmid:33249136", "pmid:33247537", "pmid:33242422", "pmid:33228555", "pmid:33209959", "pmid:33159825", "pmid:33108594", "pmid:33106889", "pmid:33105495", "pmid:33044188", "pmid:32979842", "pmid:32979507", "pmid:32975927", "pmid:32956974", "pmid:32954323", "pmid:32898862", "pmid:32876667", "pmid:32825467", "pmid:32807001", "pmid:32784364", "pmid:32761094", "pmid:32741964", "pmid:32702387", "pmid:32696070", "pmid:32675418", "pmid:32668197", "pmid:32661355", "pmid:32656337", "pmid:32612964", "pmid:32589923", "pmid:32580238", "pmid:32555394", "pmid:32548276", "pmid:32533168", "pmid:32500377", "pmid:32469433", "pmid:32439598", "pmid:32424160", "pmid:32339315", "pmid:32329133", "pmid:32260409", "pmid:32240172", "pmid:32189861", "pmid:32179492", "pmid:32164608", "pmid:32124191", "pmid:32102602", "pmid:32093602", "pmid:32077165", "pmid:32060489", "pmid:32043503", "pmid:31985471", "pmid:31940111", "pmid:31922295", "pmid:31893246", "pmid:31844074", "pmid:31828084", "pmid:31820322", "pmid:31810584", "pmid:31796991", "pmid:31785809", "pmid:31728006", "pmid:31725947", "pmid:31722751", "pmid:31712634", "pmid:31695145", "pmid:31614197", "pmid:31607598", "pmid:31599037", "pmid:31595198", "pmid:31586340", "pmid:31561381", "pmid:31546689", "pmid:31522753", "pmid:31491822", "pmid:31465962", "pmid:31403680", "pmid:31398342", "pmid:31379510", "pmid:31326748", "pmid:31302194", "pmid:31184975", "pmid:31114543", "pmid:31108174", "pmid:31104771", "pmid:31103960", "pmid:31086827", "pmid:31079989", "pmid:31059641", "pmid:30984798", "pmid:30961637", "pmid:30891880", "pmid:30887245", "pmid:30867264", "pmid:30850442", "pmid:30838312", "pmid:30811996", "pmid:30788902", "pmid:30726572", "pmid:30689590", "pmid:30682531", "pmid:30672003", "pmid:30631090", "pmid:30624705", "pmid:30618600", "pmid:30618191", "pmid:30615214", "pmid:30576007", "pmid:30550751", "pmid:30523767", "pmid:30396032", "pmid:30376191", "pmid:30358836", "pmid:30354976", "pmid:30336474", "pmid:30314815", "pmid:30262848", "pmid:30256717", "pmid:30239724", "pmid:30194983", "pmid:30194046", "pmid:30185623", "pmid:30171891", "pmid:30149534", "pmid:30126429", "pmid:30122542", "pmid:30120431", "pmid:30103339", "pmid:30103338", "pmid:30028085", "pmid:30007561", "pmid:29984244", "pmid:29945620", "pmid:29932473", "pmid:29925548", "pmid:29902468", "pmid:29881950", "pmid:29858077", "pmid:29813067", "pmid:29804730", "pmid:29801887", "pmid:29791508", "pmid:29743609", "pmid:29738460", "pmid:29715545", "pmid:29694882", "pmid:29687370", "pmid:29685790", "pmid:29682858", "pmid:29670796", "pmid:29660633", "pmid:29619771", "pmid:29581148", "pmid:29564144", "pmid:29535594", "pmid:29513687", "pmid:29494703", "pmid:29491012", "pmid:29480209", "pmid:29480205", "pmid:29480204", "pmid:29466333", "pmid:29462355", "pmid:29460498", "pmid:29459817", "pmid:29451775", "pmid:29441485", "pmid:29440125", "pmid:29378824", "pmid:29375575", "pmid:29367444", "pmid:29346421", "pmid:29324753", "pmid:29291624", "pmid:29264979", "pmid:29253686", "pmid:29249939", "pmid:29230030", "pmid:29229845", "pmid:29212711", "pmid:29172480", "pmid:29160844", "pmid:29066237", "pmid:29046994", "pmid:29043641", "pmid:29036832", "pmid:28986324", "pmid:28984613", "pmid:28971447", "pmid:28843844", "pmid:28743452", "pmid:28729730", "pmid:28715425", "pmid:28698602", "pmid:28661018", "pmid:28657159", "pmid:28653853", "pmid:28652746", "pmid:28642124", "pmid:28621522", "pmid:28585930", "pmid:28582868", "pmid:28536578", "pmid:28494017", "pmid:28465506", "pmid:28412438", "pmid:28406926", "pmid:28400517", "pmid:28359739", "pmid:28339398", "pmid:28270748", "pmid:28266655", "pmid:28238795", "pmid:28205498", "pmid:28202696", "pmid:28165127", "pmid:28153533", "pmid:28129107", "pmid:28096892", "pmid:28000697", "pmid:27983559", "pmid:27913616", "pmid:27870408", "pmid:27868347", "pmid:27818324", "pmid:27681197", "pmid:27774050", "pmid:27740685", "pmid:27714917", "pmid:27689620", "pmid:27677791", "pmid:27662335", "pmid:27658206", "pmid:27639545", "pmid:27611938", "pmid:27540492", "pmid:27481337", "pmid:27479945", "pmid:27477323", "pmid:27400454", "pmid:27376585", "pmid:27335115", "pmid:27335079", "pmid:27318215", "pmid:27288455", "pmid:27271685", "pmid:27221610", "pmid:27207688", "pmid:27182645", "pmid:27170315", "pmid:27085395", "pmid:27080129", "pmid:27031731", "pmid:27014581", "pmid:27003665", "pmid:27003663", "pmid:27002149", "pmid:26982737", "pmid:26958025", "pmid:26951563", "pmid:26900923", "pmid:26874369", "pmid:26864449", "pmid:26849111", "pmid:26846325", "pmid:26702360", "pmid:26682993", "pmid:26651603", "pmid:26642438", "pmid:26621114", "pmid:26615955", "pmid:26557176", "pmid:26490331", "pmid:26439718", "pmid:26428929", "pmid:26410751", "pmid:26397897", "pmid:26397895", "pmid:26378991", "pmid:26375764", "pmid:26333255", "pmid:26320893", "pmid:26247199", "pmid:26232222", "pmid:26219658", "pmid:26218986", "pmid:26201449", "pmid:26195796", "pmid:26148071", "pmid:26148061", "pmid:26100538", "pmid:26081309", "pmid:26079385", "pmid:25993131", "pmid:25990798", "pmid:25972145", "pmid:25953777", "pmid:25934536", "pmid:25928884", "pmid:25889241", "pmid:25876513", "pmid:25871323", "pmid:25859666", "pmid:25850430", "pmid:25849618", "pmid:25800750", "pmid:25767004", "pmid:25732261", "pmid:25703232", "pmid:25687118", "pmid:25678252", "pmid:25662336", "pmid:25642374", "pmid:25606985", "pmid:25574027", "pmid:25562842", "pmid:25466405", "pmid:25464109", "pmid:25453459", "pmid:25447230", "pmid:25385587", "pmid:25380582", "pmid:25358814", "pmid:25322077", "pmid:25316307", "pmid:25300333", "pmid:25300330", "pmid:25248608", "pmid:25246229", "pmid:25207939", "pmid:25136821", "pmid:25101541", "pmid:25099302", "pmid:25088714", "pmid:25062863", "pmid:25062764", "pmid:25035419", "pmid:25034271", "pmid:25026978", "pmid:24972706", "pmid:24951540", "pmid:24938402", "pmid:24921664", "pmid:24911443", "pmid:24841383", "pmid:24825316", "pmid:24816393", "pmid:24788406", "pmid:24784230", "pmid:24751919", "pmid:24728353", "pmid:24706734", "pmid:24633813", "pmid:24566949", "pmid:24564568", "pmid:24534762", "pmid:24465260", "pmid:24462335", "pmid:24459609", "pmid:24459107", "pmid:24452335", "pmid:24405816", "pmid:24390280", "pmid:24389360", "pmid:24380395", "pmid:24363131", "pmid:24359926", "pmid:24314096", "pmid:24292706", "pmid:24286237", "pmid:24270512", "pmid:24192302", "pmid:24047873", "pmid:24041806", "pmid:24038471", "pmid:24027120", "pmid:24022020", "pmid:24019913", "pmid:24000094", "pmid:23974869", "pmid:23963702", "pmid:23946314", "pmid:23933208", "pmid:23906595", "pmid:23896435", "pmid:23894380", "pmid:23847583", "pmid:23775678", "pmid:23765727", "pmid:23732677", "pmid:23664844", "pmid:23644918", "pmid:23624566", "pmid:23595883", "pmid:23576953", "pmid:23557875", "pmid:23525903", "pmid:23494654", "pmid:23480802", "pmid:23443539", "pmid:23440000", "pmid:23437422", "pmid:23419892", "pmid:23416527", "pmid:23398026", "pmid:23372043", "pmid:23346156", "pmid:23341618", "pmid:23300918", "pmid:23284626", "pmid:23277128", "pmid:25063431", "pmid:23157165", "pmid:23083689", "pmid:23054839", "pmid:23051704", "pmid:23042244", "pmid:23008174", "pmid:22993450", "pmid:22985800", "pmid:22974690", "pmid:22914735", "pmid:22833283", "pmid:22814437", "pmid:22803944", "pmid:22786682", "pmid:22748968", "pmid:22720673", "pmid:22674458", "pmid:22668780", "pmid:22649062", "pmid:22623107", "pmid:22613578", "pmid:22589249", "pmid:22583646", "pmid:22580959", "pmid:22580459", "pmid:22542623", "pmid:22537721", "pmid:22526956", "pmid:22497302", "pmid:26307259", "pmid:22454241", "pmid:22425717", "pmid:22409360", "pmid:22387017", "pmid:22383888", "pmid:22367996", "pmid:22359536", "pmid:22323755", "pmid:22306231", "pmid:22297462", "pmid:22274789", "pmid:22237433", "pmid:22235343", "pmid:22219281", "pmid:22216210", "pmid:22210241", "pmid:24353748", "pmid:23925262", "pmid:23476655", "pmid:22179316", "pmid:22178474", "pmid:22124413", "pmid:22072510", "pmid:22011578", "pmid:21989477", "pmid:21962718", "pmid:21951270", "pmid:21915913", "pmid:21909428", "pmid:21907324", "pmid:21897851", "pmid:21896309", "pmid:21858921", "pmid:21672921", "pmid:21566259", "pmid:21555070", "pmid:21540131", "pmid:21519949", "pmid:21509658", "pmid:21507249", "pmid:21432905", "pmid:21427085", "pmid:21370269", "pmid:21347256", "pmid:21334439", "pmid:21322024", "pmid:21297956", "pmid:21247881", "pmid:21211002", "pmid:21192926", "pmid:22832606", "pmid:22453877", "pmid:21177255", "pmid:21170307", "pmid:21147489", "pmid:21108634", "pmid:21106039", "pmid:21068430", "pmid:21037797", "pmid:21037796", "pmid:21028906", "pmid:20935170", "pmid:20919768", "pmid:24868381", "pmid:20877453", "pmid:20864123", "pmid:20697744", "pmid:20688164", "pmid:20655708", "pmid:20645403", "pmid:20629137", "pmid:20585470", "pmid:20569486", "pmid:20552561", "pmid:20457230", "pmid:20385209", "pmid:20360314", "pmid:20217280", "pmid:20190273", "pmid:20145031", "pmid:22353486", "pmid:20001119", "pmid:19997493", "pmid:19956633", "pmid:19895335", "pmid:19882735", "pmid:19857538", "pmid:19823894", "pmid:19810823", "pmid:19776381", "pmid:19652143", "pmid:19649213", "pmid:19621255", "pmid:19607813", "pmid:19595623", "pmid:19586540", "pmid:19573560", "pmid:19573298", "pmid:21048629", "pmid:19484127", "pmid:19465745", "pmid:19455596", "pmid:19412185", "pmid:19270701", "pmid:19266143", "pmid:19250382", "pmid:19249009", "pmid:21415933", "pmid:19243073", "pmid:19210789", "pmid:19200948", "pmid:19200361", "pmid:19193881", "pmid:19133136", "pmid:19130884", "pmid:19064745", "pmid:19059613", "pmid:19014073", "pmid:19012814", "pmid:18986359", "pmid:18981372", "pmid:18931668", "pmid:18930824", "pmid:18854207", "pmid:18844975", "pmid:18754766", "pmid:18688140", "pmid:18640989", "pmid:18608348", "pmid:18512767", "pmid:18502655", "pmid:18481795", "pmid:18441666", "pmid:18430257", "pmid:18413470", "pmid:18403212", "pmid:18403126", "pmid:18398004", "pmid:18387780", "pmid:18380486", "pmid:18373410", "pmid:18349696", "pmid:18314311", "pmid:18307262", "pmid:18299573", "pmid:18298206", "pmid:18231868", "pmid:18204817", "pmid:18192679", "pmid:19378429", "pmid:18158109", "pmid:18157708", "pmid:18096682", "pmid:18091069", "pmid:18077673", "pmid:18068007", "pmid:18067195", "pmid:18057558", "pmid:18004675", "pmid:17952586", "pmid:17947312", "pmid:17726644", "pmid:17707354", "pmid:17687393", "pmid:17665004", "pmid:17660463", "pmid:17653603", "pmid:17653274", "pmid:17653262", "pmid:17627386", "pmid:17615168", "pmid:17610899", "pmid:17584778", "pmid:17569088", "pmid:17562929", "pmid:17557337", "pmid:17548158", "pmid:17516481", "pmid:17493035", "pmid:17478887", "pmid:17427191", "pmid:17409200", "pmid:17383831", "pmid:17363167", "pmid:17356014", "pmid:17352933", "pmid:17352932", "pmid:17352931", "pmid:17352930", "pmid:17307423", "pmid:17299512", "pmid:17293170", "pmid:17291464", "pmid:17183717", "pmid:17181545", "pmid:17174018", "pmid:17115386", "pmid:17096834", "pmid:17055784", "pmid:17040921", "pmid:17018562", "pmid:17018277", "pmid:16987871", "pmid:16981596", "pmid:16980414", "pmid:16973440", "pmid:16925544", "pmid:16918952", "pmid:16914060", "pmid:16858508", "pmid:16772714", "pmid:16769871", "pmid:16751280", "pmid:16690085", "pmid:16687439", "pmid:16626669", "pmid:16606912", "pmid:16600988", "pmid:16570300", "pmid:16564426", "pmid:16526033", "pmid:16515395", "pmid:16461334", "pmid:16434483", "pmid:16395126", "pmid:16372906", "pmid:16321399", "pmid:16261565", "pmid:16221531", "pmid:16159402", "pmid:16135087", "pmid:16125146", "pmid:16111888", "pmid:16096998", "pmid:16082690", "pmid:16040812", "pmid:16033418", "pmid:16007623", "pmid:15986189", "pmid:15954918", "pmid:15906159", "pmid:15850737", "pmid:15848234", "pmid:15843398", "pmid:15832309", "pmid:15811941", "pmid:15764008", "pmid:15758168", "pmid:15742215", "pmid:15722951", "pmid:15716522", "pmid:15704211", "pmid:15635668", "pmid:15531095", "pmid:15496672", "pmid:15496421", "pmid:15468075", "pmid:15372528", "pmid:15365789", "pmid:15361494", "pmid:15354395", "pmid:15345132", "pmid:15254954", "pmid:15229244", "pmid:15211622", "pmid:15201464", "pmid:15201455", "pmid:15193429", "pmid:15147313", "pmid:15094787", "pmid:15076735", "pmid:15040808", "pmid:15025718", "pmid:14999077", "pmid:14993615", "pmid:14713958", "pmid:14708029", "pmid:14688268", "pmid:14673581", "pmid:14625278", "pmid:14625025", "pmid:14581669", "pmid:14570710", "pmid:12966525", "pmid:12926013", "pmid:12895502", "pmid:12886033", "pmid:12850791", "pmid:12824708", "pmid:12805114", "pmid:12797118", "pmid:12791042", "pmid:12783847", "pmid:12782968", "pmid:12700167", "pmid:12599191", "pmid:12576549", "pmid:12554681", "pmid:12460551", "pmid:12438470", "pmid:12405543", "pmid:12393802", "pmid:12354780", "pmid:12226089", "pmid:12223581", "pmid:12221159", "pmid:12218657", "pmid:12208565", "pmid:12177311", "pmid:12123845", "pmid:12097805", "pmid:11979062", "pmid:11978769", "pmid:11920857", "pmid:11914418", "pmid:11807410", "pmid:11782460", "pmid:11761463", "pmid:11741397", "pmid:11704263", "pmid:11689489", "pmid:11607033", "pmid:11593450", "pmid:11592850", "pmid:11558794", "pmid:11552131", "pmid:11532992", "pmid:11524486", "pmid:11520890", "pmid:11494364", "pmid:11483245", "pmid:11386982", "pmid:11409734", "pmid:11406606", "pmid:11340249", "pmid:11331615", "pmid:11317220", "pmid:11279522", "pmid:11260214", "pmid:22034471", "pmid:11225602", "pmid:11172033", "pmid:11152661", "pmid:11106399", "pmid:11105061", "pmid:11063736", "pmid:11040449", "pmid:11030759", "pmid:11021756", "pmid:11013077", "pmid:11009201", "pmid:10980573", "pmid:10964480", "pmid:10880387", "pmid:10860124", "pmid:10814708", "pmid:10794362", "pmid:10780268", "pmid:10770860", "pmid:10766906", "pmid:10717003", "pmid:10712225", "pmid:10677504", "pmid:10666223", "pmid:10631644", "pmid:10611371", "pmid:10581038", "pmid:10574348", "pmid:10564878", "pmid:10533044", "pmid:10522893", "pmid:10502848", "pmid:10502825", "pmid:10489045", "pmid:10486315", "pmid:10478585", "pmid:10441327", "pmid:10441201", "pmid:10434306", "pmid:10434303", "pmid:10434297", "pmid:10434295", "pmid:10405095", "pmid:10398087", "pmid:10334474", "pmid:10333377", "pmid:10206229", "pmid:10197541", "pmid:10196370", "pmid:10196365", "pmid:10098889", "pmid:10091627", "pmid:10090478", "pmid:10082833", "pmid:10052816", "pmid:10051007", "pmid:10023115", "pmid:9949443", "pmid:9949199", "pmid:9932964", "pmid:9887339", "pmid:9818876", "pmid:9806905", "pmid:9792871", "pmid:9768849", "pmid:9684917", "pmid:9674805", "pmid:9666478", "pmid:9647305", "pmid:9626775", "pmid:9611675", "pmid:9527890", "pmid:9536082", "pmid:9536081", "pmid:9536080", "pmid:9595987", "pmid:9577843", "pmid:9514585", "pmid:9514579", "pmid:9361024", "pmid:9485067", "pmid:9462548", "pmid:9415475", "pmid:23604331", "pmid:9399688", "pmid:9398841", "pmid:9388503", "pmid:9339688", "pmid:9299885", "pmid:9299309", "pmid:9267034", "pmid:9267033", "pmid:9152833", "pmid:9150744", "pmid:9150168", "pmid:9108071", "pmid:9106534", "pmid:9143014", "pmid:10462592", "pmid:9020849", "pmid:9401013", "pmid:9219003", "pmid:9002673", "pmid:9384710", "pmid:8931689", "pmid:8898202", "pmid:8855141", "pmid:8912795", "pmid:8751857", "pmid:8659522", "pmid:8735227", "pmid:8643525", "pmid:8678115", "pmid:8606810", "pmid:8714530", "pmid:8614526", "pmid:8985734", "pmid:8954302", "pmid:8840396", "pmid:8766138", "pmid:8572659", "pmid:8557266", "pmid:7477379", "pmid:8804464", "pmid:7576661", "pmid:7568002", "pmid:8544189", "pmid:8541834", "pmid:7668287", "pmid:7668260", "pmid:7639626", "pmid:7484060", "pmid:7480359", "pmid:7774020", "pmid:7675777", "pmid:7898693", "pmid:7868117", "pmid:7634532", "pmid:7757069", "pmid:9173995", "pmid:7881406", "pmid:7969980", "pmid:7959696", "pmid:7853373", "pmid:7915776", "pmid:7815437", "pmid:8208412", "pmid:8178825", "pmid:8064815", "pmid:7909529", "pmid:8162059", "pmid:8162055", "pmid:8162053", "pmid:8044653", "pmid:7888133", "pmid:7865169", "pmid:8133511", "pmid:8133510", "pmid:8133508", "pmid:8133495", "pmid:8111374", "pmid:8087617", "pmid:8105214", "pmid:8268906", "pmid:8252042", "pmid:8242074", "pmid:8401589", "pmid:8401588", "pmid:8401587", "pmid:2521771", "pmid:2971929", "pmid:3131233"] -}, -{ - "id": "HDL2_JPH3", - "disease_id": "HDL2", - "gene": "JPH3", - "evidence": ["Definitive"], - "chrom": "chr16", - "start_hg38": 87604282, - "stop_hg38": 87604329, - "start_hg19": 87637888, - "stop_hg19": 87637935, - "start_t2t": 93675723, - "stop_t2t": 93675776, - "disease": "Huntington disease-like 2", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Huntington disease-like 2 (HDL2) is a severe neurodegenerative disorder considered part of the neuroacanthocytosis syndromes characterized by a triad of movement, psychiatric, and cognitive abnormalities [@mondo:0011671].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "<1/1,000,000 [@orphanet:98934]. Largely in individuals of African ancestry [@genereviews:NBK1529], where a possible JPH3 founder mutation has been identified [@pmid:40187026].", - "age_onset": "Typical: 30-52; Range: 12-66 [@genereviews:NBK1529].", - "age_onset_min": 12.0, - "age_onset_max": 66.0, - "typ_age_onset_min": 30.0, - "typ_age_onset_max": 52.0, - "details": "Intermediate alleles (29-39) may either be premutations or associated with reduced penetrance; the longest pathogenic expansion (40+ motifs) to date is 60 repeats [@genereviews:NBK1529]", - "detection": null, - "mechanism": "LoF/GoF", - "mechanism_detail": "Non-mutually exclusive mechanisms include loss of function from RNA sequestration and gain of function from toxic transcripts and increased protein expression [@genereviews:NBK1529]", - "year": "2001 [@pmid:11694876]", - "location_in_gene": "Coding Exon 2", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CTG"], - "pathogenic_motif_reference_orientation": ["CTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CTG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 28, - "intermediate_min": 29, - "intermediate_max": 39, - "pathogenic_min": 40, - "pathogenic_max": 60, - "motif_len": 3, - "ref_copies": 15.6667, - "novel": "ref", - "gard": ["16874"], - "genereviews": ["NBK1529"], - "malacard": ["HNT004"], - "medgen": ["341120"], - "mondo": ["0011671"], - "omim": ["606438"], - "orphanet": ["98934"], - "gnomad": ["JPH3"], - "stripy": ["JPH3"], - "tr_atlas": ["TR143309"], - "webstr_hg38": ["828516", "5987878"], - "webstr_hg19": ["Expansion_HDL2/JPH3"], - "locus_tags": ["somatic_instability", "length_affects_phenotype", "length_affects_onset", "length_affects_penetrance", "length_affects_severity"], - "disease_tags": [], - "references": ["genereviews:NBK1529", "orphanet:98934", "pmid:40187026", "pmid:11694876", "mondo:0011671"], - "additional_literature": ["pmid:41957010", "pmid:41074680", "pmid:40914005", "pmid:38948793", "pmid:38725192", "pmid:38617831", "pmid:37379724", "pmid:35926480", "pmid:33824468", "pmid:33044188", "pmid:32675418", "pmid:32028232", "pmid:30682531", "pmid:30615214", "pmid:29801887", "pmid:29208631", "pmid:29066237", "pmid:27400454", "pmid:27288455", "pmid:26079385", "pmid:24269018", "pmid:22447335", "pmid:22367996", "pmid:22297462", "pmid:21555070", "pmid:17516481", "pmid:16858508", "pmid:15764008", "pmid:15468075", "pmid:14557581", "pmid:12805114", "pmid:11906164"] -}, -{ - "id": "OPDM1_LRP12", - "disease_id": "OPDM1", - "gene": "LRP12", - "evidence": ["Strong"], - "chrom": "chr8", - "start_hg38": 104588970, - "stop_hg38": 104588999, - "start_hg19": 105601198, - "stop_hg19": 105601227, - "start_t2t": 105716409, - "stop_t2t": 105716441, - "disease": "Oculopharyngodistal myopathy type 1", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Adult-onset ptosis, dysphagia [@pmid:39349043]; External ophthalmoplegia, facial weakness, pharyngeal, and distal limb weakness [@pmid:38876750]; May be slight male predominance [@pmid:34047774].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Population dependent; unknown percentage of LRP12 pathogenic variants. Typically East Asian ancestry [@pmid:38876750]; potentially most frequent cause of OPDM in Japan [@pmid:34047774].", - "age_onset": "Typical: 31-51 [@pmid:34047774]; Range: 7-66 [@pmid:2124290].", - "age_onset_min": 7.0, - "age_onset_max": 66.0, - "typ_age_onset_min": 31.0, - "typ_age_onset_max": 51.0, - "details": "Benign range (13-45) inferred from cohort data, but pathogenic range isn't yet fully understood [@genereviews:NBK535148]. In a cohort of 65 patients from 59 families, alleles ranged from 85-289 repeats, with an inverse relationship between size and age of onset [@pmid:34047774]. Inherited peripheral neuropathy (IPN) may be associated with shorter expansions [@pmid:39013564]. Interruptions seen: ACG, CCA [@pmid:35245110].", - "detection": "Short-read sequencing has been reported to be unreliable at detecting large expansions [@pmid:40858832]. RP-PCR followed by long-read sequencing is commonly used for characterization [@pmid:39013564].", - "mechanism": "GoF?", - "mechanism_detail": "RNA mediated toxicity hypothesized [@omim:164310]; may involve RAN translation [@pmid:38467784]. Somatic mosaicism and hypermethylation have also been reported [@pmid:41131788].", - "year": "2019 [@pmid:31332380]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CGC"], - "pathogenic_motif_reference_orientation": ["CGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 13, - "benign_max": 45, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 85, - "pathogenic_max": 289, - "motif_len": 3, - "ref_copies": 11.7, - "novel": "ref", - "gard": ["15097"], - "genereviews": ["NBK535148"], - "malacard": ["OCL076"], - "medgen": ["1684682"], - "mondo": ["0020793"], - "omim": ["164310"], - "orphanet": ["98897"], - "gnomad": ["LRP12"], - "stripy": ["LRP12"], - "tr_atlas": ["TR88348"], - "webstr_hg38": ["1082178", "4874587"], - "webstr_hg19": ["STR_1441036"], - "locus_tags": ["somatic_instability", "anticipation", "length_affects_onset"], - "disease_tags": ["oculopharyngodistal_myopathy"], - "references": ["pmid:34047774", "pmid:2124290", "omim:164310", "pmid:38467784", "pmid:41131788", "genereviews:NBK535148", "pmid:39013564", "pmid:35245110", "pmid:38876750", "pmid:31332380", "pmid:39349043"], - "additional_literature": ["pmid:41888971", "pmid:41792844", "pmid:41125376", "pmid:40645757", "pmid:40417202", "pmid:40084170", "pmid:38726482", "pmid:37923380", "pmid:37864208", "pmid:37339631", "pmid:36052448", "pmid:35700120", "pmid:35314910", "pmid:35152460", "pmid:35148830", "pmid:34927285", "pmid:33693509", "pmid:33374016", "pmid:33239111", "pmid:32493488", "pmid:27072820"] -}, -{ - "id": "FAME3_MARCHF6", - "disease_id": "FAME3", - "gene": "MARCHF6", - "evidence": ["Definitive"], - "chrom": "chr5", - "start_hg38": 10356343, - "stop_hg38": 10356411, - "start_hg19": 10356455, - "stop_hg19": 10356523, - "start_t2t": 10295525, - "stop_t2t": 10295593, - "disease": "Familial adult myoclonic epilepsy type 3", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical tremor with epilepsy [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Overall FAME prevalence is < 1/35,000; MARCHF6-caused much smaller. Most cases have European ancestry [@pmid:38876750].", - "age_onset": "Typical: 24-41 based on one 76 member pedigree [@pmid:19616813]; Range: 10 [@omim:613608] - 50 [@pmid:40788430].", - "age_onset_min": 10.0, - "age_onset_max": 50.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Healthy controls do not have pathogenic allele (TTTCA), but do have 9-20 benign motifs (TTTTA) [@genereviews:NBK535148]. Total allele size in probands spanned from 650-1035 repeats; an inverse relationship between allele size and age of onset was noted [@pmid:31664039, @pmid:40788430]. In one study it was proposed that pathogenicity only occurs when TTTCA is expanded [@pmid:40788430]. RP-PCR can detect the pathogenic TTTCA insertion motif but does not adequately resolve complex TTTTA/TTTCA architecture [@pmid:41268177].", - "detection": "Long-range PCR followed by long-read sequencing has been used to size and determine structure [@pmid:40200849].", - "mechanism": "Unknown", - "mechanism_detail": "Noted as unknown in literature [@omim:613608].", - "year": "2019 [@pmid:31664039]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["TTTTA"], - "pathogenic_motif_reference_orientation": ["TTTCA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["ATGTT", "TAGTT", "TTTTG", "TTTTT"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["ATGTT", "AGTTT", "GTTTT", "TTTTT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "FXS_FMR1", + "disease_id": "FXS, FXTAS, POF1", + "gene": "FMR1", + "evidence": [ + "Definitive" + ], + "chrom": "chrX", + "start_hg38": 147912049, + "stop_hg38": 147912111, + "start_hg19": 146993567, + "stop_hg19": 146993629, + "start_t2t": 146176677, + "stop_t2t": 146176769, + "disease": "Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1", + "inheritance": [ + "XD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X messenger ribonucleoprotein 1 (FMR1) protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].", + "hpo_terms": null, + "prevalence": "14/100000", + "prevalence_details": "Incidence of full mutation in males 19/100,000; prevalence 14/100,000 [@genereviews:NBK1384]. Female prevalence 9/100,000 [@pmid:24700618]. Known carrier frequency is approximately 300-500/100,000 but detected was 11/100,000 [@pmid:29100084]. FXS prevalence 1:7000 males, 1:11,000 females; FX premutation carriers 1:290-855 males, 1:148-300 females [@isbn:978-3-031-66932-3]. Found worldwide [@genereviews:NBK1384]. In Thailand, 1 in 600 women carry a premutation, and 1 in 400 carry a 'gray zone' allele [@pmid:39320553].", + "age_onset": "Typical: FXS 1 to 'first several years of life', FXTAS 60-65 [@genereviews:NBK1384]; Range: 0 [@url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents] - 78 [@pmid:17427188]; detailed description of typical symptom onset and diagnosis available from Arnold et al [@isbn:978-3-031-66932-3].", + "age_onset_min": 0, + "age_onset_max": 78, + "typ_age_onset_min": 1, + "typ_age_onset_max": 65, + "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108]. Women with the premutation have been reported showing episodic memory deficits, similar to those seen in AD [@pmid:41555826]. AGG interruptions are frequently reported in all associated diseases and appear to stabilize alleles; the length of the longest pure stretch predicts repeat instability [@pmid:7987398]. Elevated POI risk was observed starting at 36 repeats, increasing continuously with repeat length [@pmid:42001465].", + "detection": "Modern PCR techniques detect virtually all FMR1 expansion sizes, while RP-PCR detects AGG interspersions. Southern blotting has been used to approximate size and indicate methylation status [@genereviews:NBK1384]. Long-read sequencing has characterized repeat size, interruptions, methylation, and mosaicism [@pmid:29868108; @pmid:31740840].", + "mechanism": "LoF/GoF", + "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768]. PRKGG appears to modulate neurotoxicity [@pmid:41507195].", + "year": "1992 [@pmid:1605194]; causative gene discovered in 1991 [@pmid:1710175]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CGG" + ], + "pathogenic_motif_reference_orientation": [ + "CGG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "AGG", + "CTG" + ], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AGG", + "CTG" + ], + "locus_structure": [], + "benign_min": 5, + "benign_max": 44, + "intermediate_min": 45, + "intermediate_max": 200, + "pathogenic_min": 201, + "pathogenic_max": 2000, + "motif_len": 3, + "ref_copies": 20.6667, + "novel": "ref", + "gard": [ + "6464", + "16806" + ], + "genereviews": [ + "NBK1384" + ], + "malacard": [ + "FRG001", + "FRG008", + "PRM405" + ], + "medgen": [ + "8912", + "1644269", + "333403" + ], + "mondo": [ + "0010383", + "0010706", + "0010382" + ], + "omim": [ + "300624", + "300623" + ], + "orphanet": [ + "908", + "642691", + "93256" + ], + "gnomad": [ + "FMR1" + ], + "stripy": [ + "FMR1" + ], + "tr_atlas": [ + "TR173944" + ], + "webstr_hg38": [ + "885222" + ], + "webstr_hg19": [ + "Expansion_FXS/FMR1" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "maternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_phenotype", + "length_affects_severity", + "motif_affects_instability" + ], + "disease_tags": [ + "phenotypic_spectrum", + "ataxia" + ], + "references": [ + "genereviews:NBK1384", + "url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents", + "pmid:17427188", + "isbn:978-3-031-66932-3", + "pmid:16205714", + "pmid:36169768", + "pmid:41507195", + "pmid:32463542", + "pmid:29868108", + "pmid:41555826", + "pmid:7987398", + "pmid:42001465", + "pmid:24700618", + "pmid:29100084", + "pmid:39320553", + "pmid:1605194", + "pmid:1710175", + "mondo:0010383", + "mondo:0010706", + "mondo:0010382" + ], + "additional_literature": [ + "pmid:42041789", + "pmid:42001465", + "pmid:41952192", + "pmid:41929501", + "pmid:41917775", + "pmid:41806827", + "pmid:41792844", + "pmid:41777701", + "pmid:41762523", + "pmid:41717020", + "pmid:41672630", + "pmid:41648852", + "pmid:41557506", + "pmid:41523206", + "pmid:41514368", + "pmid:41409170", + "pmid:41386846", + "pmid:41385812", + "pmid:41372183", + "pmid:41351347", + "pmid:41278766", + "pmid:41256123", + "pmid:41167304", + "pmid:41145158", + "pmid:41120736", + "pmid:41098569", + "pmid:41074692", + "pmid:41028987", + "pmid:41015363", + "pmid:40980401", + "pmid:40940631", + "pmid:40877251", + "pmid:40869951", + "pmid:40879637", + "pmid:40778130", + "pmid:40653294", + "pmid:40600017", + "pmid:40534679", + "pmid:40488180", + "pmid:40480633", + "pmid:40459253", + "pmid:40455869", + "pmid:40418066", + "pmid:40417743", + "pmid:40296143", + "pmid:40287634", + "pmid:40244008", + "pmid:40243429", + "pmid:40243408", + "pmid:40220918", + "pmid:40166285", + "pmid:40149430", + "pmid:40141467", + "pmid:40141297", + "pmid:39945490", + "pmid:39934227", + "pmid:39839505", + "pmid:39684429", + "pmid:39654947", + "pmid:39588919", + "pmid:39574643", + "pmid:39553953", + "pmid:39492694", + "pmid:39482338", + "pmid:39488698", + "pmid:39095619", + "pmid:38997701", + "pmid:38961870", + "pmid:38946987", + "pmid:38865241", + "pmid:38772058", + "pmid:38714961", + "pmid:38522837", + "pmid:38412259", + "pmid:38307002", + "pmid:38164622", + "pmid:38162443", + "pmid:38134876", + "pmid:37970883", + "pmid:37936174", + "pmid:37906407", + "pmid:37776526", + "pmid:37745859", + "pmid:37628570", + "pmid:37583466", + "pmid:37551886", + "pmid:37551173", + "pmid:37508562", + "pmid:37364131", + "pmid:37352983", + "pmid:37347418", + "pmid:37333274", + "pmid:37209683", + "pmid:37200782", + "pmid:37146135", + "pmid:37120588", + "pmid:36882476", + "pmid:36816716", + "pmid:36250920", + "pmid:36227727", + "pmid:36012355", + "pmid:35977823", + "pmid:35948990", + "pmid:35904811", + "pmid:35729184", + "pmid:35701103", + "pmid:35681093", + "pmid:35609145", + "pmid:35182509", + "pmid:35152460", + "pmid:35129870", + "pmid:35101584", + "pmid:35072235", + "pmid:35038595", + "pmid:35026985", + "pmid:34938155", + "pmid:34926684", + "pmid:34924936", + "pmid:34880790", + "pmid:34845661", + "pmid:34828275", + "pmid:34738199", + "pmid:34690787", + "pmid:34679478", + "pmid:34646309", + "pmid:34641814", + "pmid:34641644", + "pmid:34542254", + "pmid:34456771", + "pmid:34421690", + "pmid:34372915", + "pmid:34358321", + "pmid:34321326", + "pmid:34296199", + "pmid:34276797", + "pmid:34193467", + "pmid:34153466", + "pmid:34117786", + "pmid:34111553", + "pmid:34077515", + "pmid:34054431", + "pmid:34046842", + "pmid:33998336", + "pmid:33856019", + "pmid:33854084", + "pmid:33772546", + "pmid:33709078", + "pmid:33692361", + "pmid:33642901", + "pmid:33627639", + "pmid:33585555", + "pmid:33523882", + "pmid:33497798", + "pmid:33381520", + "pmid:33374331", + "pmid:33296661", + "pmid:33195422", + "pmid:33181255", + "pmid:33151065", + "pmid:33039683", + "pmid:33008014", + "pmid:33007370", + "pmid:32787884", + "pmid:32716213", + "pmid:32695777", + "pmid:32688058", + "pmid:32589669", + "pmid:32478017", + "pmid:32446918", + "pmid:32281281", + "pmid:32258228", + "pmid:32089525", + "pmid:32066985", + "pmid:32048109", + "pmid:32012997", + "pmid:31991700", + "pmid:31989181", + "pmid:31891607", + "pmid:31887710", + "pmid:31880363", + "pmid:31866572", + "pmid:31804632", + "pmid:31733943", + "pmid:31671347", + "pmid:31665086", + "pmid:31632248", + "pmid:31586346", + "pmid:31566610", + "pmid:31512951", + "pmid:31481131", + "pmid:31468394", + "pmid:31347257", + "pmid:31336350", + "pmid:31332380", + "pmid:31299981", + "pmid:31294106", + "pmid:31264835", + "pmid:31159589", + "pmid:31096929", + "pmid:31026518", + "pmid:30984240", + "pmid:30900173", + "pmid:30847793", + "pmid:30840878", + "pmid:30832215", + "pmid:30808398", + "pmid:30665341", + "pmid:30619448", + "pmid:30606610", + "pmid:30576349", + "pmid:30567555", + "pmid:30566867", + "pmid:30538724", + "pmid:30509972", + "pmid:30396881", + "pmid:30396281", + "pmid:30312299", + "pmid:30311737", + "pmid:30211570", + "pmid:30197656", + "pmid:30173918", + "pmid:30160796", + "pmid:30158855", + "pmid:30147707", + "pmid:30030199", + "pmid:29990673", + "pmid:29981579", + "pmid:29971092", + "pmid:29880767", + "pmid:29844802", + "pmid:29766042", + "pmid:29760651", + "pmid:29379561", + "pmid:29375310", + "pmid:29316893", + "pmid:29275276", + "pmid:29267266", + "pmid:29209628", + "pmid:29188551", + "pmid:28967713", + "pmid:28895261", + "pmid:28829283", + "pmid:28815939", + "pmid:28812997", + "pmid:28697590", + "pmid:28504725", + "pmid:28454580", + "pmid:28391068", + "pmid:28369393", + "pmid:28278294", + "pmid:28233916", + "pmid:28193118", + "pmid:28173181", + "pmid:28103472", + "pmid:28065649", + "pmid:28005950", + "pmid:27883256", + "pmid:27862088", + "pmid:27841182", + "pmid:27841172", + "pmid:27840045", + "pmid:27822316", + "pmid:27816231", + "pmid:27784894", + "pmid:27646161", + "pmid:27768763", + "pmid:27761921", + "pmid:27667322", + "pmid:27616423", + "pmid:27713816", + "pmid:27708271", + "pmid:27696642", + "pmid:27696273", + "pmid:27695335", + "pmid:27540028", + "pmid:27427765", + "pmid:27375073", + "pmid:27372099", + "pmid:27355815", + "pmid:27355445", + "pmid:27335370", + "pmid:27315125", + "pmid:27294193", + "pmid:27066582", + "pmid:27042357", + "pmid:27041225", + "pmid:27001315", + "pmid:26940792", + "pmid:26825750", + "pmid:26743003", + "pmid:26716517", + "pmid:26694146", + "pmid:26554012", + "pmid:26537920", + "pmid:26463479", + "pmid:26440889", + "pmid:26420841", + "pmid:26345686", + "pmid:26322075", + "pmid:26298472", + "pmid:26194536", + "pmid:26099177", + "pmid:26029703", + "pmid:25954027", + "pmid:25953684", + "pmid:25886163", + "pmid:25875842", + "pmid:25788698", + "pmid:25776194", + "pmid:25763861", + "pmid:25726753", + "pmid:25693964", + "pmid:25689687", + "pmid:25606365", + "pmid:25436181", + "pmid:25399540", + "pmid:25366135", + "pmid:25346430", + "pmid:25290064", + "pmid:25278957", + "pmid:25250047", + "pmid:25179629", + "pmid:25171808", + "pmid:25170346", + "pmid:25147555", + "pmid:25110527", + "pmid:25093044", + "pmid:25085749", + "pmid:25013385", + "pmid:24998620", + "pmid:24963073", + "pmid:24958193", + "pmid:24938362", + "pmid:24920338", + "pmid:24912415", + "pmid:24875778", + "pmid:24858908", + "pmid:24821701", + "pmid:24816393", + "pmid:24814676", + "pmid:24787137", + "pmid:24763282", + "pmid:24743386", + "pmid:24718368", + "pmid:24715853", + "pmid:24657592", + "pmid:24654675", + "pmid:24630283", + "pmid:24591415", + "pmid:24578575", + "pmid:24463622", + "pmid:24455203", + "pmid:24448548", + "pmid:24428240", + "pmid:24424424", + "pmid:24401315", + "pmid:24352881", + "pmid:24289922", + "pmid:24261641", + "pmid:24249225", + "pmid:24177047", + "pmid:24130133", + "pmid:23949867", + "pmid:23896050", + "pmid:23792063", + "pmid:23753897", + "pmid:23731704", + "pmid:23719910", + "pmid:23683082", + "pmid:23602499", + "pmid:23574351", + "pmid:23553633", + "pmid:23497562", + "pmid:23478018", + "pmid:23464607", + "pmid:23440729", + "pmid:23250915", + "pmid:23198693", + "pmid:23148490", + "pmid:23146966", + "pmid:23015788", + "pmid:22924671", + "pmid:22918986", + "pmid:22887750", + "pmid:22796595", + "pmid:22707411", + "pmid:22612820", + "pmid:22619118", + "pmid:22581803", + "pmid:22507827", + "pmid:22498846", + "pmid:22489017", + "pmid:22466801", + "pmid:22427040", + "pmid:22393900", + "pmid:22387066", + "pmid:22311273", + "pmid:22251309", + "pmid:22241100", + "pmid:22224633", + "pmid:22223546", + "pmid:22211843", + "pmid:22177572", + "pmid:22161987", + "pmid:22149120", + "pmid:22022567", + "pmid:22004265", + "pmid:21944929", + "pmid:21808616", + "pmid:21807882", + "pmid:21775729", + "pmid:21767618", + "pmid:21720528", + "pmid:21671049", + "pmid:21646280", + "pmid:21636656", + "pmid:21617890", + "pmid:21596781", + "pmid:21572337", + "pmid:21567456", + "pmid:21499798", + "pmid:21476992", + "pmid:21445959", + "pmid:21430544", + "pmid:21389081", + "pmid:21329465", + "pmid:21270637", + "pmid:21267007", + "pmid:21254876", + "pmid:21170301", + "pmid:21051337", + "pmid:20938029", + "pmid:20935171", + "pmid:20858229", + "pmid:20801083", + "pmid:20799337", + "pmid:20736975", + "pmid:20702130", + "pmid:20616364", + "pmid:20431035", + "pmid:20425835", + "pmid:20410144", + "pmid:20364100", + "pmid:20221430", + "pmid:20213777", + "pmid:20168238", + "pmid:20118148", + "pmid:20051238", + "pmid:20011099", + "pmid:20001115", + "pmid:19927162", + "pmid:19846466", + "pmid:19804849", + "pmid:19796183", + "pmid:19778484", + "pmid:19760650", + "pmid:19710035", + "pmid:19684044", + "pmid:19562332", + "pmid:19525339", + "pmid:19514725", + "pmid:19460939", + "pmid:19460937", + "pmid:19440516", + "pmid:19404994", + "pmid:19204162", + "pmid:19097038", + "pmid:19045956", + "pmid:19026394", + "pmid:19014369", + "pmid:18565783", + "pmid:18563710", + "pmid:18553360", + "pmid:18535897", + "pmid:18472227", + "pmid:18428348", + "pmid:18413472", + "pmid:18403614", + "pmid:18384775", + "pmid:18373410", + "pmid:18357616", + "pmid:18310361", + "pmid:18281036", + "pmid:18165971", + "pmid:18165276", + "pmid:18160412", + "pmid:18057320", + "pmid:17724287", + "pmid:17698009", + "pmid:17674408", + "pmid:17635840", + "pmid:17591512", + "pmid:17516099", + "pmid:17442505", + "pmid:17322660", + "pmid:17295053", + "pmid:17279084", + "pmid:17266074", + "pmid:17152065", + "pmid:17150213", + "pmid:17089161", + "pmid:17044853", + "pmid:16780889", + "pmid:16761284", + "pmid:16361284", + "pmid:16337617", + "pmid:16258159", + "pmid:16164596", + "pmid:16047092", + "pmid:15971024", + "pmid:15947063", + "pmid:15876460", + "pmid:15811008", + "pmid:15741991", + "pmid:15659577", + "pmid:15649335", + "pmid:15629215", + "pmid:15483045", + "pmid:15377638", + "pmid:15302914", + "pmid:15068386", + "pmid:14755444", + "pmid:14735162", + "pmid:14722156", + "pmid:14560307", + "pmid:14519687", + "pmid:14517952", + "pmid:12948442", + "pmid:12905066", + "pmid:12853612", + "pmid:12681986", + "pmid:12659659", + "pmid:12634803", + "pmid:12515381", + "pmid:12379314", + "pmid:12232854", + "pmid:12160728", + "pmid:12111644", + "pmid:11992571", + "pmid:11886710", + "pmid:11807410", + "pmid:11551101", + "pmid:11499669", + "pmid:11487573", + "pmid:11410685", + "pmid:11256870", + "pmid:11229516", + "pmid:11142761", + "pmid:11142752", + "pmid:11119302", + "pmid:11097353", + "pmid:11073538", + "pmid:11070156", + "pmid:11005143", + "pmid:10995510", + "pmid:10987654", + "pmid:10941804", + "pmid:10915764", + "pmid:10870330", + "pmid:10855793", + "pmid:10780779", + "pmid:10773084", + "pmid:10710419", + "pmid:10674158", + "pmid:10631132", + "pmid:10587583", + "pmid:10567518", + "pmid:10545610", + "pmid:10521303", + "pmid:10462618", + "pmid:10447261", + "pmid:10445321", + "pmid:10424820", + "pmid:10409756", + "pmid:10369109", + "pmid:10331601", + "pmid:10331600", + "pmid:10204857", + "pmid:9916838", + "pmid:9856500", + "pmid:9811938", + "pmid:9806479", + "pmid:9792200", + "pmid:9761677", + "pmid:9738717", + "pmid:9653650", + "pmid:9624140", + "pmid:9630071", + "pmid:9604772", + "pmid:9603608", + "pmid:9529778", + "pmid:9485421", + "pmid:9514250", + "pmid:9507388", + "pmid:9415473", + "pmid:9437788", + "pmid:9399905", + "pmid:9358013", + "pmid:9341861", + "pmid:9382110", + "pmid:9299309", + "pmid:9279752", + "pmid:9254854", + "pmid:9207038", + "pmid:9201980", + "pmid:9195158", + "pmid:9640603", + "pmid:9131013", + "pmid:8798682", + "pmid:8808600", + "pmid:8792815", + "pmid:8792813", + "pmid:8844091", + "pmid:8844089", + "pmid:8844077", + "pmid:8844068", + "pmid:8844065", + "pmid:8844064", + "pmid:8755928", + "pmid:8698331", + "pmid:8826482", + "pmid:8826479", + "pmid:8725793", + "pmid:8636996", + "pmid:8673086", + "pmid:8664297", + "pmid:8644711", + "pmid:8626781", + "pmid:8872026", + "pmid:8800930", + "pmid:8519769", + "pmid:8634688", + "pmid:7499428", + "pmid:8589687", + "pmid:7581460", + "pmid:8593539", + "pmid:8579216", + "pmid:8559749", + "pmid:7541938", + "pmid:7761473", + "pmid:7758107", + "pmid:7732383", + "pmid:7783163", + "pmid:8750357", + "pmid:7825564", + "pmid:7717734", + "pmid:7881407", + "pmid:7864047", + "pmid:7927336", + "pmid:7849707", + "pmid:8023854", + "pmid:8197163", + "pmid:8162055", + "pmid:8275089", + "pmid:8244331", + "pmid:8237919", + "pmid:7902319", + "pmid:7692601", + "pmid:8242066", + "pmid:8334699", + "pmid:1642231", + "pmid:1605199" + ] + }, { - "motif": "TTTTA", - "count": 12, - "type": "internal_repeat" + "id": "BPES_FOXL2", + "disease_id": "BPES", + "gene": "FOXL2", + "evidence": [ + "Definitive" + ], + "chrom": "chr3", + "start_hg38": 138946019, + "stop_hg38": 138946062, + "start_hg19": 138664861, + "stop_hg19": 138664904, + "start_t2t": 141687011, + "stop_t2t": 141687054, + "disease": "Blepharophimosis, epicanthus inversus, and ptosis", + "inheritance": [ + "AD", + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Blepharophimosis, Ptosis, and Epicanthus Inversus syndrome (BPES) is an ophthalmic disorder characterized by blepharophimosis, ptosis, epicanthus inversus, and telecanthus, that can appear associated with (type I) or without premature ovarian failure (POF) (type II) [@mondo:0007201].", + "hpo_terms": null, + "prevalence": "0.3/50000", + "prevalence_details": "1 in 50,000 births globally for all BPES, with FOXL2 expansions ~30% of pathogenic variants [@genereviews:NBK1441; @genereviews:NBK535148; @pmid:12529855]. Found worldwide, without differences in prevalence based on sex/ethnicity [@genereviews:NBK1441].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": 0, + "typ_age_onset_max": 0, + "details": "14 repeats appears highly constrained in humans: homozygous expansions from 14 polyalanines to 19 leads to disease, which can be limited to isolated palpebral defects [@pmid:15591279]. Heterozygous expansions to 24 polyalanines also lead to disease [@pmid:15591279]. Locus start can differ between catalogs, which can affect genotyping.", + "detection": null, + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyalanine expansion leads to haploinsufficiency, likely due to decreased protein availability due to mislocalization following nuclear inclusion [@genereviews:NBK1441; @pmid:15591279]", + "year": "2003 [@pmid:12529855]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 14, + "benign_max": 14, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 15, + "pathogenic_max": 24, + "motif_len": 3, + "ref_copies": 14, + "novel": "ref", + "gard": [ + "23" + ], + "genereviews": [ + "NBK1441" + ], + "malacard": [ + "BLP046" + ], + "medgen": [ + "66312" + ], + "mondo": [ + "0007201" + ], + "omim": [ + "110100" + ], + "orphanet": [ + "126" + ], + "gnomad": [ + "FOXL2" + ], + "stripy": [ + "FOXL2" + ], + "tr_atlas": [ + "TR36092" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "genereviews:NBK1441", + "pmid:15591279", + "genereviews:NBK535148", + "pmid:12529855", + "mondo:0007201" + ], + "additional_literature": [ + "pmid:22926839", + "pmid:18158309", + "pmid:17089161", + "pmid:7633459" + ] }, { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 650, - "pathogenic_max": 1035, - "motif_len": 5, - "ref_copies": 13.6, - "novel": "novel", - "gard": ["18084"], - "genereviews": ["NBK535148"], - "malacard": ["EPL053"], - "medgen": ["462210"], - "mondo": ["0013322"], - "omim": ["613608"], - "orphanet": ["86814"], - "gnomad": ["MARCHF6"], - "stripy": ["MARCHF6"], - "tr_atlas": ["TR51895"], - "webstr_hg38": ["5994579"], - "webstr_hg19": ["STR_1116660"], - "locus_tags": ["somatic_instability", "motif_affects_onset", "motif_affects_penetrance", "motif_affects_severity"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:19616813", "omim:613608", "pmid:40788430", "genereviews:NBK535148", "pmid:31664039", "pmid:38876750", "pmid:39349043"], - "additional_literature": ["pmid:41268177", "pmid:41219789", "pmid:40417743", "pmid:40200849", "pmid:33040085"] -}, -{ - "id": "CHNG3_MIR7-2", - "disease_id": "CHNG3", - "gene": "MIR7-2", - "evidence": ["Strong"], - "chrom": "chr15", - "start_hg38": 88569433, - "stop_hg38": 88569452, - "start_hg19": 89112664, - "stop_hg19": 89112683, - "start_t2t": 86324038, - "stop_t2t": 86324057, - "disease": "Nongoitrous congenital hypothyroidism-3", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Nongoitrous congenital hypothyroidism-3 (CHNG3) is characterized by infantile-onset clinical and subclinical hypothyroidism associated with a small thyroid gland, high circulating TSH, normal free T4 levels, and normal or mildly increased serum thyroglobulin. Untreated patients or patients who discontinue treatment show a characteristic transition to multinodular goiter (MNG) with age [@omim:609893].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in 12 families, with ancestry including: Irish, White European, French (Normandie), Ashkenazi, French Canadian, Danish/White European, Welsh, Scottish, Italian, British/White European, Italian/Turkish/Lebanese, German/Palestinian, and South Chinese [@pmid:38714868].", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Deletion of one repeat (4 to 3 repeats) found in 10 unrelated families with unsolved disease [@pmid:38714869]; a heterozygous T-to-G transversion in the third repeat can also lead to disease [@pmid:38714868].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Activates a thyroid-specific enhancer [@pmid:38714868; @pmid:38714869].", - "year": "2024 [@pmid:38714869]", - "location_in_gene": "Non-coding", - "gene_strand": "-", - "reference_motif_reference_orientation": ["TTTG"], - "pathogenic_motif_reference_orientation": ["TTTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AAAC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 4, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 3, - "pathogenic_max": 3, - "motif_len": 4, - "ref_copies": null, - "novel": "ref", - "gard": ["1487"], - "genereviews": [], - "malacard": ["HYP355"], - "medgen": ["424853"], - "mondo": ["0012360"], - "omim": ["609893"], - "orphanet": [], - "gnomad": ["PRE-MIR7-2"], - "stripy": [], - "tr_atlas": ["TR192005"], - "webstr_hg38": ["5177365"], - "webstr_hg19": ["STR_492924"], - "locus_tags": ["contraction"], - "disease_tags": [], - "references": ["pmid:38714868", "pmid:38714869", "omim:609893"], - "additional_literature": [] -}, -{ - "id": "ADTKD_MUC1", - "disease_id": "ADTKD", - "gene": "MUC1", - "evidence": ["Definitive"], - "chrom": "chr1", - "start_hg38": 155188505, - "stop_hg38": 155192239, - "start_hg19": 155160981, - "stop_hg19": 155162030, - "start_t2t": 154328121, - "stop_t2t": 154330802, - "disease": "Autosomal dominant tubulointerstitial kidney disease", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function [@mondo:0020726].", - "hpo_terms": null, - "prevalence": "2.5/1000000", - "prevalence_details": "Disease is affected 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease [@genereviews:NBK153723]", - "age_onset": "Age of onset for end-stage renal disease (the only systemic manifestation) ranges from 16 [@pmid:41000883]-70 [@genereviews:NBK153723].", - "age_onset_min": 16.0, - "age_onset_max": 70.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family [@genereviews:NBK535148]. NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif.", - "detection": "This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475]. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40–83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant [@pmid:41285770]. Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants [@genereviews:NBK153723]. Instead, they are commonly detected by a VNTR assay, or resolved with long-read sequencing [@genereviews:NBK153723; @pmid:29520014].", - "mechanism": "GoF", - "mechanism_detail": "Toxic protein product accumulates in kidneys [@genereviews:NBK153723]", - "year": "2013 [@pmid:23396133]", - "location_in_gene": "Coding Exon 2", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG"], - "pathogenic_motif_reference_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA"], - "benign_motif_reference_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA"], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG"], - "benign_motif_gene_orientation": ["ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG"], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": null, - "pathogenic_max": null, - "motif_len": 1, - "ref_copies": null, - "novel": "ref", - "gard": ["7002"], - "genereviews": ["NBK153723"], - "malacard": ["TBL032"], - "medgen": ["358137"], - "mondo": ["0020726"], - "omim": ["174000"], - "orphanet": ["88949"], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:41000883", "genereviews:NBK153723", "genereviews:NBK535148", "pmid:23396133", "pmid:39781475", "doi:10.1101/2025.03.31.646505", "mondo:0020726"], - "additional_literature": ["pmid:41961547", "pmid:41832605", "pmid:41345522", "pmid:40244446", "pmid:39848530", "pmid:39576755", "pmid:39325540", "pmid:39314239", "pmid:38605207", "pmid:37547453", "pmid:37456840", "pmid:37316299", "pmid:35982790", "pmid:35497811", "pmid:34641504", "pmid:34452200", "pmid:33672244", "pmid:33001366", "pmid:32451462", "pmid:32293552", "pmid:31213370", "pmid:30593830", "pmid:29520014", "pmid:29328069", "pmid:29217307", "pmid:29156055", "pmid:29052568", "pmid:28581490", "pmid:28407289", "pmid:27957769", "pmid:27036738", "pmid:27367740", "pmid:27340743", "pmid:27157321", "pmid:26943180", "pmid:26838233", "pmid:26693201", "pmid:26692014", "pmid:26498650", "pmid:25753030", "pmid:24718884", "pmid:24509297", "pmid:24416403", "pmid:24246952", "pmid:24233342", "pmid:23778023", "pmid:23770070", "pmid:23652307", "pmid:23317217", "pmid:23259747", "pmid:22970023", "pmid:21998660", "pmid:21385452", "pmid:20876819", "pmid:20562098", "pmid:20470225", "pmid:21637607", "pmid:19811637", "pmid:19625949", "pmid:19534821", "pmid:18619437", "pmid:18094420", "pmid:18021186", "pmid:17974963", "pmid:17694298", "pmid:17581677", "pmid:17203187", "pmid:17050588", "pmid:16711252", "pmid:16631167", "pmid:16302687", "pmid:16101182", "pmid:15991935", "pmid:15944787", "pmid:15814824", "pmid:15729696", "pmid:15604091", "pmid:15387710", "pmid:15115750", "pmid:15041735", "pmid:14871854", "pmid:14707484", "pmid:12747745", "pmid:12646731", "pmid:12626424", "pmid:12090474", "pmid:11923240", "pmid:11445551", "pmid:11391628", "pmid:11358826", "pmid:11295060", "pmid:11169964", "pmid:10797294", "pmid:10741704", "pmid:10653872", "pmid:10652432", "pmid:10541345", "pmid:10430099", "pmid:10389761", "pmid:10383817", "pmid:10235488", "pmid:10206297", "pmid:10052816", "pmid:10024673", "pmid:10022471", "pmid:9935162", "pmid:9823312", "pmid:9755875", "pmid:9727561", "pmid:9690452", "pmid:9591045", "pmid:9579805", "pmid:9575675", "pmid:9551361", "pmid:9427605", "pmid:9419405", "pmid:8967520", "pmid:8643693", "pmid:7594478", "pmid:8579785", "pmid:8567787", "pmid:8519447", "pmid:7628867", "pmid:7816840", "pmid:7946402", "pmid:7514493", "pmid:7690213", "pmid:7685318"] -}, -{ - "id": "NME_NAXE", - "disease_id": "NME", - "gene": "NAXE", - "evidence": ["Limited"], - "chrom": "chr1", - "start_hg38": 156591765, - "stop_hg38": 156591783, - "start_hg19": 156561557, - "stop_hg19": 156561575, - "start_t2t": 155728131, - "stop_t2t": 155728159, - "disease": "NAXE-related mitochondrial encephalopathy", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Patients with NAXE-related mitochondrial encephalopathy exhibit developmental delay, cognitive regression, altered consciousness, abnormalities in eye movement (including nystagmus), muscle weakness, respiratory failure, seizure, ataxia, and gait disturbance at the age of 1 to 2 years. The disease is characterized by fluctuating symptoms over time, often exacerbated by febrile illness; it is progressive and fatal in the long term [@pmid:39455596].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Single proband found in Japanese cohort [@pmid:39455596].", - "age_onset": "Single repeat expansion case had onset at 13 months, while NAXE-related mitochondrial encephalopathy more generally has predominately infantile onset, extending to 20y or older [@pmid:39455596].", - "age_onset_min": 1.0, - "age_onset_max": 1.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (2-7) alleles established by 484 control alleles and validated with orthogonal databases, while single proband had expansion of ~200 repeats inherited from mother via uniparental disomy [@pmid:39455596]. While the repeat expansion is newly reported, other variants in the NAXE gene have previously been associated with mitochondrial encephalopathy.", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Reduced NAXE expression from expansion in promoter; hypermethylation was detected at and downstream of the repeat sequence in the proband as well as the maternal copy of the expanded allele, which was not present in the maternal normal range allele nor in the controls [@pmid:39455596]", - "year": "2024 [@pmid:39455596]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGGCC"], - "pathogenic_motif_reference_orientation": ["GGGCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCGGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 7, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 200, - "pathogenic_max": 200, - "motif_len": 5, - "ref_copies": null, - "novel": "ref", - "gard": ["17991"], - "genereviews": [], - "malacard": ["ENC069"], - "medgen": ["934642"], - "mondo": ["0020781"], - "omim": ["617186"], - "orphanet": ["555407"], - "gnomad": ["NAXE"], - "stripy": [], - "tr_atlas": ["TR7952"], - "webstr_hg38": ["1184343", "6351240"], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:39455596"], - "additional_literature": ["pmid:41091881"] -}, -{ - "id": "ALS1_NIPA1", - "disease_id": "ALS1", - "gene": "NIPA1", - "evidence": ["Disputed"], - "chrom": "chr15", - "start_hg38": 22786677, - "stop_hg38": 22786703, - "start_hg19": 23086363, - "stop_hg19": 23086389, - "start_t2t": 20458510, - "stop_t2t": 20458536, - "disease": "Amyotrophic lateral sclerosis", - "inheritance": ["AD"], - "association_type": ["Modifier"], - "disease_description": "Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life [@omim:105400].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "2.7-7.4/100,000 for all cases of ALS, NIPA1 + C9orf72 is 0.37% of ALS patients; frequency of NIPA1 expansion in controls is 3.74% [@pmid:31286297]. The NIPA1 expansion is associated with disease globally [@pmid:30342764], but likely unassociated in African probands [@pmid:34179866].", - "age_onset": "Typical: 44-60 [@pmid:26777436]; Range: 25 [@pmid:22378146] - 77 [@pmid:26777436].", - "age_onset_min": 25.0, - "age_onset_max": 77.0, - "typ_age_onset_min": 44.0, - "typ_age_onset_max": 60.0, - "details": "Allelic ranges taken from STRipy based on primary literature [@stripy:NIPA1]. Currently proposed as a modifier for ALS [@pmid:31286297]. Note: the motif for this locus is CGG in hg38 and T2T reference genomes, while in hg19, the motif is the reverse complement CCG because it is on the negative strand. GCA, GCT, and GCC interruptions have been reported [@pmid:40585427].", - "detection": null, - "mechanism": null, - "mechanism_detail": null, - "year": "2019 [@pmid:30342764]", - "location_in_gene": "Coding Exon 1/Intron 1 depending on transcript", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCG"], - "pathogenic_motif_reference_orientation": ["GCG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["GCA", "GCT", "GCC"], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AGC", "CTG", "CCG"], - "locus_structure": [], - "benign_min": 6, - "benign_max": 10, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 11, - "pathogenic_max": 56, - "motif_len": 3, - "ref_copies": 10.7, - "novel": "ref", - "gard": ["5786"], - "genereviews": [], - "malacard": ["FRN044"], - "medgen": ["400169"], - "mondo": ["0007103"], - "omim": ["105400"], - "orphanet": ["282", "803"], - "gnomad": ["NIPA1"], - "stripy": ["NIPA1"], - "tr_atlas": ["TR133649"], - "webstr_hg38": ["5135087"], - "webstr_hg19": [], - "locus_tags": ["proposed_modifier"], - "disease_tags": [], - "references": ["pmid:26777436", "pmid:22378146", "stripy:NIPA1", "pmid:31286297", "pmid:40585427", "pmid:30342764", "pmid:34179866", "omim:105400"], - "additional_literature": ["pmid:41426430", "pmid:38667292", "pmid:37043475", "pmid:35869263", "pmid:33414559", "pmid:32954321", "pmid:24866401", "pmid:21419568", "pmid:11839840", "pmid:10987648", "pmid:9736780"] -}, -{ - "id": "SCA36_NOP56", - "disease_id": "SCA36", - "gene": "NOP56", - "evidence": ["Definitive"], - "chrom": "chr20", - "start_hg38": 2652732, - "stop_hg38": 2652757, - "start_hg19": 2633378, - "stop_hg19": 2633403, - "start_t2t": 2683189, - "stop_t2t": 2683230, - "disease": "Spinocerebellar ataxia type 36", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 36 (SCA36) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1) characterized by gait and limb ataxia, lower limb spasticity, dysarthria, muscle fasciculations, tongue atrophy and hyperreflexia [@mondo:0013594].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Western Japan: 3.6% of all SCA; Costa da Morte region of Spain: 6.3% of all SCA [@pmid:37332636]; US: 0.7% of large undiagnosed ataxia cohort [@pmid:28761930]. Found across ancestries/ethnicities [@omim:614153].", - "age_onset": "Typical: 40-60 [@pmid:25101480]; Range: 28 [@pmid:37810464] - 67 [@pmid:37332636].", - "age_onset_min": 28.0, - "age_onset_max": 67.0, - "typ_age_onset_min": 40.0, - "typ_age_onset_max": 60.0, - "details": "Benign alleles range from 3-14 repeats and pathogenic alleles (650+ repeats) appear fully penetrant; the significance of intermediate alleles has yet to be elucidated [@pmid:25101480]. Interruptions documented: GGCTG, GGCCCTG, GGCCG, and GGCCTTG [@pmid:37051597].", - "detection": "RP-PCR with fragment analysis has been used to detect these expansions [@pmid:21683323]. Long-read sequencing has accurately sized alleles [@pmid:37051597].", - "mechanism": "GoF", - "mechanism_detail": "Toxic protein gain-of-function, RAN translation [@omim:614153].", - "year": "2011 [@pmid:21683323]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGCCTG"], - "pathogenic_motif_reference_orientation": ["GGCCTG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["GGCTG", "GGCCCTG", "GGCCG", "GGCCTT"], - "pathogenic_motif_gene_orientation": ["CCTGGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["CTGGG", "CCCTGGG", "CCGGG", "CCTTGG"], - "locus_structure": [ + "id": "FRDA_FXN", + "disease_id": "FRDA", + "gene": "FXN", + "evidence": [ + "Definitive" + ], + "chrom": "chr9", + "start_hg38": 69037286, + "stop_hg38": 69037304, + "start_hg19": 71652202, + "stop_hg19": 71652220, + "start_t2t": 81210834, + "stop_t2t": 81210861, + "disease": "Friedreich ataxia", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", + "hpo_terms": null, + "prevalence": "1/50000", + "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", + "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", + "age_onset_min": 2, + "age_onset_max": 80, + "typ_age_onset_min": 10, + "typ_age_onset_max": 15, + "details": "96% of FA patients have biallelic GAA expansions in intron 1 (compared to compound heterozygous with another mutation type), in which the reference allele is conventionally 5-33 repeats [@genereviews:NBK1281]. Intermediate alleles (34-55) are associated with premutations, but may lead to disease as exact pathogenicity/penetrance thresholds have not been demarcated [@genereviews:NBK1281]. The expanded repeats can be interrupted with GAAGAG, GAAGGA, or GAAGAAAA sequences, leading to differential phenotypes [@pmid:11748752]. Allele size is correlated with disease severity and inversely correlated to age of onset, and expansions can reach 1700 repeats [@pmid:8815938].", + "detection": "RP-PCR and long-range PCR have been used to detect expansions [@pmid:35595154]. Long-read sequencing has sized large alleles and resolved sequence organization [@pmid:35595154].", + "mechanism": "LoF", + "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", + "year": "1996 [@pmid:8596916]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GAA" + ], + "pathogenic_motif_reference_orientation": [ + "GAA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AAG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "A", + "count": 16, + "type": "flank_repeat" + }, + { + "motif": "GAA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 5, + "benign_max": 33, + "intermediate_min": 34, + "intermediate_max": 55, + "pathogenic_min": 56, + "pathogenic_max": 1700, + "motif_len": 3, + "ref_copies": 6, + "novel": "ref", + "gard": [ + "6468" + ], + "genereviews": [ + "NBK1281" + ], + "malacard": [ + "FRD001" + ], + "medgen": [ + "383962" + ], + "mondo": [ + "0100340" + ], + "omim": [ + "229300" + ], + "orphanet": [ + "95" + ], + "gnomad": [ + "FXN" + ], + "stripy": [ + "FXN" + ], + "tr_atlas": [ + "TR93516" + ], + "webstr_hg38": [ + "1509872" + ], + "webstr_hg19": [], + "locus_tags": [ + "somatic_instability", + "maternal_expansion", + "length_affects_onset", + "length_affects_phenotype", + "motif_affects_instability", + "motif_affects_onset", + "motif_affects_penetrance" + ], + "disease_tags": [ + "ataxia" + ], + "references": [ + "genereviews:NBK1281", + "pmid:16205714", + "pmid:36169768", + "pmid:11748752", + "pmid:8815938", + "omim:229300", + "pmid:29100084", + "pmid:8596916" + ], + "additional_literature": [ + "pmid:42134333", + "pmid:42094143", + "pmid:42018061", + "pmid:41954755", + "pmid:41919005", + "pmid:41890103", + "pmid:41640354", + "pmid:41432640", + "pmid:41426430", + "pmid:41318543", + "pmid:41301739", + "pmid:41278766", + "pmid:41176519", + "pmid:41137390", + "pmid:41074692", + "pmid:41014100", + "pmid:40994821", + "pmid:40970480", + "pmid:40898875", + "pmid:40880907", + "pmid:40507780", + "pmid:40488180", + "pmid:40419681", + "pmid:40404357", + "pmid:40296143", + "pmid:40141365", + "pmid:39812846", + "pmid:39810753", + "pmid:39574782", + "pmid:39571249", + "pmid:39519164", + "pmid:39496895", + "pmid:39324476", + "pmid:39235665", + "pmid:39219417", + "pmid:39062522", + "pmid:38936158", + "pmid:38495102", + "pmid:38484450", + "pmid:38396238", + "pmid:38367363", + "pmid:38352270", + "pmid:38141359", + "pmid:38063871", + "pmid:38014032", + "pmid:37891254", + "pmid:37585105", + "pmid:37006329", + "pmid:36928898", + "pmid:36800320", + "pmid:36780807", + "pmid:36777637", + "pmid:36638893", + "pmid:36635061", + "pmid:36618024", + "pmid:36511872", + "pmid:36369844", + "pmid:36133907", + "pmid:36036008", + "pmid:35850241", + "pmid:35708503", + "pmid:35595154", + "pmid:35301072", + "pmid:35182509", + "pmid:34920960", + "pmid:34849883", + "pmid:34786480", + "pmid:34747814", + "pmid:34687355", + "pmid:34643298", + "pmid:34600502", + "pmid:34408077", + "pmid:34372915", + "pmid:34299126", + "pmid:34214898", + "pmid:33820410", + "pmid:33629768", + "pmid:33624863", + "pmid:33599954", + "pmid:33592237", + "pmid:33529321", + "pmid:33354116", + "pmid:33151022", + "pmid:33028632", + "pmid:32746884", + "pmid:32744307", + "pmid:32717741", + "pmid:32608417", + "pmid:32586831", + "pmid:32582297", + "pmid:32481586", + "pmid:32385683", + "pmid:32291635", + "pmid:31911468", + "pmid:31904895", + "pmid:31877117", + "pmid:31673878", + "pmid:31650522", + "pmid:31446150", + "pmid:31279523", + "pmid:30874991", + "pmid:30828501", + "pmid:30761510", + "pmid:30635474", + "pmid:30596685", + "pmid:30590615", + "pmid:30552117", + "pmid:30519163", + "pmid:30464193", + "pmid:30425621", + "pmid:30358880", + "pmid:30237783", + "pmid:30159187", + "pmid:30097477", + "pmid:30076049", + "pmid:30065630", + "pmid:29666341", + "pmid:29529236", + "pmid:29261783", + "pmid:29125828", + "pmid:29070698", + "pmid:28904984", + "pmid:28812047", + "pmid:28716278", + "pmid:28451558", + "pmid:28282710", + "pmid:28109580", + "pmid:27518705", + "pmid:27668106", + "pmid:27648458", + "pmid:27644330", + "pmid:27522354", + "pmid:27425605", + "pmid:27386501", + "pmid:27228352", + "pmid:27206881", + "pmid:27142428", + "pmid:26906906", + "pmid:26896803", + "pmid:28392990", + "pmid:26704351", + "pmid:26414159", + "pmid:26401053", + "pmid:26393353", + "pmid:26379101", + "pmid:26339677", + "pmid:26338206", + "pmid:26301374", + "pmid:26149656", + "pmid:26099177", + "pmid:25845763", + "pmid:25831023", + "pmid:25814655", + "pmid:25758173", + "pmid:25685137", + "pmid:25681319", + "pmid:25616511", + "pmid:25207996", + "pmid:25198290", + "pmid:25112975", + "pmid:25022367", + "pmid:24971578", + "pmid:24962209", + "pmid:24858524", + "pmid:24819921", + "pmid:24816001", + "pmid:24787137", + "pmid:24714088", + "pmid:24691413", + "pmid:24667739", + "pmid:24665325", + "pmid:24613765", + "pmid:24586819", + "pmid:24455203", + "pmid:24371004", + "pmid:24327207", + "pmid:24209901", + "pmid:24023969", + "pmid:23996585", + "pmid:23943791", + "pmid:23925595", + "pmid:23922695", + "pmid:23879205", + "pmid:23838345", + "pmid:23775342", + "pmid:23691127", + "pmid:23640016", + "pmid:23625326", + "pmid:23474817", + "pmid:23418481", + "pmid:23382970", + "pmid:23280845", + "pmid:25499576", + "pmid:23269675", + "pmid:23242090", + "pmid:23071719", + "pmid:22798143", + "pmid:22787155", + "pmid:22764244", + "pmid:22752483", + "pmid:22691228", + "pmid:22447512", + "pmid:22414340", + "pmid:22409940", + "pmid:22289650", + "pmid:22262734", + "pmid:21830088", + "pmid:21776984", + "pmid:21745819", + "pmid:21652007", + "pmid:21486239", + "pmid:21397024", + "pmid:21181307", + "pmid:21127046", + "pmid:21051337", + "pmid:21040903", + "pmid:20675166", + "pmid:20559546", + "pmid:20506029", + "pmid:20373285", + "pmid:20098685", + "pmid:20090835", + "pmid:19956589", + "pmid:19876374", + "pmid:19733517", + "pmid:19485941", + "pmid:19370769", + "pmid:19259763", + "pmid:19043662", + "pmid:18820300", + "pmid:18697824", + "pmid:18597733", + "pmid:18045775", + "pmid:17703324", + "pmid:17498922", + "pmid:28182935", + "pmid:17262846", + "pmid:17235301", + "pmid:17024371", + "pmid:16989817", + "pmid:16919418", + "pmid:16857735", + "pmid:16764889", + "pmid:16644517", + "pmid:16120311", + "pmid:15376485", + "pmid:15340363", + "pmid:15233994", + "pmid:15201464", + "pmid:15180699", + "pmid:14978261", + "pmid:14962663", + "pmid:12516053", + "pmid:12112211", + "pmid:11939898", + "pmid:11843702", + "pmid:11809170", + "pmid:11428460", + "pmid:11340071", + "pmid:11325966", + "pmid:11240567", + "pmid:11071107", + "pmid:11054139", + "pmid:10982543", + "pmid:10982187", + "pmid:10969848", + "pmid:10896266", + "pmid:10732799", + "pmid:10681084", + "pmid:10556290", + "pmid:10230399", + "pmid:10102712", + "pmid:10077729", + "pmid:9811933", + "pmid:9779809", + "pmid:9737785", + "pmid:9667602", + "pmid:9577387", + "pmid:9443873", + "pmid:9486868", + "pmid:9448568", + "pmid:9416816", + "pmid:9409356", + "pmid:9326946", + "pmid:9339708", + "pmid:9339680", + "pmid:9270667", + "pmid:9270608", + "pmid:9241271", + "pmid:9177790", + "pmid:9153531", + "pmid:9153129", + "pmid:10464657", + "pmid:9331900", + "pmid:8751856" + ] + }, { - "motif": "GGCCTG", - "count": null, - "type": "pathogenic_repeat" + "id": "OPDM2_GIPC1", + "disease_id": "OPDM2", + "gene": "GIPC1", + "evidence": [ + "Definitive" + ], + "chrom": "chr19", + "start_hg38": 14496041, + "stop_hg38": 14496075, + "start_hg19": 14606853, + "stop_hg19": 14606887, + "start_t2t": 14622655, + "stop_t2t": 14622692, + "disease": "Oculopharyngodistal myopathy type 2", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750]; Slowly progressive distal weakness, ophthalmoplegia, facial and bulbar weakness [@pmid:39349043]. Two probands presented with ataxia and mild cognitive impairment [@pmid:41975469].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Population dependent; presumed rare. Predominantly found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 20-34 [@pmid:32413282]; Range: 2 [@pmid:41975469] - 70 [@pmid:33374016].", + "age_onset_min": 2, + "age_onset_max": 70, + "typ_age_onset_min": 20, + "typ_age_onset_max": 34, + "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Findings suggest that alternative initiation sites and an upstream CTG codon serve as the initiation site for RAN translation [@pmid:41121761]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784]. One proband with ataxia and repeat size 11/112 had an asymptomatic father with 650 repeats and higher methylation [@pmid:41975469].", + "detection": "Short-read WGS or exome sequencing have been reported to be inaccurate in detecting these expansions [@pmid:32413282]. RP-PCR has detected most repeats, while long-read sequencing accurately resolved size and structure [@pmid:32413282].", + "mechanism": "LoF/GoF?", + "mechanism_detail": "Findings suggest that the mechanism is likely not LoF, but the mechanism is otherwise unknown [@pmid:41121761]. This expansion appears to be predominantly RAN translated into a toxic protein [@pmid:41121761]. This protein has been reported to impair cell proliferation, induce cytotoxicity and apoptosis in multiple cell lines, and caused phenotypic defects in a zebrafish model [@pmid:41121761].", + "year": "2020 [@pmid:32413282]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CCG" + ], + "pathogenic_motif_reference_orientation": [ + "CCG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 0, + "benign_max": 32, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 73, + "pathogenic_max": 164, + "motif_len": 3, + "ref_copies": 14.7, + "novel": "ref", + "gard": [ + "16397" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "OCL080" + ], + "medgen": [ + "1718769" + ], + "mondo": [ + "0030134" + ], + "omim": [ + "618940" + ], + "orphanet": [], + "gnomad": [ + "GIPC1" + ], + "stripy": [ + "GIPC1" + ], + "tr_atlas": [ + "TR154638" + ], + "webstr_hg38": [ + "5626440" + ], + "webstr_hg19": [ + "STR_668861" + ], + "locus_tags": [ + "length_affects_onset", + "length_affects_severity" + ], + "disease_tags": [ + "oculopharyngodistal_myopathy", + "ataxia" + ], + "references": [ + "pmid:32413282", + "pmid:41975469", + "pmid:33374016", + "pmid:41121761", + "gnomad:GIPC1", + "genereviews:NBK535148", + "pmid:38876750", + "pmid:35245110", + "pmid:38467784", + "pmid:39349043" + ], + "additional_literature": [ + "pmid:42057638", + "pmid:41888971", + "pmid:41792844", + "pmid:41555317", + "pmid:40645757", + "pmid:40084170", + "pmid:39936620", + "pmid:39492694", + "pmid:39418922", + "pmid:39013564", + "pmid:38871700", + "pmid:37923380", + "pmid:37550168", + "pmid:36108428", + "pmid:36055118", + "pmid:35700120", + "pmid:35521937", + "pmid:35314910", + "pmid:35152460", + "pmid:35148830", + "pmid:34927285", + "pmid:33693509", + "pmid:33239111", + "pmid:22521844" + ] }, { - "motif": "CGCCTG", - "count": 3, - "type": "flank_repeat" - }], - "benign_min": 3, - "benign_max": 14, - "intermediate_min": 15, - "intermediate_max": 649, - "pathogenic_min": 650, - "pathogenic_max": 2500, - "motif_len": 6, - "ref_copies": 7.2, - "novel": "ref", - "gard": ["12367"], - "genereviews": ["NBK535148"], - "malacard": ["SPN265"], - "medgen": ["483339"], - "mondo": ["0013594"], - "omim": ["614153"], - "orphanet": ["276198"], - "gnomad": ["NOP56"], - "stripy": ["NOP56"], - "tr_atlas": ["TR157810", "TR157811"], - "webstr_hg38": ["6177296", "890490"], - "webstr_hg19": ["STR_833720"], - "locus_tags": ["somatic_instability", "length_affects_onset", "length_affects_severity"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["pmid:25101480", "pmid:37810464", "pmid:37332636", "omim:614153", "pmid:37051597", "pmid:28761930", "pmid:21683323", "mondo:0013594"], - "additional_literature": ["pmid:42038259", "pmid:41337098", "pmid:41074692", "pmid:40898875", "pmid:40765612", "pmid:40488180", "pmid:40015643", "pmid:40004498", "pmid:38961870", "pmid:38934198", "pmid:38811808", "pmid:38667292", "pmid:38227102", "pmid:36599645", "pmid:36572080", "pmid:36530930", "pmid:35599735", "pmid:35077744", "pmid:34179866", "pmid:33705846", "pmid:32989102", "pmid:32407596", "pmid:32375063", "pmid:32375043", "pmid:32270466", "pmid:31737797", "pmid:30610877", "pmid:30109267", "pmid:29316893", "pmid:29281254", "pmid:28918022", "pmid:27123487", "pmid:26661328", "pmid:25476002", "pmid:24985895", "pmid:24269018", "pmid:22744658", "pmid:22492559"] -}, -{ - "id": "NIID_NOTCH2NLC", - "disease_id": "NIID", - "gene": "NOTCH2NLC", - "evidence": ["Definitive"], - "chrom": "chr1", - "start_hg38": 149390802, - "stop_hg38": 149390842, - "start_hg19": 145209323, - "stop_hg19": 145209354, - "start_t2t": 148519695, - "stop_t2t": 148519738, - "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which can precede neurologic manifestations by decades in one documented case [pmid:41929501]. Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms [@pmid:42058219; @pmid:42005169]. Subclinical peripheral neuropathy has been reported in NOTCH2NLC-related NIID [@pmid:42001002]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.", - "hpo_terms": [], - "prevalence": null, - "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 30-70 [@omim:603472]; Range: 10 [@pmid:37090934] - 78 [@pmid:37305750].", - "age_onset_min": 10.0, - "age_onset_max": 78.0, - "typ_age_onset_min": 30.0, - "typ_age_onset_max": 70.0, - "details": "Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats [@genereviews:NBK535148]. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype [@pmid:39055960; @pmid:39496005]: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders [@pmid:31178126]. Age of onset inversely related to allele size [@pmid:38377026]. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype [@pmid:34718964]. Interruptions documented: GGA, GGG [@pmid:35245110]; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed [@pmid:38467784]. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.", - "detection": "Short-read sequencing is reported to be unreliable for sizing of large or complex expansions [@pmid:34034831]. RP-PCR has screened for expansions [@pmid:37371433], while long-read sequencing has resolved size, structure, and methylation [@pmid:34774111].", - "mechanism": "GoF", - "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation [@pmid:42058219]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@pmid:39920690]. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported [@pmid:41539185]. Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression [@pmid:41942455].", - "year": "2019 [@pmid:31332380]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGC"], - "pathogenic_motif_reference_orientation": ["GGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["GGA", "AGC"], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AGG", "AGC"], - "locus_structure": [], - "benign_min": 7, - "benign_max": 37, - "intermediate_min": 38, - "intermediate_max": 65, - "pathogenic_min": 66, - "pathogenic_max": 517, - "motif_len": 3, - "ref_copies": 13.3, - "novel": "ref", - "gard": ["3971"], - "genereviews": ["NBK535148"], - "malacard": ["NRN008"], - "medgen": ["355075"], - "mondo": ["0011327"], - "omim": ["603472", "619473"], - "orphanet": ["2289"], - "gnomad": ["NOTCH2NLC"], - "stripy": ["NOTCH2NLC"], - "tr_atlas": ["TR7525"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": ["somatic_instability", "paternal_expansion", "length_affects_onset", "length_affects_phenotype", "motif_affects_onset", "motif_affects_phenotype"], - "disease_tags": ["phenotypic_spectrum"], - "references": ["omim:603472", "pmid:37090934", "pmid:37305750", "pmid:36169768", "pmid:38467784", "pmid:42058219", "doi:10.1186/s12964-025-02079-1", "pmid:41539185", "pmid:41942455", "genereviews:NBK535148", "pmid:39055960", "pmid:39496005", "pmid:31178126", "pmid:38377026", "pmid:34718964", "pmid:35245110", "pmid:37371433", "pmid:38876750", "pmid:31332380", "mondo:0011327", "pmid:41929501", "pmid:42005169"], - "additional_literature": ["pmid:42058219", "pmid:42033810", "pmid:42021030", "pmid:42015293", "pmid:42005169", "pmid:41964975", "pmid:41942455", "pmid:41929501", "pmid:41888971", "pmid:41882342", "pmid:41862851", "pmid:41792844", "pmid:41762523", "pmid:41756172", "pmid:41731582", "pmid:41688968", "pmid:41634634", "pmid:41556371", "pmid:41526374", "pmid:41235412", "pmid:41154122", "pmid:41074692", "pmid:40934004", "pmid:40879637", "pmid:40765612", "pmid:40708231", "pmid:40645757", "pmid:40635536", "pmid:40609325", "pmid:40517194", "pmid:40515658", "pmid:40514451", "pmid:40267536", "pmid:40084170", "pmid:39936620", "pmid:39920690", "pmid:39609868", "pmid:39529621", "pmid:39505310", "pmid:39492694", "pmid:39418922", "pmid:39167540", "pmid:39078482", "pmid:38779172", "pmid:38667292", "pmid:38579412", "pmid:38477063", "pmid:38288273", "pmid:38145851", "pmid:37975799", "pmid:37923380", "pmid:37864208", "pmid:37823700", "pmid:37644522", "pmid:37365282", "pmid:37271829", "pmid:37237429", "pmid:37184590", "pmid:37131242", "pmid:37001413", "pmid:36948577", "pmid:36942588", "pmid:36825461", "pmid:36823368", "pmid:36809423", "pmid:36715780", "pmid:36672065", "pmid:36621630", "pmid:36588885", "pmid:36570826", "pmid:36545534", "pmid:36483830", "pmid:36458450", "pmid:36417528", "pmid:36263606", "pmid:36216675", "pmid:36207023", "pmid:36191230", "pmid:36172483", "pmid:36150977", "pmid:36086903", "pmid:36061987", "pmid:36041634", "pmid:36033605", "pmid:35974122", "pmid:35866887", "pmid:35857137", "pmid:35838850", "pmid:35788208", "pmid:35772299", "pmid:35700120", "pmid:35419641", "pmid:35411397", "pmid:35402653", "pmid:35366689", "pmid:35314910", "pmid:35297556", "pmid:35180462", "pmid:35152460", "pmid:35148830", "pmid:35147270", "pmid:34927285", "pmid:34797461", "pmid:34774111", "pmid:34750918", "pmid:34694469", "pmid:34675106", "pmid:34641814", "pmid:34392981", "pmid:34306035", "pmid:34243731", "pmid:34054431", "pmid:34017298", "pmid:33943039", "pmid:33887199", "pmid:33871559", "pmid:33871549", "pmid:33766934", "pmid:33693509", "pmid:33679585", "pmid:33626493", "pmid:33625684", "pmid:33388663", "pmid:33377220", "pmid:33377207", "pmid:33239111", "pmid:33201994", "pmid:33201988", "pmid:33146692", "pmid:33146671", "pmid:33026126", "pmid:33016348", "pmid:32989102", "pmid:32931575", "pmid:32852534", "pmid:32827029", "pmid:32817896", "pmid:32777174", "pmid:32768149", "pmid:32602554", "pmid:32535679", "pmid:32516806", "pmid:32495371", "pmid:32449905", "pmid:32268889", "pmid:32250060", "pmid:32081467", "pmid:32039647", "pmid:31886491", "pmid:31819945", "pmid:31433517", "pmid:31413119", "pmid:31332381"] -}, -{ - "id": "OPML1_NUTM2B-AS1", - "disease_id": "OPML1", - "gene": "NUTM2B-AS1", - "evidence": ["Moderate"], - "chrom": "chr10", - "start_hg38": 79826383, - "stop_hg38": 79826404, - "start_hg19": 81586139, - "stop_hg19": 81586160, - "start_t2t": 80695718, - "stop_t2t": 80695748, - "disease": "Oculopharyngeal myopathy with leukoencephalopathy 1", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Oculopharyngodistal myopathy and white matter abnormalities [@pmid:38876750]; Ptosis, ophthalmoplegia, dysphagia, dysarthria [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Rare, found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "15-40 (only characterized in one family) [@pmid:31332380].", - "age_onset_min": 15.0, - "age_onset_max": 40.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (3-16 repeats) established in 1000 controls, studied alongside pathogenic probands of up to 700 repeats [@pmid:31332380]. Pathogenicity occurs at repeats as short as 161 motifs [@pmid:38159879; @pmid:37923380], while intermediate alleles may correlate to milder phenotypes [@pmid:38159879]. Alt transcript in opposite direction: LOC642361.", - "detection": "RP-PCR has effectively detected these expansions [@pmid:39308795], while long-read sequencing has resolved size and structure [@pmid:38159879].", - "mechanism": "GoF?", - "mechanism_detail": "RNA mediated toxicity hypothesized, overall mechanism unknown [@omim:618637; @pmid:36169768].", - "year": "2019 [@pmid:31332380]", - "location_in_gene": "Exon 1 of lncRNA (noncoding)", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGC"], - "pathogenic_motif_reference_orientation": ["GGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 3, - "benign_max": 16, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 161, - "pathogenic_max": 700, - "motif_len": 3, - "ref_copies": 7.0, - "novel": "ref", - "gard": [], - "genereviews": ["NBK535148"], - "malacard": ["OCL077"], - "medgen": ["1684701"], - "mondo": ["0032843"], - "omim": ["618637"], - "orphanet": [], - "gnomad": ["NUTM2B-AS1"], - "stripy": ["NUTM2B-AS1"], - "tr_atlas": ["TR102881"], - "webstr_hg38": [], - "webstr_hg19": ["STR_173942"], - "locus_tags": ["length_affects_severity", "length_affects_phenotype"], - "disease_tags": [], - "references": ["pmid:31332380", "omim:618637", "pmid:36169768", "pmid:38159879", "pmid:37923380", "pmid:38876750", "pmid:39349043"], - "additional_literature": ["pmid:40645757", "pmid:39308795", "pmid:39176128", "pmid:35152460"] -}, -{ - "id": "OPMD_PABPN1", - "disease_id": "OPMD", - "gene": "PABPN1", - "evidence": ["Definitive"], - "chrom": "chr14", - "start_hg38": 23321472, - "stop_hg38": 23321503, - "start_hg19": 23790681, - "stop_hg19": 23790712, - "start_t2t": 17522488, - "stop_t2t": 17522519, - "disease": "Oculopharyngeal muscular dystrophy", - "inheritance": ["AD", "AR"], - "association_type": ["Mendelian"], - "disease_description": "OPMD is a late-onset neuromuscular disease, characterized by ptosis, dysphagia, and general facial weakness [@omim:164300; @pmid:39349043; @pmid:38876750]. Proximal limb weakness commonly develops later in the disease course [@pmid:42157275].", - "hpo_terms": null, - "prevalence": "1/100000", - "prevalence_details": "1/100,000 (population specific) [@pmid:29100084]. Frequency of (GCN)11 alleles is 1-2% of North America/Europe/Japan [@genereviews:NBK1126]. Disease is significantly enriched in individuals of Jewish Bukharian descent[@pmid:42157275]. Disease is found worldwide, in more than 30 countries [@genereviews:NBK1126].", - "age_onset": "Typical: 40-59 [@pmid:37519616]; Range: 20-79 [@pmid:35112761].", - "age_onset_min": 20.0, - "age_onset_max": 79.0, - "typ_age_onset_min": 40.0, - "typ_age_onset_max": 59.0, - "details": "Disease is caused by a GCN polyalanine expansion in the first exon of PABPN1. Most known patients have (GCG)+, but GCN (any polyalanine) may be pathogenic [@genereviews:NBK1126]. This locus is heterozygous in ~90% of cases (autosomal dominant inheritance), while expansions are biallelic in ~10% of cases (consistent with autosomal recessive inheritance). Disease is generally more severe in cases with two expanded alleles. Age of onset is inverse to allele size, while penetrance and severity increase with allele size [@genereviews:NBK1126]. Mild, late-onset disease can occur in individuals with a (GCN)10(GCN)11 genotype, suggesting variable penetrance [@pmid:28011929]. The definition of this locus differs in the literature with prior work counting exact GCG motifs for a benign size of (GCG)6 [@pmid:9462747], while later resources count GCNs (any alanine codon), widening the region by 4 motifs to a benign size of (GCN)10 [@genereviews:NBK1126; @pmid:39349043]. STRchive is using the GCN definition.", - "detection": "Flanking PCR with fragment analysis has accurately detected expansions [@pmid:27980005]. Heterozygous expansions have been sized by Sanger sequencing. Biallelic expanded variants were assessed using short-read sequencing or PCR fragment analysis.", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyalanine expansions leading to cellular toxicity (loss of function) as well as abnormal aggregation and inefficient protein degradation, which may impact mRNA processing [@genereviews:NBK1126].", - "year": "1998 [@pmid:9462747]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 10, - "intermediate_min": 11, - "intermediate_max": 11, - "pathogenic_min": 12, - "pathogenic_max": 18, - "motif_len": 3, - "ref_copies": 7.0, - "novel": "ref", - "gard": ["7245"], - "genereviews": ["NBK1126"], - "malacard": ["OCL088"], - "medgen": ["1054618"], - "mondo": ["0958176"], - "omim": ["164300"], - "orphanet": ["270"], - "gnomad": ["PABPN1"], - "stripy": ["PABPN1"], - "tr_atlas": ["TR128439"], - "webstr_hg38": ["1442709", "5271481"], - "webstr_hg19": ["Expansion_OPMD/PAPBN1"], - "locus_tags": ["length_affects_onset", "length_affects_severity"], - "disease_tags": [], - "references": ["pmid:37519616", "pmid:35112761", "genereviews:NBK1126", "pmid:28011929", "pmid:9462747", "pmid:39349043", "pmid:29100084", "omim:164300", "pmid:38876750"], - "additional_literature": ["pmid:42196324", "pmid:42157275", "pmid:41764774", "pmid:41676387", "pmid:41587185", "pmid:40594369", "pmid:40552959", "pmid:40220918", "pmid:39113268", "pmid:38165364", "pmid:37698929", "pmid:37559347", "pmid:36790141", "pmid:35859342", "pmid:34927285", "pmid:34225694", "pmid:34047774", "pmid:31294444", "pmid:30455479", "pmid:28361972", "pmid:27980005", "pmid:26428746", "pmid:23793615", "pmid:23399899", "pmid:22519734", "pmid:21742497", "pmid:21647273", "pmid:21602480", "pmid:21316245", "pmid:19641605", "pmid:19101703", "pmid:18481858", "pmid:18367172", "pmid:18343218", "pmid:17138075", "pmid:16648376", "pmid:16642034", "pmid:16481821", "pmid:16378590", "pmid:16239242", "pmid:15811916", "pmid:15755680", "pmid:15725589", "pmid:15645184", "pmid:14627730", "pmid:12673802", "pmid:11712939", "pmid:11304042", "pmid:11222452", "pmid:11150975", "pmid:11087766", "pmid:11003790", "pmid:10734263", "pmid:10680791", "pmid:9084936"] -}, -{ - "id": "CCHS_PHOX2B", - "disease_id": "CCHS", - "gene": "PHOX2B", - "evidence": ["Definitive"], - "chrom": "chr4", - "start_hg38": 41745972, - "stop_hg38": 41746032, - "start_hg19": 41747989, - "stop_hg19": 41748049, - "start_t2t": 41719745, - "stop_t2t": 41719805, - "disease": "Congenital central hypoventilation syndrome", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of the PHOX-2B gene is found in 90% of the patients. Association with Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026]. Hyperinsulinism has been observed in patients [@pmid:41531556].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Incidence is 1:148000-200000 births (Estimated, may include mild/undiagnosed or be overestimated globally) [@genereviews:NBK1427]. Rare, but reported worldwide [@pmid:15121777].", - "age_onset": "Typical: 0-2 [@genereviews:NBK1427; @pmid:15121777]; Range: 0-36 [@pmid:16873766].", - "age_onset_min": 0.0, - "age_onset_max": 36.0, - "typ_age_onset_min": 0.0, - "typ_age_onset_max": 2.0, - "details": "Alleles of 24 repeats (and sometimes 25 repeats) correspond to delayed disease onset and/or milder phenotype; alleles above benign range (9-20 repeats) and below the pathogenic range (26-33 repeats) have uncertain significance [@genereviews:NBK1427].", - "detection": "Short-read sequencing and exome sequencing are reportedly unable to accurately detect these expansions. Fragment analysis is the standard detection method, while Sanger sequencing determines the exact repeat size [@genereviews:NBK1427].", - "mechanism": "LoF/GoF", - "mechanism_detail": "Polyalanine expansion leading to loss or gain of function, dependent on altered protein product [@pmid:38467784; @genereviews:NBK1427]. Correlation between length and reduced transcriptional activity [@pmid:15888479].", - "year": "2003 [@pmid:12640453]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 9, - "benign_max": 20, - "intermediate_min": 21, - "intermediate_max": 25, - "pathogenic_min": 26, - "pathogenic_max": 33, - "motif_len": 3, - "ref_copies": 15.7, - "novel": "ref", - "gard": ["8535"], - "genereviews": ["NBK1427"], - "malacard": ["CNT119"], - "medgen": ["1794285"], - "mondo": ["0800026"], - "omim": ["209880"], - "orphanet": ["661"], - "gnomad": ["PHOX2B"], - "stripy": ["PHOX2B"], - "tr_atlas": ["TR42548"], - "webstr_hg38": ["4725362"], - "webstr_hg19": ["Expansion_CCHS/PHOX2B"], - "locus_tags": ["length_affects_onset", "length_affects_severity"], - "disease_tags": [], - "references": ["genereviews:NBK1427", "pmid:15121777", "pmid:16873766", "pmid:38467784", "pmid:15888479", "pmid:12640453", "mondo:0800026", "pmid:41531556"], - "additional_literature": ["pmid:41420984", "pmid:41188450", "pmid:38467313", "pmid:38454954", "pmid:38431667", "pmid:38001308", "pmid:36394266", "pmid:35421844", "pmid:34626313", "pmid:34012823", "pmid:33958749", "pmid:33855005", "pmid:33047879", "pmid:32822965", "pmid:31950261", "pmid:30786110", "pmid:30672101", "pmid:30227298", "pmid:29058474", "pmid:28992836", "pmid:27485184", "pmid:27129232", "pmid:26378991", "pmid:26375764", "pmid:26063465", "pmid:26011159", "pmid:25975378", "pmid:25085640", "pmid:24442913", "pmid:24135798", "pmid:23460545", "pmid:23460419", "pmid:23103552", "pmid:23045564", "pmid:22922260", "pmid:22829249", "pmid:22821709", "pmid:22437207", "pmid:22278185", "pmid:22125732", "pmid:21373876", "pmid:20236122", "pmid:19881470", "pmid:19608868", "pmid:18798833", "pmid:18157832", "pmid:17928950", "pmid:17909190", "pmid:17045833", "pmid:16888290", "pmid:16258163", "pmid:16249188"] -}, -{ - "id": "MRUPAV_PLIN4", - "disease_id": "MRUPAV", - "gene": "PLIN4", - "evidence": ["Moderate"], - "chrom": "chr19", - "start_hg38": 4510727, - "stop_hg38": 4513659, - "start_hg19": 4510739, - "stop_hg19": 4513671, - "start_t2t": 4494212, - "stop_t2t": 4497342, - "disease": "Myopathy with Rimmed Ubiquitin-Positive Autophagic Vacuolation, PLIN4-Related Myopathy", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Autosomal dominant myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV) is characterized by adult onset of slowly progressive skeletal muscle weakness variably affecting the distal or proximal lower limbs. Some patients may also have upper limb involvement or neck muscle weakness, but respiratory and bulbar involvement only rarely occurs. EMG studies show a myopathic process, and myotonia may also be observed [@omim:601846]. An early characterisation of the disease was reported in Blasi, et al. [@pmid:15236412].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Studied in patients of chinese ancestry and two families of spanish ancestry [@pmid:36151849; @pmid:40693562].", - "age_onset": "22-66 [@pmid:36151849; @pmid:37145156; @pmid:35499779; @pmid:40693562].", - "age_onset_min": 22.0, - "age_onset_max": 66.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "This is an expanded variable number tandem repeat (VNTR) in the PLIN4 gene, located in exon 3. This repeat consists of a 99 bp motif which encodes 33 amino-acids within the perilipin-4 protein [@pmid:32451610]. Expansions of this 99 bp motif lead to insertion of multiple imperfect 33–amino acid repeats. These repetitive sequences are thought to contribute to abnormal protein aggregation and dysregulated autophagy seen in affected muscle tissue [@omim:601846].", - "detection": "Short-read sequencing and exome sequencing are reported to not reliably detect this repeat. Long-range PCR is used for detection, while long-read sequencing is used to fully resolve size and structure [@pmid:32451610; @pmid:33811808].", - "mechanism": "GoF", - "mechanism_detail": "The present disease is characterized by dominantly inherited progressively increasing mobilization of aggrephagy at sites of progressive accumulation of a mutated protein, suggesting that the mutation is leading to aggregation, likely through misfolding, exceeding aggrephagic capacity [@pmid:32451610]", - "year": "2020 [@pmid:32451610]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "-", - "reference_motif_reference_orientation": ["TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC"], - "pathogenic_motif_reference_orientation": ["TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AAAGGAACCATCCAGACCGGCGTGGACACCAGTAAGACTGTCCTAACAGGTACCAAGGACACCGTCTGTAGTGGGGTGACTGGTGCCATGAATGTGGCC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 29, - "benign_max": 31, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 37, - "pathogenic_max": 50, - "motif_len": 99, - "ref_copies": 31.0, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": [], - "medgen": ["355637"], - "mondo": ["0011155"], - "omim": ["601846"], - "orphanet": ["696063"], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": ["anticipation", "length_affects_onset"], - "disease_tags": [], - "references": ["pmid:36151849", "pmid:37145156", "pmid:35499779", "pmid:40693562", "pmid:32451610", "omim:601846", "pmid:15236412"], - "additional_literature": ["pmid:39492694"] -}, -{ - "id": "CPEO_POLG", - "disease_id": "CPEO", - "gene": "POLG", - "evidence": ["Disputed"], - "chrom": "chr15", - "start_hg38": 89333588, - "stop_hg38": 89333629, - "start_hg19": 89876819, - "stop_hg19": 89876860, - "start_t2t": 87088411, - "stop_t2t": 87088452, - "disease": "Progressive external ophthalmoplegia, Parkinson's disease", - "inheritance": [], - "association_type": ["Mendelian", "Risk", "Modifier"], - "disease_description": "sensory ataxic neuropathy, dysarthria, and ophthalmoparesis [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Disease association unclear but largely studied in European cohorts/patients [@omim:258450; @omim:157640].", - "age_onset": "Typical: 57 [@pmid:20399836] - 59 [@pmid:20826197]; Range: 23-87 [@pmid:20399836].", - "age_onset_min": 23.0, - "age_onset_max": 87.0, - "typ_age_onset_min": 57.0, - "typ_age_onset_max": 59.0, - "details": "There is conflicting evidence for the association between this repeat expansion and Parkinson's risk [@pmid:20399836; @pmid:10196696; @pmid:22963882], as well as overall disease significance. May be predisposing factor in earlier age of onset in FRDA patients [@pmid:19043662].", - "detection": null, - "mechanism": null, - "mechanism_detail": null, - "year": null, - "location_in_gene": "Coding Exon 2", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCT"], - "pathogenic_motif_reference_orientation": ["GCT"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "GDPAG_GLS", + "disease_id": "GDPAG", + "gene": "GLS", + "evidence": [ + "Definitive" + ], + "chrom": "chr2", + "start_hg38": 190880872, + "stop_hg38": 190880920, + "start_hg19": 191745598, + "stop_hg19": 191745646, + "start_t2t": 191369982, + "stop_t2t": 191370024, + "disease": "Glutaminase deficiency", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Glutaminase deficiency is characterized by refractory seizures, respiratory failure, brain abnormalities and death in the neonatal period, though milder cases with spastic ataxia-dysarthria have also been reported. This condition is caused by mutations in the glutaminase (GLS) gene [@mondo:0600001].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "As of 2019, only 7 cases total of GLS deficiency, including non-repeat. Identified unrelated patients have been Canadian [@pmid:30970188], Kurdish (Turkey) [@pmid:35913761], and US-American (Northern European/Native American descent) [@pmid:35913761].", + "age_onset": "Early childhood (2-4) [@pmid:30970188; @pmid:35913761].", + "age_onset_min": 2, + "age_onset_max": 4, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Pathogenic range from 3 unrelated probands; benign range inferred from mutation data [@genereviews:NBK535148]. Disease cases can be caused by homozygosity or compound heterozygotes [@omim:618412].", + "detection": "Exome sequencing does not reliably detect these expansions. Short-read sequencing has flagged expanded alleles while RP-PCR has confirmed them. Complex alleles may require optical genome mapping or long-read sequencing to resolve size and structure [@pmid:30970188; @pmid:35913761].", + "mechanism": "LoF", + "mechanism_detail": "Change in histone modification decreases transcription [@omim:618412].", + "year": "2019 [@pmid:30970188]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCA" + ], + "pathogenic_motif_reference_orientation": [ + "GCA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 38, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 680, + "pathogenic_max": 1500, + "motif_len": 3, + "ref_copies": 16, + "novel": "ref", + "gard": [], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "SPS235" + ], + "medgen": [ + "987241" + ], + "mondo": [ + "0600001" + ], + "omim": [ + "618412" + ], + "orphanet": [ + "557056" + ], + "gnomad": [ + "GLS" + ], + "stripy": [ + "GLS" + ], + "tr_atlas": [ + "TR24838" + ], + "webstr_hg38": [ + "333878", + "5494902" + ], + "webstr_hg19": [ + "STR_803303" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:30970188", + "pmid:35913761", + "omim:618412", + "genereviews:NBK535148", + "mondo:0600001" + ], + "additional_literature": [ + "pmid:41501457", + "pmid:40488180", + "pmid:40417743", + "pmid:39699045", + "pmid:39651202", + "pmid:38877099", + "pmid:38871700", + "pmid:38260514", + "pmid:34285061", + "pmid:34013182", + "pmid:33691262", + "pmid:33413375", + "pmid:14510958", + "pmid:7729621" + ] + }, { - "motif": "GCT", - "count": 2, - "type": "flank_repeat" + "id": "aFTLD-U_GOLGA8A", + "disease_id": "aFTLD-U", + "gene": "GOLGA8A", + "evidence": [ + "Provisional" + ], + "chrom": "chr15", + "start_hg38": 34419425, + "stop_hg38": 34419451, + "start_hg19": 34711626, + "stop_hg19": 34711652, + "start_t2t": 32225152, + "stop_t2t": 32225178, + "disease": "Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U)", + "inheritance": [], + "association_type": [ + "Risk" + ], + "disease_description": "A rare subtype of Frontotemporal Lobar Degeneration with FET protein inclusions (FTLD-FET). Categorized clinically by behavioral variant frontotemporal dementia (bvFTD) with TAF15/FUS/EWSR1 positive inclusions. Associated with psychiatric symptoms and frontal/striatal atrophy [@pmid:41820575].", + "hpo_terms": [ + "HP:0002145 Frontotemporal dementia" + ], + "prevalence": null, + "prevalence_details": "FTLD-FET makes up ~5–10% of FTLD, and aFTLD-U is the most common FTLD-FET subtype. Prevalence estimates are challenging because diagnosis typically requires neuropathology at autopsy. Risk haplotypes are enriched in Amish and non-Finnish europeans [@pmid:41820575].", + "age_onset": "Typical: 34-55; Range: 21-72 [@pmid:41820575].", + "age_onset_min": 21, + "age_onset_max": 72, + "typ_age_onset_min": 34, + "typ_age_onset_max": 55, + "details": "Variation in repeat length, motif length, and motif sequence, with long CT-dimer expansions strongly associated with aFTLD-U risk. CCTT and CCCTCT motif expansions have been observed in unaffected individuals. CCCCT repeats were present in one aFTLD-U case. Proposed risk-associated expansions are typically >450 bp with >80% CT content and/or contain >190 CT dimers, though unaffected carriers have also been observed. Although the functional consequence of this repeat remains unknown, its presence in nearly 60% of aFTLD-U cases points to a major role in disease pathogenesis [@pmid:41820575].", + "detection": null, + "mechanism": "Unknown [@pmid:41820575].", + "mechanism_detail": null, + "year": "2026 [@pmid:41820575]", + "location_in_gene": null, + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "TTTC" + ], + "pathogenic_motif_reference_orientation": [ + "CT" + ], + "benign_motif_reference_orientation": [ + "CCTT", + "CCCTCT" + ], + "unknown_motif_reference_orientation": [ + "CCCCT" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AG" + ], + "benign_motif_gene_orientation": [ + "AAGG", + "AGAGGG" + ], + "unknown_motif_gene_orientation": [ + "AGGGG" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "CT", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 190, + "pathogenic_max": 600, + "motif_len": 2, + "ref_copies": 6.75, + "novel": "novel", + "gard": [ + "8436" + ], + "genereviews": [], + "malacard": [ + "FRN066" + ], + "medgen": [ + "83266" + ], + "mondo": [], + "omim": [ + "616180" + ], + "orphanet": [], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [ + "STR_459855" + ], + "locus_tags": [ + "somatic_instability" + ], + "disease_tags": [], + "references": [ + "pmid:41820575" + ], + "additional_literature": [] }, { - "motif": "GTT", - "count": 1, - "type": "flank_repeat" + "id": "HFG_HOXA13-I", + "disease_id": "HFG-I", + "gene": "HOXA13", + "evidence": [ + "Limited" + ], + "chrom": "chr7", + "start_hg38": 27199924, + "stop_hg38": 27199966, + "start_hg19": 27239543, + "stop_hg19": 27239585, + "start_t2t": 27335912, + "stop_t2t": 27335954, + "disease": "Hand-foot-genital syndrome 1", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", + "detection": "PCR amplification of tract I, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short-read sequencing may miss expanded repeats [@genereviews:NBK1423].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", + "year": "2004 [@pmid:15385446]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 14, + "benign_max": 14, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 22, + "motif_len": 3, + "ref_copies": 14, + "novel": "ref", + "gard": [ + "2594" + ], + "genereviews": [ + "NBK1423" + ], + "malacard": [ + "HND004" + ], + "medgen": [ + "331103" + ], + "mondo": [ + "0007698" + ], + "omim": [ + "140000" + ], + "orphanet": [ + "2438" + ], + "gnomad": [ + "HOXA13_1" + ], + "stripy": [ + "HOXA13_1" + ], + "tr_atlas": [ + "TR74138" + ], + "webstr_hg38": [ + "5679832" + ], + "webstr_hg19": [ + "STR_1311037" + ], + "locus_tags": [], + "disease_tags": [ + "hand_foot_genital_syndrome" + ], + "references": [ + "genereviews:NBK1423", + "pmid:15385446", + "pmid:17935235", + "mondo:0007698" + ], + "additional_literature": [ + "pmid:32386547", + "pmid:23532960", + "pmid:19591980", + "pmid:12414828", + "pmid:11543619" + ] }, { - "motif": "GCT", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 10, - "benign_max": 10, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": null, - "pathogenic_max": null, - "motif_len": 3, - "ref_copies": 13.7, - "novel": "ref", - "gard": ["15215", "13174"], - "genereviews": [], - "malacard": ["PRG130", "PRK002"], - "medgen": ["897191", "371919"], - "mondo": ["0009783", "0024528"], - "omim": ["258450", "157640"], - "orphanet": ["520820"], - "gnomad": [], - "stripy": [], - "tr_atlas": ["TR137533"], - "webstr_hg38": ["5177947"], - "webstr_hg19": ["STR_493430"], - "locus_tags": ["proposed_modifier"], - "disease_tags": [], - "references": ["pmid:20399836", "pmid:20826197", "pmid:10196696", "pmid:22963882", "pmid:19043662", "omim:258450", "omim:157640", "pmid:38876750"], - "additional_literature": ["pmid:41009775", "pmid:40844737", "pmid:39812846", "pmid:34600502", "pmid:29029963", "pmid:28444220", "pmid:25767537", "pmid:24491464", "pmid:23912752", "pmid:23493802", "pmid:20803511", "pmid:15694274", "pmid:12036482"] -}, -{ - "id": "SCA12_PPP2R2B", - "disease_id": "SCA12", - "gene": "PPP2R2B", - "evidence": ["Moderate"], - "chrom": "chr5", - "start_hg38": 146878727, - "stop_hg38": 146878759, - "start_hg19": 146258290, - "stop_hg19": 146258322, - "start_t2t": 147414733, - "stop_t2t": 147414780, - "disease": "Spinocerebellar ataxia type 12", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 12 (SCA12) is a very rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by the presence of action tremor associated with relatively mild cerebellar ataxia. Associated pyramidal and extrapyramidal signs and dementia have been reported [@mondo:0011439].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Frequent in India; rare in other populations [@pmid:34711523].", - "age_onset": "Typical: 26-50; Range: 8-62 [@omim:604326; @pmid:42105155].", - "age_onset_min": 8.0, - "age_onset_max": 62.0, - "typ_age_onset_min": 26.0, - "typ_age_onset_max": 50.0, - "details": "Benign range is 6-32 repeats, intermediate range 40-49, and pathogenic range is 51-78 [@pmid:37906407]; intermediate alleles are associated with reduced penetrance [@pmid:11198281].", - "detection": "RP-PCR generally detects expansions, while PCR fragment analysis approximates allele size. Large expansions may require Southern blot confirmation [@pmid:35262663; @pmid:10581021].", - "mechanism": "GoF", - "mechanism_detail": "Polyalanine gain of function associated with RAN translation [@pmid:38467784].", - "year": "1999 [@pmid:10581021]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCT"], - "pathogenic_motif_reference_orientation": ["GCT"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 32, - "intermediate_min": 40, - "intermediate_max": 49, - "pathogenic_min": 51, - "pathogenic_max": 78, - "motif_len": 3, - "ref_copies": 10.7, - "novel": "ref", - "gard": ["10476"], - "genereviews": ["NBK535148"], - "malacard": ["SPN293"], - "medgen": ["347653"], - "mondo": ["0011439"], - "omim": ["604326"], - "orphanet": ["98762"], - "gnomad": ["PPP2R2B"], - "stripy": ["PPP2R2B"], - "tr_atlas": ["TR59714"], - "webstr_hg38": ["985593", "6072892"], - "webstr_hg19": ["Expansion_SCA12/PPP2R2B"], - "locus_tags": ["length_affects_penetrance"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["omim:604326", "pmid:38467784", "pmid:37906407", "pmid:11198281", "pmid:34711523", "pmid:10581021", "mondo:0011439"], - "additional_literature": ["pmid:42105155", "pmid:42038259", "pmid:41788301", "pmid:41762523", "pmid:41691974", "pmid:41612618", "pmid:41074692", "pmid:40488180", "pmid:39565297", "pmid:39469072", "pmid:38961870", "pmid:38798069", "pmid:38711441", "pmid:38227102", "pmid:38058854", "pmid:35531119", "pmid:33502644", "pmid:32675418", "pmid:32124191", "pmid:30130680", "pmid:29057148", "pmid:27864267", "pmid:26340331", "pmid:26077168", "pmid:25634432", "pmid:25586539", "pmid:25274186", "pmid:24269018", "pmid:21029765", "pmid:20937954", "pmid:20533062", "pmid:18940801", "pmid:18484086", "pmid:17961920", "pmid:16054804", "pmid:11171892"] -}, -{ - "id": "HSAN-VIII_PRDM12", - "disease_id": "HSAN VIII", - "gene": "PRDM12", - "evidence": ["Moderate"], - "chrom": "chr9", - "start_hg38": 130681605, - "stop_hg38": 130681641, - "start_hg19": 133556992, - "stop_hg19": 133557028, - "start_t2t": 142886568, - "stop_t2t": 142886595, - "disease": "Hereditary sensory and autonomic neuropathy type VIII", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "A hereditary sensory neuropathy characterized by congenital insensitivity to pain and decreased sweating and tear production that has material basis in homozygous mutation in the PRDM12 gene on chromosome 9q34 [@mondo:0014662].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Expansions found in 2 families from Pakistan and Saudi Arabia [@pmid:26005867]. All PRDM12 disease mutations < 1/1,000,000", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Pathogenic expansion found in 2 families, from whom pathogenic range (18-19) is inferred [@pmid:26005867]. Benign range (7-14) inferred from Human Gene Mutation Database [@genereviews:NBK535148].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Mutations abrogate the histone-modifying potential of PRDM12, consistent with a loss of function mechanism [@omim:616488].", - "year": "2015 [@pmid:26005867]", - "location_in_gene": "Coding Exon 5", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 7, - "benign_max": 14, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 18, - "pathogenic_max": 19, - "motif_len": 3, - "ref_copies": 12.0, - "novel": "ref", - "gard": ["17866"], - "genereviews": ["NBK535148"], - "malacard": ["NRP044"], - "medgen": ["894363"], - "mondo": ["0014662"], - "omim": ["616488"], - "orphanet": ["478664"], - "gnomad": ["PRDM12"], - "stripy": ["PRDM12"], - "tr_atlas": ["TR97506"], - "webstr_hg38": ["1543400"], - "webstr_hg19": ["STR_1521945"], - "locus_tags": [], - "disease_tags": [], - "references": ["omim:616488", "pmid:26005867", "genereviews:NBK535148", "mondo:0014662"], - "additional_literature": ["pmid:41630927"] -}, -{ - "id": "CJD_PRNP", - "disease_id": "CJD", - "gene": "PRNP", - "evidence": ["Moderate"], - "chrom": "chr20", - "start_hg38": 4699397, - "stop_hg38": 4699493, - "start_hg19": 4680043, - "stop_hg19": 4680139, - "start_t2t": 4738633, - "stop_t2t": 4738705, - "disease": "Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Schneiker syndrome (GSS) are a rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus [@genereviews:NBK1229]. These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat [@doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "<0.0225/1,000,000: <15% of CJ variants are repeat expansions [@genereviews:NBK535148]. 15% newly diagnosed prion disease cases are genetic [@genereviews:NBK1229], 1 individual per million per year worldwide (350 cases annually in US) [@pmid:29939637]. Found worldwide [@genereviews:NBK1229].", - "age_onset": "Typical: 50-60 [@genereviews:NBK1229]; Range: 31-63 [@pmid:37379724].", - "age_onset_min": 31.0, - "age_onset_max": 63.0, - "typ_age_onset_min": 50.0, - "typ_age_onset_max": 60.0, - "details": "Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln; any additional repeat leads to pathogenicity, with the largest repeat observed 16 motifs [@genereviews:NBK1229]. Insertion length may correspond to phenotype, such as CJD versus frontotemporal dementia [@pmid:36977684].", - "detection": null, - "mechanism": "LoF?", - "mechanism_detail": "Loss of function hypothesized [@pmid:38467784]", - "year": "1991 [@pmid:1683708]", - "location_in_gene": "Coding Exon 2", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGTGGTGGCTGGGGGCAGCCTCAT"], - "pathogenic_motif_reference_orientation": ["CCTCATGGTGGTGGCTGGGGGCAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGCCTCATGGTGGTGGCTGGGGGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "HFG_HOXA13-II", + "disease_id": "HFG-II", + "gene": "HOXA13", + "evidence": [ + "Limited" + ], + "chrom": "chr7", + "start_hg38": 27199825, + "stop_hg38": 27199861, + "start_hg19": 27239444, + "stop_hg19": 27239480, + "start_t2t": 27335813, + "stop_t2t": 27335849, + "disease": "Hand-foot-genital syndrome 2", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", + "detection": "PCR amplification of tract II, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", + "year": "2003 [@pmid:12676922]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 12, + "benign_max": 12, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 18, + "pathogenic_max": 18, + "motif_len": 3, + "ref_copies": 12, + "novel": "ref", + "gard": [ + "2594" + ], + "genereviews": [ + "NBK1423" + ], + "malacard": [ + "HND004" + ], + "medgen": [ + "331103" + ], + "mondo": [ + "0007698" + ], + "omim": [ + "140000" + ], + "orphanet": [ + "2438" + ], + "gnomad": [ + "HOXA13_2" + ], + "stripy": [ + "HOXA13_2" + ], + "tr_atlas": [ + "TR74137" + ], + "webstr_hg38": [ + "5679831" + ], + "webstr_hg19": [ + "STR_1311036" + ], + "locus_tags": [], + "disease_tags": [ + "hand_foot_genital_syndrome" + ], + "references": [ + "genereviews:NBK1423", + "pmid:15385446", + "pmid:17935235", + "pmid:12676922", + "mondo:0007698" + ], + "additional_literature": [ + "pmid:32386547", + "pmid:23532960", + "pmid:19591980", + "pmid:12414828", + "pmid:11543619" + ] + }, { - "motif": "CCTCAGGGCGGTGGTGGCTGGGGGCAG", - "count": 1, - "type": "flank_repeat" + "id": "HFG_HOXA13-III", + "disease_id": "HFG-III", + "gene": "HOXA13", + "evidence": [ + "Limited" + ], + "chrom": "chr7", + "start_hg38": 27199678, + "stop_hg38": 27199732, + "start_hg19": 27239297, + "stop_hg19": 27239351, + "start_t2t": 27335684, + "stop_t2t": 27335720, + "disease": "Hand-foot-genital syndrome 3", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Anticipation does not occur, and expansions appear fully penetrant; it is unknown if contractions also lead to phenotypic variation [@genereviews:NBK1423].", + "detection": "PCR amplification of tract III, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", + "year": "2000 [@pmid:10839976]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 8, + "benign_max": 18, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 32, + "motif_len": 3, + "ref_copies": 18, + "novel": "ref", + "gard": [ + "2594" + ], + "genereviews": [ + "NBK1423" + ], + "malacard": [ + "HND004" + ], + "medgen": [ + "331103" + ], + "mondo": [ + "0007698" + ], + "omim": [ + "140000" + ], + "orphanet": [ + "2438" + ], + "gnomad": [ + "HOXA13_3" + ], + "stripy": [ + "HOXA13_3" + ], + "tr_atlas": [ + "TR74136" + ], + "webstr_hg38": [ + "1365344" + ], + "webstr_hg19": [ + "STR_1311035" + ], + "locus_tags": [], + "disease_tags": [ + "hand_foot_genital_syndrome" + ], + "references": [ + "genereviews:NBK1423", + "pmid:15385446", + "pmid:17935235", + "pmid:10839976", + "mondo:0007698" + ], + "additional_literature": [ + "pmid:32386547", + "pmid:23532960", + "pmid:19591980", + "pmid:12414828", + "pmid:11543619" + ] }, { - "motif": "CCTCATGGTGGTGGCTGGGGGCAG", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 4, - "benign_max": 4, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 5, - "pathogenic_max": 16, - "motif_len": 24, - "ref_copies": null, - "novel": "ref", - "gard": ["17307"], - "genereviews": ["NBK1229"], - "malacard": ["CRT072"], - "medgen": ["155837"], - "mondo": ["0007403"], - "omim": ["123400"], - "orphanet": ["282166"], - "gnomad": ["PRNP"], - "stripy": [], - "tr_atlas": ["TR157963", "TR157964"], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": ["length_affects_phenotype"], - "disease_tags": [], - "references": ["genereviews:NBK1229", "pmid:37379724", "pmid:38467784", "pmid:36977684", "genereviews:NBK535148", "pmid:29939637", "pmid:1683708", "doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1"], - "additional_literature": ["pmid:41890154", "pmid:41009775", "pmid:40803449", "pmid:39256877", "pmid:35926480", "pmid:35903139", "pmid:35752680", "pmid:35585119", "pmid:33131137", "pmid:31795947", "pmid:31127772", "pmid:30777654", "pmid:30530974", "pmid:29966485", "pmid:28003435", "pmid:27400454", "pmid:25239657", "pmid:23998997", "pmid:21686668", "pmid:19092329", "pmid:18397498", "pmid:18366654", "pmid:17709704", "pmid:16858508", "pmid:14729275", "pmid:12805114", "pmid:12451210", "pmid:11593450", "pmid:10611945", "pmid:9710033", "pmid:9565627", "pmid:8030952"] -}, -{ - "id": "FAME8_RAI1", - "disease_id": "FAME8", - "gene": "RAI1", - "evidence": ["Limited"], - "chrom": "chr17", - "start_hg38": 17808358, - "stop_hg38": 17808460, - "start_hg19": 17711672, - "stop_hg19": 17711774, - "start_t2t": 17754961, - "stop_t2t": 17755053, - "disease": "Familial adult myoclonic epilepsy type 8", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Observed in a single family from Mali with ten affected individuals [@pmid:37994247].", - "age_onset": "7-68 (one family)", - "age_onset_min": 7.0, - "age_onset_max": 68.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1 gene that co-segregated with disease status in a single large family from Mali [@pmid:37994247]. Ten affected individuals were studied. Both TTTTA and TTTCA motifs were observed in all eight of the affected individuals with spanning reads, with allele sizes in the range: (TTTTA)278-773(TTTCA)9-334. A single individual was observed with additional motifs and interruptions in one allele with the structure: (TTTTA)exp(GGGGT)ins(GGGAT)ins(TTTCA)ins. TTTCA repeats were absent in 200 Malian controls, who had alleles in the range: (TTTCA)16-20. Reviewed in [@pmid:38876750]. It is uncertain if expansions at both the TTTTA and TTTCA motifs, or only the TTTCA motif are required for pathogenicity. The pathogenic range in STRchive is for the TTTCA motif only. Note: locus is partially deleted in T2T reference genome.", - "detection": null, - "mechanism": "Unknown", - "mechanism_detail": "Expression isn't changed [@pmid:7994247].", - "year": "2024 [@pmid:37994247]", - "location_in_gene": "Intron 4", - "gene_strand": "+", - "reference_motif_reference_orientation": ["TTTTA"], - "pathogenic_motif_reference_orientation": ["TTTCA"], - "benign_motif_reference_orientation": ["TTTTA"], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["GGGGT", "GGGAT"], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": ["ATTTT"], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["GGGGT", "ATGGG"], - "locus_structure": [ + "id": "SD5_HOXD13", + "disease_id": "SD5", + "gene": "HOXD13", + "evidence": [ + "Definitive" + ], + "chrom": "chr2", + "start_hg38": 176093058, + "stop_hg38": 176093103, + "start_hg19": 176957786, + "stop_hg19": 176957831, + "start_t2t": 176581179, + "stop_t2t": 176581224, + "disease": "Syndactyly", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Synpolydactyly (SPD), or syndactyly type II, is defined as a connection between the middle and ring fingers and fourth and fifth toes, variably associated with postaxial polydactyly in the same digits. Minor local anomalies and various metacarpal or metatarsal abnormalities may be present [@omim:186000].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Syndactyly is found across dozens of unrelated families worldwide [@pmid:24038517]. However, syndactyly-5 specific to STR expansion has been found in 3 individuals [@genereviews:NBK535148].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign alleles are highly conserved to be 15 repeats, with disease observed in individuals with 22-23 repeats [@pmid:8614804; @pmid:22406499] as well as in individuals with 8-11 repeats [@genereviews:NBK535148].", + "detection": "Targeted PCR across exon 1 has detected expansions, and subcloning with Sanger sequencing has characterized them [@pmid:9223304].", + "mechanism": "GoF", + "mechanism_detail": "Polyalanine expansion leading to GoF [@pmid:38467784]", + "year": "1996 [@pmid:8614804]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 23, + "motif_len": 3, + "ref_copies": 14, + "novel": "ref", + "gard": [ + "17358" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "SYN084" + ], + "medgen": [ + "1809573" + ], + "mondo": [ + "0008513" + ], + "omim": [ + "186000" + ], + "orphanet": [ + "295195" + ], + "gnomad": [ + "HOXD13" + ], + "stripy": [ + "HOXD13" + ], + "tr_atlas": [ + "TR24032" + ], + "webstr_hg38": [ + "5486677" + ], + "webstr_hg19": [ + "STR_796395" + ], + "locus_tags": [ + "contraction" + ], + "disease_tags": [], + "references": [ + "pmid:38467784", + "pmid:8614804", + "pmid:22406499", + "genereviews:NBK535148", + "pmid:24038517", + "omim:186000" + ], + "additional_literature": [ + "pmid:34159400", + "pmid:32652111", + "pmid:32386547", + "pmid:19841179", + "pmid:19546318", + "pmid:17935235", + "pmid:12414828", + "pmid:12116248", + "pmid:11543619" + ] + }, { - "motif": "TTTTA", - "count": 18, - "type": "internal_repeat" + "id": "HD_HTT", + "disease_id": "HD", + "gene": "HTT", + "evidence": [ + "Definitive" + ], + "chrom": "chr4", + "start_hg38": 3074876, + "stop_hg38": 3074933, + "start_hg19": 3076603, + "stop_hg19": 3076660, + "start_t2t": 3073603, + "stop_t2t": 3073687, + "disease": "Huntington disease", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian", + "Risk" + ], + "disease_description": "Huntington disease (HD) is a rare neurodegenerative disorder of the central nervous system characterized by unwanted choreatic movements, behavioral and psychiatric disturbances and dementia [@mondo:0007739].", + "hpo_terms": null, + "prevalence": "1/10000", + "prevalence_details": "6.5-15/100,000 [@pmid:29100084]. 9.71-17:100,000 (European) vs. 0.1-2/100,000 (African), as many as 1 in 400 have reduced penetrance (0.2-2% for 36-38 CAG) HTT alleles [@genereviews:NBK1305]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1305].", + "age_onset": "Typical: 35-44 [@genereviews:NBK1305]; Range: 1-85 [@pmid:39441074; @pmid:21171977].", + "age_onset_min": 1, + "age_onset_max": 85, + "typ_age_onset_min": 35, + "typ_age_onset_max": 44, + "details": "27-35 motifs are unstable/premutations, while 36-39 motifs are associated with reduced penetrance and mild phenotypes [@pmid:39572770], and alleles over 40 repeats are typically fully penetrant [@genereviews:NBK1305]. >60 motifs associated with onset age <20 years [@genereviews:NBK1305]. Only CAG expansions are considered pathogenic, but interruptions impact pathogenicity (CAA) [@pmid:35245110; @pmid:39673793]. Only fathers with premutations are considered at risk of transmitting pathogenic alleles [@pmid:19507258]. CAG repeat size 21-35 may continuously modulate brain structure and psychiatric disease risk in an age-dependent manner [@pmid:39572770] [@doi:https://doi.org/10.64898/2026.05.08.26352223]. Somatic expansion of HTT CAG repeats in vulnerable tissues is proposed to contribute to age-dependent onset and neurodegeneration, with greater repeat instability associated with earlier disease onset [@pmid:41926793; @pmid:39824182]. Undiagnosed carriers of premutation and pathogenic HTT expansions, exhibit reduced striatal brain volumes and elevated neurofilament light chain levels before clinical diagnosis, consistent with findings observed across other loci [@pmid:41951733].", + "detection": "PCR methods have reliably detected expansions up to ~115 repeats, but very large expansions may require Southern blotting [@genereviews:NBK1305]. Long-read sequencing has resolved interruptions and validated sizing [@pmid:41512049].", + "mechanism": "GoF/LoF", + "mechanism_detail": "While the primary pathogenic mechanism is gain of function of the protein product, pathogenesis is complex and multifactorial [@pmid:27940602]. Reduced SCN4B expression in striatal neurons has been implicated as a modifier of HD-associated phenotype severity, potentially contributing to dysfunction in motor associated striatal neuronal populations [@pmid:41959367].", + "year": "1993 [@pmid:8458085]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "CAA" + ], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AAC" + ], + "locus_structure": [ + { + "motif": "CAG", + "count": null, + "type": "pathogenic_repeat" + }, + { + "motif": "CAACAG", + "count": 1, + "type": "interruption" + }, + { + "motif": "CCG", + "count": 12, + "type": "flank_repeat" + } + ], + "benign_min": 6, + "benign_max": 26, + "intermediate_min": 27, + "intermediate_max": 35, + "pathogenic_min": 36, + "pathogenic_max": 250, + "motif_len": 3, + "ref_copies": 21.3, + "novel": "ref", + "gard": [ + "6677" + ], + "genereviews": [ + "NBK1305" + ], + "malacard": [ + "HNT016" + ], + "medgen": [ + "5654" + ], + "mondo": [ + "0007739" + ], + "omim": [ + "143100" + ], + "orphanet": [ + "399" + ], + "gnomad": [ + "HTT" + ], + "stripy": [ + "HTT" + ], + "tr_atlas": [ + "TR40017", + "TR40018" + ], + "webstr_hg38": [ + "4701738", + "86468", + "86467" + ], + "webstr_hg19": [ + "Expansion_HD/HTT" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_phenotype", + "length_affects_severity", + "motif_affects_instability", + "motif_affects_onset", + "motif_affects_penetrance", + "proposed_modifier" + ], + "disease_tags": [], + "references": [ + "genereviews:NBK1305", + "pmid:39441074", + "pmid:21171977", + "pmid:27940602", + "pmid:41959367", + "pmid:39572770", + "pmid:35245110", + "pmid:39673793", + "pmid:19507258", + "doi:https://doi.org/10.64898/2026.05.08.26352223", + "pmid:41926793", + "pmid:39824182", + "pmid:41951733", + "pmid:29100084", + "pmid:8458085", + "mondo:0007739" + ], + "additional_literature": [ + "pmid:42210302", + "pmid:42202221", + "pmid:42196324", + "pmid:42185880", + "pmid:42183198", + "pmid:42182232", + "pmid:42181265", + "pmid:42152675", + "pmid:42109206", + "pmid:42091595", + "pmid:42007924", + "pmid:41957010", + "pmid:41916314", + "pmid:41906693", + "pmid:41884622", + "pmid:41883719", + "pmid:41850723", + "pmid:41849610", + "pmid:41849583", + "pmid:41841355", + "pmid:41838909", + "pmid:41828602", + "pmid:41786746", + "pmid:41770933", + "pmid:41762523", + "pmid:41741274", + "pmid:41736717", + "pmid:41736445", + "pmid:41697960", + "pmid:41640354", + "pmid:41622913", + "pmid:41620818", + "pmid:41612618", + "pmid:41557250", + "pmid:41545439", + "pmid:41520110", + "pmid:41462929", + "pmid:41427302", + "pmid:41426430", + "pmid:41424860", + "pmid:41418088", + "pmid:41389205", + "pmid:41361856", + "pmid:41358280", + "pmid:41346861", + "pmid:41332649", + "pmid:41279265", + "pmid:41256123", + "pmid:41254939", + "pmid:41240184", + "pmid:41239019", + "pmid:41147028", + "pmid:41139934", + "pmid:41126427", + "pmid:41095675", + "pmid:41095094", + "pmid:41084658", + "pmid:41074680", + "pmid:41030958", + "pmid:41003760", + "pmid:40985165", + "pmid:40945646", + "pmid:40926977", + "pmid:40905034", + "pmid:40898018", + "pmid:40844528", + "pmid:40838126", + "pmid:40801627", + "pmid:40796049", + "pmid:40791503", + "pmid:40777434", + "pmid:40777236", + "pmid:40752726", + "pmid:40748251", + "pmid:40748199", + "pmid:40746751", + "pmid:40702881", + "pmid:40702852", + "pmid:40667291", + "pmid:40662609", + "pmid:40643497", + "pmid:40626527", + "pmid:40620227", + "pmid:40585812", + "pmid:40563832", + "pmid:40560365", + "pmid:40559333", + "pmid:40546037", + "pmid:40520366", + "pmid:40501897", + "pmid:40501854", + "pmid:40490511", + "pmid:40450087", + "pmid:40443124", + "pmid:40429681", + "pmid:40426848", + "pmid:40419681", + "pmid:40417743", + "pmid:40369544", + "pmid:40330856", + "pmid:40319093", + "pmid:40300581", + "pmid:40267238", + "pmid:40258535", + "pmid:40221975", + "pmid:40161725", + "pmid:40081335", + "pmid:40060574", + "pmid:40055280", + "pmid:40040448", + "pmid:40004498", + "pmid:40002561", + "pmid:39984289", + "pmid:39973385", + "pmid:39938516", + "pmid:39937881", + "pmid:39923663", + "pmid:39897579", + "pmid:39849121", + "pmid:39843658", + "pmid:39825149", + "pmid:39812810", + "pmid:39803497", + "pmid:39801710", + "pmid:39772743", + "pmid:39768315", + "pmid:39763784", + "pmid:39762660", + "pmid:39713241", + "pmid:39669608", + "pmid:39666103", + "pmid:39662690", + "pmid:39651202", + "pmid:39627841", + "pmid:39621338", + "pmid:39617003", + "pmid:39614274", + "pmid:39592326", + "pmid:39574844", + "pmid:39473968", + "pmid:39457479", + "pmid:39331414", + "pmid:39309355", + "pmid:39298485", + "pmid:39270726", + "pmid:39250876", + "pmid:39242198", + "pmid:39229124", + "pmid:39185703", + "pmid:39155290", + "pmid:39155061", + "pmid:39153206", + "pmid:39115048", + "pmid:39112488", + "pmid:39096606", + "pmid:39026894", + "pmid:39023561", + "pmid:38977715", + "pmid:38974999", + "pmid:38948755", + "pmid:38931834", + "pmid:38897956", + "pmid:38895438", + "pmid:38869243", + "pmid:38841617", + "pmid:38803421", + "pmid:38786052", + "pmid:38774633", + "pmid:38749429", + "pmid:38744826", + "pmid:38734203", + "pmid:38660915", + "pmid:38627751", + "pmid:38609352", + "pmid:38595854", + "pmid:38585669", + "pmid:38544341", + "pmid:38459427", + "pmid:38449714", + "pmid:38418081", + "pmid:38416505", + "pmid:38383663", + "pmid:38379425", + "pmid:38352602", + "pmid:38291334", + "pmid:38280392", + "pmid:38267530", + "pmid:38237588", + "pmid:38195181", + "pmid:38137557", + "pmid:38092667", + "pmid:38035176", + "pmid:38007671", + "pmid:38003344", + "pmid:37993517", + "pmid:37992538", + "pmid:37961595", + "pmid:37961108", + "pmid:37855597", + "pmid:37840138", + "pmid:37831730", + "pmid:37830620", + "pmid:37827155", + "pmid:37761940", + "pmid:37751638", + "pmid:37745577", + "pmid:37744022", + "pmid:37727506", + "pmid:37716514", + "pmid:37700320", + "pmid:37582307", + "pmid:37547003", + "pmid:37535888", + "pmid:37501188", + "pmid:37481821", + "pmid:37407555", + "pmid:37379724", + "pmid:37333326", + "pmid:37315918", + "pmid:37315450", + "pmid:37306313", + "pmid:37302585", + "pmid:37288993", + "pmid:37231148", + "pmid:37199581", + "pmid:37177784", + "pmid:37162872", + "pmid:37148558", + "pmid:37146135", + "pmid:37117485", + "pmid:37005488", + "pmid:36994811", + "pmid:36958627", + "pmid:36902304", + "pmid:36839842", + "pmid:36825038", + "pmid:36797418", + "pmid:36793800", + "pmid:36711022", + "pmid:36691277", + "pmid:36658243", + "pmid:36599645", + "pmid:36599142", + "pmid:36585400", + "pmid:36550260", + "pmid:36458209", + "pmid:36427954", + "pmid:36352624", + "pmid:36344508", + "pmid:36335527", + "pmid:36335491", + "pmid:36285345", + "pmid:36262216", + "pmid:36252286", + "pmid:36220612", + "pmid:36179426", + "pmid:36130218", + "pmid:36099320", + "pmid:36098485", + "pmid:36087538", + "pmid:36075537", + "pmid:36066723", + "pmid:36064847", + "pmid:36063627", + "pmid:36009409", + "pmid:35997316", + "pmid:35935919", + "pmid:35928225", + "pmid:35926480", + "pmid:35915275", + "pmid:35914128", + "pmid:35852957", + "pmid:35803234", + "pmid:35793238", + "pmid:35661131", + "pmid:35659303", + "pmid:35628406", + "pmid:35580427", + "pmid:35440014", + "pmid:35395816", + "pmid:35379994", + "pmid:35370826", + "pmid:35357736", + "pmid:35275350", + "pmid:35241644", + "pmid:35224162", + "pmid:35182509", + "pmid:35146388", + "pmid:35143966", + "pmid:35114102", + "pmid:35099257", + "pmid:35095420", + "pmid:35058188", + "pmid:35055435", + "pmid:35046408", + "pmid:35036881", + "pmid:38835439", + "pmid:34948242", + "pmid:34942093", + "pmid:34884469", + "pmid:34880419", + "pmid:34851867", + "pmid:34829752", + "pmid:34806402", + "pmid:34800149", + "pmid:34747792", + "pmid:34718701", + "pmid:34681268", + "pmid:34663519", + "pmid:34659371", + "pmid:34658796", + "pmid:34631219", + "pmid:34608934", + "pmid:34539331", + "pmid:34536046", + "pmid:34520257", + "pmid:34504195", + "pmid:34492254", + "pmid:34473992", + "pmid:34469738", + "pmid:34423286", + "pmid:34423068", + "pmid:34390268", + "pmid:34389718", + "pmid:34376056", + "pmid:34372915", + "pmid:34366363", + "pmid:34330701", + "pmid:34301881", + "pmid:34296279", + "pmid:34200421", + "pmid:34183222", + "pmid:34180418", + "pmid:34115782", + "pmid:34093422", + "pmid:34077591", + "pmid:34071882", + "pmid:34028139", + "pmid:34003958", + "pmid:33989290", + "pmid:33983118", + "pmid:33949657", + "pmid:33918672", + "pmid:33909994", + "pmid:33907289", + "pmid:33892278", + "pmid:33824468", + "pmid:33805940", + "pmid:33766994", + "pmid:33751106", + "pmid:33731741", + "pmid:33722743", + "pmid:33710799", + "pmid:33692166", + "pmid:33684424", + "pmid:33681777", + "pmid:33675499", + "pmid:33611676", + "pmid:33606279", + "pmid:33602179", + "pmid:33581487", + "pmid:33579864", + "pmid:33576024", + "pmid:33567536", + "pmid:33556538", + "pmid:33547932", + "pmid:33521985", + "pmid:33517535", + "pmid:33500176", + "pmid:33487499", + "pmid:33376800", + "pmid:33329316", + "pmid:33310753", + "pmid:33250715", + "pmid:33249136", + "pmid:33247537", + "pmid:33242422", + "pmid:33228555", + "pmid:33209959", + "pmid:33159825", + "pmid:33108594", + "pmid:33106889", + "pmid:33105495", + "pmid:33044188", + "pmid:32979842", + "pmid:32979507", + "pmid:32975927", + "pmid:32956974", + "pmid:32954323", + "pmid:32898862", + "pmid:32876667", + "pmid:32825467", + "pmid:32807001", + "pmid:32784364", + "pmid:32761094", + "pmid:32741964", + "pmid:32702387", + "pmid:32696070", + "pmid:32675418", + "pmid:32668197", + "pmid:32661355", + "pmid:32656337", + "pmid:32612964", + "pmid:32589923", + "pmid:32580238", + "pmid:32555394", + "pmid:32548276", + "pmid:32533168", + "pmid:32500377", + "pmid:32469433", + "pmid:32439598", + "pmid:32424160", + "pmid:32339315", + "pmid:32329133", + "pmid:32260409", + "pmid:32240172", + "pmid:32189861", + "pmid:32179492", + "pmid:32164608", + "pmid:32124191", + "pmid:32102602", + "pmid:32093602", + "pmid:32077165", + "pmid:32060489", + "pmid:32043503", + "pmid:31985471", + "pmid:31940111", + "pmid:31922295", + "pmid:31893246", + "pmid:31844074", + "pmid:31828084", + "pmid:31820322", + "pmid:31810584", + "pmid:31796991", + "pmid:31785809", + "pmid:31728006", + "pmid:31725947", + "pmid:31722751", + "pmid:31712634", + "pmid:31695145", + "pmid:31614197", + "pmid:31607598", + "pmid:31599037", + "pmid:31595198", + "pmid:31586340", + "pmid:31561381", + "pmid:31546689", + "pmid:31522753", + "pmid:31491822", + "pmid:31465962", + "pmid:31403680", + "pmid:31398342", + "pmid:31379510", + "pmid:31326748", + "pmid:31302194", + "pmid:31184975", + "pmid:31114543", + "pmid:31108174", + "pmid:31104771", + "pmid:31103960", + "pmid:31086827", + "pmid:31079989", + "pmid:31059641", + "pmid:30984798", + "pmid:30961637", + "pmid:30891880", + "pmid:30887245", + "pmid:30867264", + "pmid:30850442", + "pmid:30838312", + "pmid:30811996", + "pmid:30788902", + "pmid:30726572", + "pmid:30689590", + "pmid:30682531", + "pmid:30672003", + "pmid:30631090", + "pmid:30624705", + "pmid:30618600", + "pmid:30618191", + "pmid:30615214", + "pmid:30576007", + "pmid:30550751", + "pmid:30523767", + "pmid:30396032", + "pmid:30376191", + "pmid:30358836", + "pmid:30354976", + "pmid:30336474", + "pmid:30314815", + "pmid:30262848", + "pmid:30256717", + "pmid:30239724", + "pmid:30194983", + "pmid:30194046", + "pmid:30185623", + "pmid:30171891", + "pmid:30149534", + "pmid:30126429", + "pmid:30122542", + "pmid:30120431", + "pmid:30103339", + "pmid:30103338", + "pmid:30028085", + "pmid:30007561", + "pmid:29984244", + "pmid:29945620", + "pmid:29932473", + "pmid:29925548", + "pmid:29902468", + "pmid:29881950", + "pmid:29858077", + "pmid:29813067", + "pmid:29804730", + "pmid:29801887", + "pmid:29791508", + "pmid:29743609", + "pmid:29738460", + "pmid:29715545", + "pmid:29694882", + "pmid:29687370", + "pmid:29685790", + "pmid:29682858", + "pmid:29670796", + "pmid:29660633", + "pmid:29619771", + "pmid:29581148", + "pmid:29564144", + "pmid:29535594", + "pmid:29513687", + "pmid:29494703", + "pmid:29491012", + "pmid:29480209", + "pmid:29480205", + "pmid:29480204", + "pmid:29466333", + "pmid:29462355", + "pmid:29460498", + "pmid:29459817", + "pmid:29451775", + "pmid:29441485", + "pmid:29440125", + "pmid:29378824", + "pmid:29375575", + "pmid:29367444", + "pmid:29346421", + "pmid:29324753", + "pmid:29291624", + "pmid:29264979", + "pmid:29253686", + "pmid:29249939", + "pmid:29230030", + "pmid:29229845", + "pmid:29212711", + "pmid:29172480", + "pmid:29160844", + "pmid:29066237", + "pmid:29046994", + "pmid:29043641", + "pmid:29036832", + "pmid:28986324", + "pmid:28984613", + "pmid:28971447", + "pmid:28843844", + "pmid:28743452", + "pmid:28729730", + "pmid:28715425", + "pmid:28698602", + "pmid:28661018", + "pmid:28657159", + "pmid:28653853", + "pmid:28652746", + "pmid:28642124", + "pmid:28621522", + "pmid:28585930", + "pmid:28582868", + "pmid:28536578", + "pmid:28494017", + "pmid:28465506", + "pmid:28412438", + "pmid:28406926", + "pmid:28400517", + "pmid:28359739", + "pmid:28339398", + "pmid:28270748", + "pmid:28266655", + "pmid:28238795", + "pmid:28205498", + "pmid:28202696", + "pmid:28165127", + "pmid:28153533", + "pmid:28129107", + "pmid:28096892", + "pmid:28000697", + "pmid:27983559", + "pmid:27913616", + "pmid:27870408", + "pmid:27868347", + "pmid:27818324", + "pmid:27681197", + "pmid:27774050", + "pmid:27740685", + "pmid:27714917", + "pmid:27689620", + "pmid:27677791", + "pmid:27662335", + "pmid:27658206", + "pmid:27639545", + "pmid:27611938", + "pmid:27540492", + "pmid:27481337", + "pmid:27479945", + "pmid:27477323", + "pmid:27400454", + "pmid:27376585", + "pmid:27335115", + "pmid:27335079", + "pmid:27318215", + "pmid:27288455", + "pmid:27271685", + "pmid:27221610", + "pmid:27207688", + "pmid:27182645", + "pmid:27170315", + "pmid:27085395", + "pmid:27080129", + "pmid:27031731", + "pmid:27014581", + "pmid:27003665", + "pmid:27003663", + "pmid:27002149", + "pmid:26982737", + "pmid:26958025", + "pmid:26951563", + "pmid:26900923", + "pmid:26874369", + "pmid:26864449", + "pmid:26849111", + "pmid:26846325", + "pmid:26702360", + "pmid:26682993", + "pmid:26651603", + "pmid:26642438", + "pmid:26621114", + "pmid:26615955", + "pmid:26557176", + "pmid:26490331", + "pmid:26439718", + "pmid:26428929", + "pmid:26410751", + "pmid:26397897", + "pmid:26397895", + "pmid:26378991", + "pmid:26375764", + "pmid:26333255", + "pmid:26320893", + "pmid:26247199", + "pmid:26232222", + "pmid:26219658", + "pmid:26218986", + "pmid:26201449", + "pmid:26195796", + "pmid:26148071", + "pmid:26148061", + "pmid:26100538", + "pmid:26081309", + "pmid:26079385", + "pmid:25993131", + "pmid:25990798", + "pmid:25972145", + "pmid:25953777", + "pmid:25934536", + "pmid:25928884", + "pmid:25889241", + "pmid:25876513", + "pmid:25871323", + "pmid:25859666", + "pmid:25850430", + "pmid:25849618", + "pmid:25800750", + "pmid:25767004", + "pmid:25732261", + "pmid:25703232", + "pmid:25687118", + "pmid:25678252", + "pmid:25662336", + "pmid:25642374", + "pmid:25606985", + "pmid:25574027", + "pmid:25562842", + "pmid:25466405", + "pmid:25464109", + "pmid:25453459", + "pmid:25447230", + "pmid:25385587", + "pmid:25380582", + "pmid:25358814", + "pmid:25322077", + "pmid:25316307", + "pmid:25300333", + "pmid:25300330", + "pmid:25248608", + "pmid:25246229", + "pmid:25207939", + "pmid:25136821", + "pmid:25101541", + "pmid:25099302", + "pmid:25088714", + "pmid:25062863", + "pmid:25062764", + "pmid:25035419", + "pmid:25034271", + "pmid:25026978", + "pmid:24972706", + "pmid:24951540", + "pmid:24938402", + "pmid:24921664", + "pmid:24911443", + "pmid:24841383", + "pmid:24825316", + "pmid:24816393", + "pmid:24788406", + "pmid:24784230", + "pmid:24751919", + "pmid:24728353", + "pmid:24706734", + "pmid:24633813", + "pmid:24566949", + "pmid:24564568", + "pmid:24534762", + "pmid:24465260", + "pmid:24462335", + "pmid:24459609", + "pmid:24459107", + "pmid:24452335", + "pmid:24405816", + "pmid:24390280", + "pmid:24389360", + "pmid:24380395", + "pmid:24363131", + "pmid:24359926", + "pmid:24314096", + "pmid:24292706", + "pmid:24286237", + "pmid:24270512", + "pmid:24192302", + "pmid:24047873", + "pmid:24041806", + "pmid:24038471", + "pmid:24027120", + "pmid:24022020", + "pmid:24019913", + "pmid:24000094", + "pmid:23974869", + "pmid:23963702", + "pmid:23946314", + "pmid:23933208", + "pmid:23906595", + "pmid:23896435", + "pmid:23894380", + "pmid:23847583", + "pmid:23775678", + "pmid:23765727", + "pmid:23732677", + "pmid:23664844", + "pmid:23644918", + "pmid:23624566", + "pmid:23595883", + "pmid:23576953", + "pmid:23557875", + "pmid:23525903", + "pmid:23494654", + "pmid:23480802", + "pmid:23443539", + "pmid:23440000", + "pmid:23437422", + "pmid:23419892", + "pmid:23416527", + "pmid:23398026", + "pmid:23372043", + "pmid:23346156", + "pmid:23341618", + "pmid:23300918", + "pmid:23284626", + "pmid:23277128", + "pmid:25063431", + "pmid:23157165", + "pmid:23083689", + "pmid:23054839", + "pmid:23051704", + "pmid:23042244", + "pmid:23008174", + "pmid:22993450", + "pmid:22985800", + "pmid:22974690", + "pmid:22914735", + "pmid:22833283", + "pmid:22814437", + "pmid:22803944", + "pmid:22786682", + "pmid:22748968", + "pmid:22720673", + "pmid:22674458", + "pmid:22668780", + "pmid:22649062", + "pmid:22623107", + "pmid:22613578", + "pmid:22589249", + "pmid:22583646", + "pmid:22580959", + "pmid:22580459", + "pmid:22542623", + "pmid:22537721", + "pmid:22526956", + "pmid:22497302", + "pmid:26307259", + "pmid:22454241", + "pmid:22425717", + "pmid:22409360", + "pmid:22387017", + "pmid:22383888", + "pmid:22367996", + "pmid:22359536", + "pmid:22323755", + "pmid:22306231", + "pmid:22297462", + "pmid:22274789", + "pmid:22237433", + "pmid:22235343", + "pmid:22219281", + "pmid:22216210", + "pmid:22210241", + "pmid:24353748", + "pmid:23925262", + "pmid:23476655", + "pmid:22179316", + "pmid:22178474", + "pmid:22124413", + "pmid:22072510", + "pmid:22011578", + "pmid:21989477", + "pmid:21962718", + "pmid:21951270", + "pmid:21915913", + "pmid:21909428", + "pmid:21907324", + "pmid:21897851", + "pmid:21896309", + "pmid:21858921", + "pmid:21672921", + "pmid:21566259", + "pmid:21555070", + "pmid:21540131", + "pmid:21519949", + "pmid:21509658", + "pmid:21507249", + "pmid:21432905", + "pmid:21427085", + "pmid:21370269", + "pmid:21347256", + "pmid:21334439", + "pmid:21322024", + "pmid:21297956", + "pmid:21247881", + "pmid:21211002", + "pmid:21192926", + "pmid:22832606", + "pmid:22453877", + "pmid:21177255", + "pmid:21170307", + "pmid:21147489", + "pmid:21108634", + "pmid:21106039", + "pmid:21068430", + "pmid:21037797", + "pmid:21037796", + "pmid:21028906", + "pmid:20935170", + "pmid:20919768", + "pmid:24868381", + "pmid:20877453", + "pmid:20864123", + "pmid:20697744", + "pmid:20688164", + "pmid:20655708", + "pmid:20645403", + "pmid:20629137", + "pmid:20585470", + "pmid:20569486", + "pmid:20552561", + "pmid:20457230", + "pmid:20385209", + "pmid:20360314", + "pmid:20217280", + "pmid:20190273", + "pmid:20145031", + "pmid:22353486", + "pmid:20001119", + "pmid:19997493", + "pmid:19956633", + "pmid:19895335", + "pmid:19882735", + "pmid:19857538", + "pmid:19823894", + "pmid:19810823", + "pmid:19776381", + "pmid:19652143", + "pmid:19649213", + "pmid:19621255", + "pmid:19607813", + "pmid:19595623", + "pmid:19586540", + "pmid:19573560", + "pmid:19573298", + "pmid:21048629", + "pmid:19484127", + "pmid:19465745", + "pmid:19455596", + "pmid:19412185", + "pmid:19270701", + "pmid:19266143", + "pmid:19250382", + "pmid:19249009", + "pmid:21415933", + "pmid:19243073", + "pmid:19210789", + "pmid:19200948", + "pmid:19200361", + "pmid:19193881", + "pmid:19133136", + "pmid:19130884", + "pmid:19064745", + "pmid:19059613", + "pmid:19014073", + "pmid:19012814", + "pmid:18986359", + "pmid:18981372", + "pmid:18931668", + "pmid:18930824", + "pmid:18854207", + "pmid:18844975", + "pmid:18754766", + "pmid:18688140", + "pmid:18640989", + "pmid:18608348", + "pmid:18512767", + "pmid:18502655", + "pmid:18481795", + "pmid:18441666", + "pmid:18430257", + "pmid:18413470", + "pmid:18403212", + "pmid:18403126", + "pmid:18398004", + "pmid:18387780", + "pmid:18380486", + "pmid:18373410", + "pmid:18349696", + "pmid:18314311", + "pmid:18307262", + "pmid:18299573", + "pmid:18298206", + "pmid:18231868", + "pmid:18204817", + "pmid:18192679", + "pmid:19378429", + "pmid:18158109", + "pmid:18157708", + "pmid:18096682", + "pmid:18091069", + "pmid:18077673", + "pmid:18068007", + "pmid:18067195", + "pmid:18057558", + "pmid:18004675", + "pmid:17952586", + "pmid:17947312", + "pmid:17726644", + "pmid:17707354", + "pmid:17687393", + "pmid:17665004", + "pmid:17660463", + "pmid:17653603", + "pmid:17653274", + "pmid:17653262", + "pmid:17627386", + "pmid:17615168", + "pmid:17610899", + "pmid:17584778", + "pmid:17569088", + "pmid:17562929", + "pmid:17557337", + "pmid:17548158", + "pmid:17516481", + "pmid:17493035", + "pmid:17478887", + "pmid:17427191", + "pmid:17409200", + "pmid:17383831", + "pmid:17363167", + "pmid:17356014", + "pmid:17352933", + "pmid:17352932", + "pmid:17352931", + "pmid:17352930", + "pmid:17307423", + "pmid:17299512", + "pmid:17293170", + "pmid:17291464", + "pmid:17183717", + "pmid:17181545", + "pmid:17174018", + "pmid:17115386", + "pmid:17096834", + "pmid:17055784", + "pmid:17040921", + "pmid:17018562", + "pmid:17018277", + "pmid:16987871", + "pmid:16981596", + "pmid:16980414", + "pmid:16973440", + "pmid:16925544", + "pmid:16918952", + "pmid:16914060", + "pmid:16858508", + "pmid:16772714", + "pmid:16769871", + "pmid:16751280", + "pmid:16690085", + "pmid:16687439", + "pmid:16626669", + "pmid:16606912", + "pmid:16600988", + "pmid:16570300", + "pmid:16564426", + "pmid:16526033", + "pmid:16515395", + "pmid:16461334", + "pmid:16434483", + "pmid:16395126", + "pmid:16372906", + "pmid:16321399", + "pmid:16261565", + "pmid:16221531", + "pmid:16159402", + "pmid:16135087", + "pmid:16125146", + "pmid:16111888", + "pmid:16096998", + "pmid:16082690", + "pmid:16040812", + "pmid:16033418", + "pmid:16007623", + "pmid:15986189", + "pmid:15954918", + "pmid:15906159", + "pmid:15850737", + "pmid:15848234", + "pmid:15843398", + "pmid:15832309", + "pmid:15811941", + "pmid:15764008", + "pmid:15758168", + "pmid:15742215", + "pmid:15722951", + "pmid:15716522", + "pmid:15704211", + "pmid:15635668", + "pmid:15531095", + "pmid:15496672", + "pmid:15496421", + "pmid:15468075", + "pmid:15372528", + "pmid:15365789", + "pmid:15361494", + "pmid:15354395", + "pmid:15345132", + "pmid:15254954", + "pmid:15229244", + "pmid:15211622", + "pmid:15201464", + "pmid:15201455", + "pmid:15193429", + "pmid:15147313", + "pmid:15094787", + "pmid:15076735", + "pmid:15040808", + "pmid:15025718", + "pmid:14999077", + "pmid:14993615", + "pmid:14713958", + "pmid:14708029", + "pmid:14688268", + "pmid:14673581", + "pmid:14625278", + "pmid:14625025", + "pmid:14581669", + "pmid:14570710", + "pmid:12966525", + "pmid:12926013", + "pmid:12895502", + "pmid:12886033", + "pmid:12850791", + "pmid:12824708", + "pmid:12805114", + "pmid:12797118", + "pmid:12791042", + "pmid:12783847", + "pmid:12782968", + "pmid:12700167", + "pmid:12599191", + "pmid:12576549", + "pmid:12554681", + "pmid:12460551", + "pmid:12438470", + "pmid:12405543", + "pmid:12393802", + "pmid:12354780", + "pmid:12226089", + "pmid:12223581", + "pmid:12221159", + "pmid:12218657", + "pmid:12208565", + "pmid:12177311", + "pmid:12123845", + "pmid:12097805", + "pmid:11979062", + "pmid:11978769", + "pmid:11920857", + "pmid:11914418", + "pmid:11807410", + "pmid:11782460", + "pmid:11761463", + "pmid:11741397", + "pmid:11704263", + "pmid:11689489", + "pmid:11607033", + "pmid:11593450", + "pmid:11592850", + "pmid:11558794", + "pmid:11552131", + "pmid:11532992", + "pmid:11524486", + "pmid:11520890", + "pmid:11494364", + "pmid:11483245", + "pmid:11386982", + "pmid:11409734", + "pmid:11406606", + "pmid:11340249", + "pmid:11331615", + "pmid:11317220", + "pmid:11279522", + "pmid:11260214", + "pmid:22034471", + "pmid:11225602", + "pmid:11172033", + "pmid:11152661", + "pmid:11106399", + "pmid:11105061", + "pmid:11063736", + "pmid:11040449", + "pmid:11030759", + "pmid:11021756", + "pmid:11013077", + "pmid:11009201", + "pmid:10980573", + "pmid:10964480", + "pmid:10880387", + "pmid:10860124", + "pmid:10814708", + "pmid:10794362", + "pmid:10780268", + "pmid:10770860", + "pmid:10766906", + "pmid:10717003", + "pmid:10712225", + "pmid:10677504", + "pmid:10666223", + "pmid:10631644", + "pmid:10611371", + "pmid:10581038", + "pmid:10574348", + "pmid:10564878", + "pmid:10533044", + "pmid:10522893", + "pmid:10502848", + "pmid:10502825", + "pmid:10489045", + "pmid:10486315", + "pmid:10478585", + "pmid:10441327", + "pmid:10441201", + "pmid:10434306", + "pmid:10434303", + "pmid:10434297", + "pmid:10434295", + "pmid:10405095", + "pmid:10398087", + "pmid:10334474", + "pmid:10333377", + "pmid:10206229", + "pmid:10197541", + "pmid:10196370", + "pmid:10196365", + "pmid:10098889", + "pmid:10091627", + "pmid:10090478", + "pmid:10082833", + "pmid:10052816", + "pmid:10051007", + "pmid:10023115", + "pmid:9949443", + "pmid:9949199", + "pmid:9932964", + "pmid:9887339", + "pmid:9818876", + "pmid:9806905", + "pmid:9792871", + "pmid:9768849", + "pmid:9684917", + "pmid:9674805", + "pmid:9666478", + "pmid:9647305", + "pmid:9626775", + "pmid:9611675", + "pmid:9527890", + "pmid:9536082", + "pmid:9536081", + "pmid:9536080", + "pmid:9595987", + "pmid:9577843", + "pmid:9514585", + "pmid:9514579", + "pmid:9361024", + "pmid:9485067", + "pmid:9462548", + "pmid:9415475", + "pmid:23604331", + "pmid:9399688", + "pmid:9398841", + "pmid:9388503", + "pmid:9339688", + "pmid:9299885", + "pmid:9299309", + "pmid:9267034", + "pmid:9267033", + "pmid:9152833", + "pmid:9150744", + "pmid:9150168", + "pmid:9108071", + "pmid:9106534", + "pmid:9143014", + "pmid:10462592", + "pmid:9020849", + "pmid:9401013", + "pmid:9219003", + "pmid:9002673", + "pmid:9384710", + "pmid:8931689", + "pmid:8898202", + "pmid:8855141", + "pmid:8912795", + "pmid:8751857", + "pmid:8659522", + "pmid:8735227", + "pmid:8643525", + "pmid:8678115", + "pmid:8606810", + "pmid:8714530", + "pmid:8614526", + "pmid:8985734", + "pmid:8954302", + "pmid:8840396", + "pmid:8766138", + "pmid:8572659", + "pmid:8557266", + "pmid:7477379", + "pmid:8804464", + "pmid:7576661", + "pmid:7568002", + "pmid:8544189", + "pmid:8541834", + "pmid:7668287", + "pmid:7668260", + "pmid:7639626", + "pmid:7484060", + "pmid:7480359", + "pmid:7774020", + "pmid:7675777", + "pmid:7898693", + "pmid:7868117", + "pmid:7634532", + "pmid:7757069", + "pmid:9173995", + "pmid:7881406", + "pmid:7969980", + "pmid:7959696", + "pmid:7853373", + "pmid:7915776", + "pmid:7815437", + "pmid:8208412", + "pmid:8178825", + "pmid:8064815", + "pmid:7909529", + "pmid:8162059", + "pmid:8162055", + "pmid:8162053", + "pmid:8044653", + "pmid:7888133", + "pmid:7865169", + "pmid:8133511", + "pmid:8133510", + "pmid:8133508", + "pmid:8133495", + "pmid:8111374", + "pmid:8087617", + "pmid:8105214", + "pmid:8268906", + "pmid:8252042", + "pmid:8242074", + "pmid:8401589", + "pmid:8401588", + "pmid:8401587", + "pmid:2521771", + "pmid:2971929", + "pmid:3131233" + ] }, { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 9, - "pathogenic_max": 334, - "motif_len": 5, - "ref_copies": 20.8, - "novel": "novel", - "gard": ["16758"], - "genereviews": [], - "malacard": [], - "medgen": [], - "mondo": [], - "omim": [], - "orphanet": ["86814"], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": ["486849"], - "webstr_hg19": [], - "locus_tags": ["motif_affects_onset"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:7994247", "pmid:37994247", "pmid:38876750"], - "additional_literature": ["pmid:41874439", "pmid:41219789", "pmid:40541176", "pmid:38871700", "pmid:37339841", "pmid:34565721", "pmid:33186760", "pmid:32283749", "pmid:32281848", "pmid:30891880", "pmid:30622881", "pmid:25663198", "pmid:23897707", "pmid:17457615", "pmid:15148657", "pmid:11594924", "pmid:10915763", "pmid:8817239"] -}, -{ - "id": "FAME7_RAPGEF2", - "disease_id": "FAME7", - "gene": "RAPGEF2", - "evidence": ["Limited"], - "chrom": "chr4", - "start_hg38": 159342526, - "stop_hg38": 159342618, - "start_hg19": 160263678, - "stop_hg19": 160263770, - "start_t2t": 162693303, - "stop_t2t": 162693405, - "disease": "Familial adult myoclonic epilepsy type 7", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. Repeat expansion found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 20-33 [@pmid:30351492]; Range: 18 [@pmid:29507423] - 37 [@pmid:30351492].", - "age_onset_min": 18.0, - "age_onset_max": 37.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "The locus structure is (TTTTA)exp(TTTCA)exp(TTTTA)n, where only the TTTCA is specific to affected individuals as a pathogenic insertion [@pmid:29507423; @pmid:30351492]. Pathogenic expansions range from 60 to thousands of repeats [@pmid:29507423; @pmid:30351492]. Interruptions seen: TATTA, TTTTTA [@pmid:35245110].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423].", - "year": "2018 [@pmid:29507423]", - "location_in_gene": "Intron 14", - "gene_strand": "+", - "reference_motif_reference_orientation": ["TTTTA"], - "pathogenic_motif_reference_orientation": ["TTTCA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["TTTTT", "TTATG"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["TTTTT", "ATGTT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "HDL2_JPH3", + "disease_id": "HDL2", + "gene": "JPH3", + "evidence": [ + "Definitive" + ], + "chrom": "chr16", + "start_hg38": 87604282, + "stop_hg38": 87604329, + "start_hg19": 87637888, + "stop_hg19": 87637935, + "start_t2t": 93675723, + "stop_t2t": 93675776, + "disease": "Huntington disease-like 2", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Huntington disease-like 2 (HDL2) is a severe neurodegenerative disorder considered part of the neuroacanthocytosis syndromes characterized by a triad of movement, psychiatric, and cognitive abnormalities [@mondo:0011671].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "<1/1,000,000 [@orphanet:98934]. Largely in individuals of African ancestry [@genereviews:NBK1529], where a possible JPH3 founder mutation has been identified [@pmid:40187026].", + "age_onset": "Typical: 30-52; Range: 12-66 [@genereviews:NBK1529].", + "age_onset_min": 12, + "age_onset_max": 66, + "typ_age_onset_min": 30, + "typ_age_onset_max": 52, + "details": "Intermediate alleles (29-39) may either be premutations or associated with reduced penetrance; the longest pathogenic expansion (40+ motifs) to date is 60 repeats [@genereviews:NBK1529]", + "detection": null, + "mechanism": "LoF/GoF", + "mechanism_detail": "Non-mutually exclusive mechanisms include loss of function from RNA sequestration and gain of function from toxic transcripts and increased protein expression [@genereviews:NBK1529]", + "year": "2001 [@pmid:11694876]", + "location_in_gene": "Coding Exon 2", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CTG" + ], + "pathogenic_motif_reference_orientation": [ + "CTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CTG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 28, + "intermediate_min": 29, + "intermediate_max": 39, + "pathogenic_min": 40, + "pathogenic_max": 60, + "motif_len": 3, + "ref_copies": 15.6667, + "novel": "ref", + "gard": [ + "16874" + ], + "genereviews": [ + "NBK1529" + ], + "malacard": [ + "HNT004" + ], + "medgen": [ + "341120" + ], + "mondo": [ + "0011671" + ], + "omim": [ + "606438" + ], + "orphanet": [ + "98934" + ], + "gnomad": [ + "JPH3" + ], + "stripy": [ + "JPH3" + ], + "tr_atlas": [ + "TR143309" + ], + "webstr_hg38": [ + "828516", + "5987878" + ], + "webstr_hg19": [ + "Expansion_HDL2/JPH3" + ], + "locus_tags": [ + "somatic_instability", + "length_affects_phenotype", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_severity" + ], + "disease_tags": [], + "references": [ + "genereviews:NBK1529", + "orphanet:98934", + "pmid:40187026", + "pmid:11694876", + "mondo:0011671" + ], + "additional_literature": [ + "pmid:41957010", + "pmid:41074680", + "pmid:40914005", + "pmid:38948793", + "pmid:38725192", + "pmid:38617831", + "pmid:37379724", + "pmid:35926480", + "pmid:33824468", + "pmid:33044188", + "pmid:32675418", + "pmid:32028232", + "pmid:30682531", + "pmid:30615214", + "pmid:29801887", + "pmid:29208631", + "pmid:29066237", + "pmid:27400454", + "pmid:27288455", + "pmid:26079385", + "pmid:24269018", + "pmid:22447335", + "pmid:22367996", + "pmid:22297462", + "pmid:21555070", + "pmid:17516481", + "pmid:16858508", + "pmid:15764008", + "pmid:15468075", + "pmid:14557581", + "pmid:12805114", + "pmid:11906164" + ] + }, { - "motif": "TTTTA", - "count": 17, - "type": "internal_repeat" + "id": "OPDM1_LRP12", + "disease_id": "OPDM1", + "gene": "LRP12", + "evidence": [ + "Strong" + ], + "chrom": "chr8", + "start_hg38": 104588970, + "stop_hg38": 104588999, + "start_hg19": 105601198, + "stop_hg19": 105601227, + "start_t2t": 105716409, + "stop_t2t": 105716441, + "disease": "Oculopharyngodistal myopathy type 1", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Adult-onset ptosis, dysphagia [@pmid:39349043]; External ophthalmoplegia, facial weakness, pharyngeal, and distal limb weakness [@pmid:38876750]; May be slight male predominance [@pmid:34047774].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Population dependent; unknown percentage of LRP12 pathogenic variants. Typically East Asian ancestry [@pmid:38876750]; potentially most frequent cause of OPDM in Japan [@pmid:34047774].", + "age_onset": "Typical: 31-51 [@pmid:34047774]; Range: 7-66 [@pmid:2124290].", + "age_onset_min": 7, + "age_onset_max": 66, + "typ_age_onset_min": 31, + "typ_age_onset_max": 51, + "details": "Benign range (13-45) inferred from cohort data, but pathogenic range isn't yet fully understood [@genereviews:NBK535148]. In a cohort of 65 patients from 59 families, alleles ranged from 85-289 repeats, with an inverse relationship between size and age of onset [@pmid:34047774]. Inherited peripheral neuropathy (IPN) may be associated with shorter expansions [@pmid:39013564]. Interruptions seen: ACG, CCA [@pmid:35245110].", + "detection": "Short-read sequencing has been reported to be unreliable at detecting large expansions [@pmid:40858832]. RP-PCR followed by long-read sequencing is commonly used for characterization [@pmid:39013564].", + "mechanism": "GoF?", + "mechanism_detail": "RNA mediated toxicity hypothesized [@omim:164310]; may involve RAN translation [@pmid:38467784]. Somatic mosaicism and hypermethylation have also been reported [@pmid:41131788].", + "year": "2019 [@pmid:31332380]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CGC" + ], + "pathogenic_motif_reference_orientation": [ + "CGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 13, + "benign_max": 45, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 85, + "pathogenic_max": 289, + "motif_len": 3, + "ref_copies": 11.7, + "novel": "ref", + "gard": [ + "15097" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "OCL076" + ], + "medgen": [ + "1684682" + ], + "mondo": [ + "0020793" + ], + "omim": [ + "164310" + ], + "orphanet": [ + "98897" + ], + "gnomad": [ + "LRP12" + ], + "stripy": [ + "LRP12" + ], + "tr_atlas": [ + "TR88348" + ], + "webstr_hg38": [ + "1082178", + "4874587" + ], + "webstr_hg19": [ + "STR_1441036" + ], + "locus_tags": [ + "somatic_instability", + "anticipation", + "length_affects_onset" + ], + "disease_tags": [ + "oculopharyngodistal_myopathy" + ], + "references": [ + "pmid:34047774", + "pmid:2124290", + "omim:164310", + "pmid:38467784", + "pmid:41131788", + "genereviews:NBK535148", + "pmid:39013564", + "pmid:35245110", + "pmid:38876750", + "pmid:31332380", + "pmid:39349043" + ], + "additional_literature": [ + "pmid:41888971", + "pmid:41792844", + "pmid:41125376", + "pmid:40645757", + "pmid:40417202", + "pmid:40084170", + "pmid:38726482", + "pmid:37923380", + "pmid:37864208", + "pmid:37339631", + "pmid:36052448", + "pmid:35700120", + "pmid:35314910", + "pmid:35152460", + "pmid:35148830", + "pmid:34927285", + "pmid:33693509", + "pmid:33374016", + "pmid:33239111", + "pmid:32493488", + "pmid:27072820" + ] }, { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 60, - "pathogenic_max": 2200, - "motif_len": 5, - "ref_copies": 17.4, - "novel": "novel", - "gard": ["16758"], - "genereviews": ["NBK535148"], - "malacard": ["EPL228"], - "medgen": ["1648435"], - "mondo": ["0054847"], - "omim": ["618075"], - "orphanet": ["86814"], - "gnomad": ["RAPGEF2"], - "stripy": ["RAPGEF2"], - "tr_atlas": ["TR49300"], - "webstr_hg38": ["154264", "4792219"], - "webstr_hg19": ["STR_1096016"], - "locus_tags": ["motif_affects_penetrance"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:30351492", "pmid:29507423", "pmid:35245110", "pmid:38876750"], - "additional_literature": ["pmid:41219789", "pmid:36092952", "pmid:33040085", "pmid:31483537"] -}, -{ - "id": "CANVAS_RFC1", - "disease_id": "CANVAS", - "gene": "RFC1", - "evidence": ["Definitive"], - "chrom": "chr4", - "start_hg38": 39348424, - "stop_hg38": 39348483, - "start_hg19": 39350044, - "stop_hg19": 39350103, - "start_t2t": 39318077, - "stop_t2t": 39318136, - "disease": "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Sensory disturbances, imbalance, oscillopsia, chronic dry cough, dysarthria and dysphagia [@pmid:38876750]; Late-onset ataxia, sensory neuropathy, vestibular areflexia syndrome [@pmid:39349043]. This expansion has been implicated in the genetic etiology of Parkinson's disease [@pmid:41177915].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Carrier frequency in Europeans is 0.7-4% and in Chinese Han population is 2.24%; estimated prevalence of 1/20,000 to 1/625 [@genereviews:NBK564656]. Many cases are likely not diagnosed due to heterogeneous presentation [@pmid:39230846]. Observed in multiple ethnicities [@pmid:38876750]; patients diagnosed with European, Chinese Han, and Maori ancestry, as well as found in Japan, Canada, Brazil, the UK, Italy, Germany, and Australia [@genereviews:NBK564656].", - "age_onset": "Typical: 36-52; Range: 19-76 [@genereviews:NBK564656].", - "age_onset_min": 19.0, - "age_onset_max": 76.0, - "typ_age_onset_min": 36.0, - "typ_age_onset_max": 52.0, - "details": "Disease is caused by an insertion of a pathogenic motif, although motif presence is variable and can expand up to 200 repeats without apparently causing a phenotype [@genereviews:NBK564656]. Pathogenic expansions (ranging from 400-2750 pathogenic motifs) may be flanked by other motifs [@genereviews:NBK564656]. For example, (AAAGG)10-25(AAGGG)exp(AAAGG)4-6 [@pmid:32851396]. Motif heterogeneity is common in unaffected individuals [@genereviews:NBK564656], and motif associations are described by Delforge et al. [@pmid:38627134]. The pathogenic size threshold appears to differ for the AAAGG motif: AAAGG expansions >= 600 repeats have been observed in CANVAS patients (vs 400 with established pathogenic motif AAGGG), while ~100-380 AAAGG repeats were found in unaffected controls [@pmid:37450567]. Length appears to impact age of onset and disease severity, with particular impact from the smaller allele [@doi:10.1136/jnnp-2024-ABN.259]. Phenotypic spectrum may include Parkinsonism [@pmid:39833204], chronic cough [@pmid:39811557], idiopathic sensory neuropathy, small fiber neuropathy, and sensorimotor neuropathy [@pmid:41964406].", - "detection": "Expansions are suggested by flanking PCR failure and a pathogenic RP-PCR sawtooth pattern, but biallelic confirmation and sizing rely on Southern blotting [@genereviews:NBK564656]. Long-read sequencing or optical genome mapping are useful for resolving this variable, complex motif structure [@pmid:37892228; @pmid:37450567].", - "mechanism": "LoF", - "mechanism_detail": "LoF; exact mechanism unknown [@pmid:38467784].", - "year": "2019 [@pmid:31230722]", - "location_in_gene": "Intron 2", - "gene_strand": "-", - "reference_motif_reference_orientation": ["AAAAG"], - "pathogenic_motif_reference_orientation": ["AAGGG", "ACAGG", "AAAGG", "AGGGC"], - "benign_motif_reference_orientation": ["AAAAG", "AAAGGG"], - "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AACGG", "AAGAC", "AAGGT", "AGGGG", "AAGAG", "AAAAGG", "AAACG", "AACAG", "AGGTG", "ACGGG", "AAAAAG", "AAGGC"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CCCTT", "CCTGT", "CCTTT", "CCCTG"], - "benign_motif_gene_orientation": ["CTTTT", "CCCTTT"], - "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "CCGTT", "CTTGT", "ACCTT", "CCCCT", "CTCTT", "CCTTTT", "CGTTT", "CTGTT", "ACCTC", "CCCGT", "CTTTTT", "CCTTG"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "FAME3_MARCHF6", + "disease_id": "FAME3", + "gene": "MARCHF6", + "evidence": [ + "Definitive" + ], + "chrom": "chr5", + "start_hg38": 10356343, + "stop_hg38": 10356411, + "start_hg19": 10356455, + "stop_hg19": 10356523, + "start_t2t": 10295525, + "stop_t2t": 10295593, + "disease": "Familial adult myoclonic epilepsy type 3", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical tremor with epilepsy [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Overall FAME prevalence is < 1/35,000; MARCHF6-caused much smaller. Most cases have European ancestry [@pmid:38876750].", + "age_onset": "Typical: 24-41 based on one 76 member pedigree [@pmid:19616813]; Range: 10 [@omim:613608] - 50 [@pmid:40788430].", + "age_onset_min": 10, + "age_onset_max": 50, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Healthy controls do not have pathogenic allele (TTTCA), but do have 9-20 benign motifs (TTTTA) [@genereviews:NBK535148]. Total allele size in probands spanned from 650-1035 repeats; an inverse relationship between allele size and age of onset was noted [@pmid:31664039, @pmid:40788430]. In one study it was proposed that pathogenicity only occurs when TTTCA is expanded [@pmid:40788430]. RP-PCR can detect the pathogenic TTTCA insertion motif but does not adequately resolve complex TTTTA/TTTCA architecture [@pmid:41268177].", + "detection": "Long-range PCR followed by long-read sequencing has been used to size and determine structure [@pmid:40200849].", + "mechanism": "Unknown", + "mechanism_detail": "Noted as unknown in literature [@omim:613608].", + "year": "2019 [@pmid:31664039]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "TTTTA" + ], + "pathogenic_motif_reference_orientation": [ + "TTTCA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "ATGTT", + "TAGTT", + "TTTTG", + "TTTTT" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "ATGTT", + "AGTTT", + "GTTTT", + "TTTTT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "TTTTA", + "count": 12, + "type": "internal_repeat" + }, + { + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 650, + "pathogenic_max": 1035, + "motif_len": 5, + "ref_copies": 13.6, + "novel": "novel", + "gard": [ + "18084" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "EPL053" + ], + "medgen": [ + "462210" + ], + "mondo": [ + "0013322" + ], + "omim": [ + "613608" + ], + "orphanet": [ + "86814" + ], + "gnomad": [ + "MARCHF6" + ], + "stripy": [ + "MARCHF6" + ], + "tr_atlas": [ + "TR51895" + ], + "webstr_hg38": [ + "5994579" + ], + "webstr_hg19": [ + "STR_1116660" + ], + "locus_tags": [ + "somatic_instability", + "motif_affects_onset", + "motif_affects_penetrance", + "motif_affects_severity" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:19616813", + "omim:613608", + "pmid:40788430", + "genereviews:NBK535148", + "pmid:31664039", + "pmid:38876750", + "pmid:39349043" + ], + "additional_literature": [ + "pmid:41268177", + "pmid:41219789", + "pmid:40417743", + "pmid:40200849", + "pmid:33040085" + ] + }, { - "motif": "AAAAG", - "count": 11, - "type": "internal_repeat" + "id": "CHNG3_MIR7-2", + "disease_id": "CHNG3", + "gene": "MIR7-2", + "evidence": [ + "Strong" + ], + "chrom": "chr15", + "start_hg38": 88569433, + "stop_hg38": 88569452, + "start_hg19": 89112664, + "stop_hg19": 89112683, + "start_t2t": 86324038, + "stop_t2t": 86324057, + "disease": "Nongoitrous congenital hypothyroidism-3", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Nongoitrous congenital hypothyroidism-3 (CHNG3) is characterized by infantile-onset clinical and subclinical hypothyroidism associated with a small thyroid gland, high circulating TSH, normal free T4 levels, and normal or mildly increased serum thyroglobulin. Untreated patients or patients who discontinue treatment show a characteristic transition to multinodular goiter (MNG) with age [@omim:609893].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in 12 families, with ancestry including: Irish, White European, French (Normandie), Ashkenazi, French Canadian, Danish/White European, Welsh, Scottish, Italian, British/White European, Italian/Turkish/Lebanese, German/Palestinian, and South Chinese [@pmid:38714868].", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Deletion of one repeat (4 to 3 repeats) found in 10 unrelated families with unsolved disease [@pmid:38714869]; a heterozygous T-to-G transversion in the third repeat can also lead to disease [@pmid:38714868].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Activates a thyroid-specific enhancer [@pmid:38714868; @pmid:38714869].", + "year": "2024 [@pmid:38714869]", + "location_in_gene": "Non-coding", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "TTTG" + ], + "pathogenic_motif_reference_orientation": [ + "TTTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AAAC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 4, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 3, + "pathogenic_max": 3, + "motif_len": 4, + "ref_copies": null, + "novel": "ref", + "gard": [ + "1487" + ], + "genereviews": [], + "malacard": [ + "HYP355" + ], + "medgen": [ + "424853" + ], + "mondo": [ + "0012360" + ], + "omim": [ + "609893" + ], + "orphanet": [], + "gnomad": [ + "PRE-MIR7-2" + ], + "stripy": [], + "tr_atlas": [ + "TR192005" + ], + "webstr_hg38": [ + "5177365" + ], + "webstr_hg19": [ + "STR_492924" + ], + "locus_tags": [ + "contraction" + ], + "disease_tags": [], + "references": [ + "pmid:38714868", + "pmid:38714869", + "omim:609893" + ], + "additional_literature": [] }, { - "motif": "AAGGG", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 0, - "benign_max": 11, - "intermediate_min": 11, - "intermediate_max": 200, - "pathogenic_min": 400, - "pathogenic_max": 2750, - "motif_len": 5, - "ref_copies": 11.8, - "novel": "novel", - "gard": ["17937"], - "genereviews": ["NBK564656"], - "malacard": ["CRB196"], - "medgen": ["482853"], - "mondo": ["0044720"], - "omim": ["614575"], - "orphanet": ["504476"], - "gnomad": ["RFC1"], - "stripy": ["RFC1"], - "tr_atlas": ["TR42349"], - "webstr_hg38": ["4722884", "99101"], - "webstr_hg19": ["STR_1036603"], - "locus_tags": ["motif_affects_penetrance", "length_affects_onset", "length_affects_severity"], - "disease_tags": ["ataxia", "phenotypic_spectrum"], - "references": ["genereviews:NBK564656", "pmid:38467784", "pmid:32851396", "pmid:38627134", "pmid:37450567", "doi:10.1136/jnnp-2024-ABN.259", "pmid:39833204", "pmid:39811557", "pmid:41964406", "pmid:39230846", "pmid:38876750", "pmid:31230722", "pmid:39349043", "pmid:41177915"], - "additional_literature": ["pmid:42178418", "pmid:42096001", "pmid:42094143", "pmid:42038259", "pmid:41840142", "pmid:41780084", "pmid:41689662", "pmid:41614301", "pmid:41592538", "pmid:41532091", "pmid:41426430", "pmid:41327893", "pmid:41322202", "pmid:41278766", "pmid:41145152", "pmid:41118032", "pmid:41084404", "pmid:41074692", "pmid:41055766", "pmid:40898875", "pmid:40894141", "pmid:40802152", "pmid:40765612", "pmid:40637932", "pmid:40595562", "pmid:40594369", "pmid:40488180", "pmid:40481300", "pmid:40461673", "pmid:40417743", "pmid:40313272", "pmid:40273470", "pmid:40221271", "pmid:40211677", "pmid:40204545", "pmid:40141365", "pmid:40113266", "pmid:40007153", "pmid:39812846", "pmid:39721397", "pmid:39571249", "pmid:39543176", "pmid:39507594", "pmid:39416949", "pmid:39406499", "pmid:39342186", "pmid:39286915", "pmid:39231235", "pmid:39219417", "pmid:39152783", "pmid:39076534", "pmid:38978724", "pmid:38916676", "pmid:38789445", "pmid:38579416", "pmid:38487929", "pmid:38447794", "pmid:38381906", "pmid:38381176", "pmid:38324175", "pmid:38311638", "pmid:38306376", "pmid:38266156", "pmid:38193360", "pmid:38168171", "pmid:38145611", "pmid:38062616", "pmid:38054570", "pmid:37917284", "pmid:37892228", "pmid:37853169", "pmid:37747091", "pmid:37660923", "pmid:37578187", "pmid:37546920", "pmid:37476326", "pmid:37460231", "pmid:37414537", "pmid:37399286", "pmid:36805468", "pmid:36753892", "pmid:36705320", "pmid:36381255", "pmid:36289003", "pmid:36250766", "pmid:36227727", "pmid:36214978", "pmid:36177974", "pmid:36088850", "pmid:36061987", "pmid:36046423", "pmid:36034314", "pmid:35884855", "pmid:35883251", "pmid:35864213", "pmid:35633373", "pmid:35585435", "pmid:35502508", "pmid:35355059", "pmid:35306791", "pmid:35253317", "pmid:38835435", "pmid:35013364", "pmid:34968871", "pmid:34927205", "pmid:34600502", "pmid:34537679", "pmid:34101140", "pmid:33969391", "pmid:33940977", "pmid:33884451", "pmid:33807868", "pmid:33745133", "pmid:33666721", "pmid:33495376", "pmid:33188504", "pmid:33103729", "pmid:33068477", "pmid:33068476", "pmid:32949124", "pmid:32939785", "pmid:32910249", "pmid:32873692", "pmid:32732387", "pmid:32694621", "pmid:32682126", "pmid:32582864", "pmid:32151945", "pmid:32066831", "pmid:32040566", "pmid:31824583", "pmid:31817852", "pmid:31370354", "pmid:30926972", "pmid:25648260", "pmid:25007187", "pmid:24686188", "pmid:22086855", "pmid:15457444", "pmid:12556494"] -}, -{ - "id": "OPDM4_RILPL1", - "disease_id": "OPDM4", - "gene": "RILPL1", - "evidence": ["Moderate"], - "chrom": "chr12", - "start_hg38": 123533720, - "stop_hg38": 123533750, - "start_hg19": 124018267, - "stop_hg19": 124018297, - "start_t2t": 123532573, - "stop_t2t": 123532603, - "disease": "Oculopharyngodistal myopathy type 4", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Population dependent: 21.6% of one OPDM cohort [@pmid:35148830]. Typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 18-30 [@pmid:35148830]; Range: 10-30 [@pmid:35700120].", - "age_onset_min": 10.0, - "age_onset_max": 30.0, - "typ_age_onset_min": 18.0, - "typ_age_onset_max": 30.0, - "details": "Benign alleles have been documented to have 6-16 repeats [@pmid:37864208], while pathogenic repeats range from 120 to 197 repeats; there is no apparent relationship between allele size and age of onset [@pmid:37864208; @pmid:35148830]. Intermediate alleles may be associated with incomplete penetrance, or milder phenotypes [@pmid:35148830]. AGG, TGG, and CGT interruptions observed [@pmid:35148830; @pmid:35700120].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to RNA-mediated gain-of-function mechanism [@pmid:38467784].", - "year": "2022 [@pmid:35148830]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GGC"], - "pathogenic_motif_reference_orientation": ["GGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["TGG", "CGT", "AGG"], - "pathogenic_motif_gene_orientation": ["CCG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["ACC", "ACG", "CCT"], - "locus_structure": [], - "benign_min": 6, - "benign_max": 16, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 120, - "pathogenic_max": 197, - "motif_len": 3, - "ref_copies": 11.7, - "novel": "ref", - "gard": ["12592"], - "genereviews": [], - "malacard": ["OCL085"], - "medgen": ["1809981"], - "mondo": ["0030712"], - "omim": [], - "orphanet": ["98897"], - "gnomad": ["RILPL1"], - "stripy": ["RILPL1"], - "tr_atlas": ["TR121403"], - "webstr_hg38": ["5128610", "609239"], - "webstr_hg19": ["STR_347096"], - "locus_tags": [], - "disease_tags": ["oculopharyngodistal_myopathy"], - "references": ["pmid:35148830", "pmid:35700120", "pmid:38467784", "pmid:37864208", "pmid:38876750"], - "additional_literature": ["pmid:41792844", "pmid:40645757", "pmid:40084170", "pmid:39044557", "pmid:39013564", "pmid:37923380"] -}, -{ - "id": "CCD_RUNX2", - "disease_id": "CCD", - "gene": "RUNX2", - "evidence": ["Definitive"], - "chrom": "chr6", - "start_hg38": 45422750, - "stop_hg38": 45422801, - "start_hg19": 45390487, - "stop_hg19": 45390538, - "start_t2t": 45257567, - "stop_t2t": 45257618, - "disease": "Cleidocranial dysplasia", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "A condition that primarily affects the development of the bones and teeth. Characteristic features include underdeveloped or absent collarbones (clavicles); dental abnormalities; and delayed closing of the spaces between the skull bones (fontanels). Other features may include decreased bone density (osteopenia), osteoporosis, hearing loss, bone abnormalities of the hands, and recurrent sinus and ear infections [@mondo:0007340].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "All conditions 1/1,000,000 births (likely underdiagnosed); Utah population frequency 0.12/10,000. Found in many ethnic groups [@orphanet:1452]. TR expansions causative in 2 individuals [@genereviews:NBK535148].", - "age_onset": "0 (birth) [@genereviews:NBK1513].", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (4-17 repeats) established from gnomAD and primary literature; pathogenic ranges (20-27) reflect two clinical cases to date [@gnomad:RUNX2; @pmid:26220009]. Intermediate alleles (i.e, 18 repeats; 19 not reported) appear to not be associated with disease [@pmid:20560987; @pmid:26220009]. The gene RUNX2 was previously called CBFA1, as reflected in some of the literature [@pmid:9182765].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansion leading to haploinsufficiency [@pmid:26220009].", - "year": "Causation identified in 2015 [@pmid:26220009]; clinical association found in 1997 [@pmid:9182765]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 17, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 20, - "pathogenic_max": 27, - "motif_len": 3, - "ref_copies": 15.0, - "novel": "ref", - "gard": ["6118"], - "genereviews": ["NBK1513"], - "malacard": ["CLD001"], - "medgen": ["3486"], - "mondo": ["0007340"], - "omim": ["119600"], - "orphanet": ["1452"], - "gnomad": ["RUNX2"], - "stripy": ["RUNX2"], - "tr_atlas": ["TR65117"], - "webstr_hg38": ["5789216"], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["genereviews:NBK1513", "pmid:26220009", "gnomad:RUNX2", "pmid:20560987", "pmid:9182765", "orphanet:1452", "genereviews:NBK535148", "mondo:0007340"], - "additional_literature": ["pmid:41468806", "pmid:40585427", "pmid:37365568", "pmid:37202645", "pmid:32386547", "pmid:24497578", "pmid:22912713", "pmid:21887706", "pmid:19264154"] -}, -{ - "id": "FAME1_SAMD12", - "disease_id": "FAME1", - "gene": "SAMD12", - "evidence": ["Definitive"], - "chrom": "chr8", - "start_hg38": 118366812, - "stop_hg38": 118366918, - "start_hg19": 119379051, - "stop_hg19": 119379157, - "start_t2t": 119495247, - "stop_t2t": 119495353, - "disease": "Familial adult myoclonic epilepsy type 1", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical myoclonus, with seizures in up to a half of patients [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. Typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 21-39 [@pmid:29939203]; Range: 8 [@pmid:40503331] - 68 [@pmid:29507423].", - "age_onset_min": 8.0, - "age_onset_max": 68.0, - "typ_age_onset_min": 21.0, - "typ_age_onset_max": 39.0, - "details": "Novel, pathogenic alleles include expansions of TTTTAn + TTTCAn, but only the TTTCA insertion is specific to affected individuals and associated with symptom age of onset [@pmid:39569876]; pathogenic expansions range from 105 to 3860 repeats [@omim:601068; @pmid:29507423]", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA mediated gain of function proposed [@omim:601068; @pmid:38467784].", - "year": "2018 [@pmid:29507423]", - "location_in_gene": "Intron 4/4", - "gene_strand": "-", - "reference_motif_reference_orientation": ["TAAAA"], - "pathogenic_motif_reference_orientation": ["TGAAA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["AAAAA", "TAAAC", "TAACA", "TACAA", "TACAC"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["TTTTT", "AGTTT", "ATGTT", "ATTGT", "AGTGT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "ADTKD_MUC1", + "disease_id": "ADTKD", + "gene": "MUC1", + "evidence": [ + "Definitive" + ], + "chrom": "chr1", + "start_hg38": 155188505, + "stop_hg38": 155192239, + "start_hg19": 155160981, + "stop_hg19": 155162030, + "start_t2t": 154328121, + "stop_t2t": 154330802, + "disease": "Autosomal dominant tubulointerstitial kidney disease", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function [@mondo:0020726].", + "hpo_terms": null, + "prevalence": "2.5/1000000", + "prevalence_details": "Disease is affected 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease [@genereviews:NBK153723]", + "age_onset": "Age of onset for end-stage renal disease (the only systemic manifestation) ranges from 16 [@pmid:41000883]-70 [@genereviews:NBK153723].", + "age_onset_min": 16, + "age_onset_max": 70, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family [@genereviews:NBK535148]. NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif.", + "detection": "This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475]. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40–83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant [@pmid:41285770]. Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants [@genereviews:NBK153723]. Instead, they are commonly detected by a VNTR assay, or resolved with long-read sequencing [@genereviews:NBK153723; @pmid:29520014].", + "mechanism": "GoF", + "mechanism_detail": "Toxic protein product accumulates in kidneys [@genereviews:NBK153723]", + "year": "2013 [@pmid:23396133]", + "location_in_gene": "Coding Exon 2", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG" + ], + "pathogenic_motif_reference_orientation": [ + "GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA" + ], + "benign_motif_reference_orientation": [ + "GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA" + ], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG" + ], + "benign_motif_gene_orientation": [ + "ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG" + ], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": null, + "pathogenic_max": null, + "motif_len": 1, + "ref_copies": null, + "novel": "ref", + "gard": [ + "7002" + ], + "genereviews": [ + "NBK153723" + ], + "malacard": [ + "TBL032" + ], + "medgen": [ + "358137" + ], + "mondo": [ + "0020726" + ], + "omim": [ + "174000" + ], + "orphanet": [ + "88949" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:41000883", + "genereviews:NBK153723", + "genereviews:NBK535148", + "pmid:23396133", + "pmid:39781475", + "doi:10.1101/2025.03.31.646505", + "mondo:0020726" + ], + "additional_literature": [ + "pmid:41961547", + "pmid:41832605", + "pmid:41345522", + "pmid:40244446", + "pmid:39848530", + "pmid:39576755", + "pmid:39325540", + "pmid:39314239", + "pmid:38605207", + "pmid:37547453", + "pmid:37456840", + "pmid:37316299", + "pmid:35982790", + "pmid:35497811", + "pmid:34641504", + "pmid:34452200", + "pmid:33672244", + "pmid:33001366", + "pmid:32451462", + "pmid:32293552", + "pmid:31213370", + "pmid:30593830", + "pmid:29520014", + "pmid:29328069", + "pmid:29217307", + "pmid:29156055", + "pmid:29052568", + "pmid:28581490", + "pmid:28407289", + "pmid:27957769", + "pmid:27036738", + "pmid:27367740", + "pmid:27340743", + "pmid:27157321", + "pmid:26943180", + "pmid:26838233", + "pmid:26693201", + "pmid:26692014", + "pmid:26498650", + "pmid:25753030", + "pmid:24718884", + "pmid:24509297", + "pmid:24416403", + "pmid:24246952", + "pmid:24233342", + "pmid:23778023", + "pmid:23770070", + "pmid:23652307", + "pmid:23317217", + "pmid:23259747", + "pmid:22970023", + "pmid:21998660", + "pmid:21385452", + "pmid:20876819", + "pmid:20562098", + "pmid:20470225", + "pmid:21637607", + "pmid:19811637", + "pmid:19625949", + "pmid:19534821", + "pmid:18619437", + "pmid:18094420", + "pmid:18021186", + "pmid:17974963", + "pmid:17694298", + "pmid:17581677", + "pmid:17203187", + "pmid:17050588", + "pmid:16711252", + "pmid:16631167", + "pmid:16302687", + "pmid:16101182", + "pmid:15991935", + "pmid:15944787", + "pmid:15814824", + "pmid:15729696", + "pmid:15604091", + "pmid:15387710", + "pmid:15115750", + "pmid:15041735", + "pmid:14871854", + "pmid:14707484", + "pmid:12747745", + "pmid:12646731", + "pmid:12626424", + "pmid:12090474", + "pmid:11923240", + "pmid:11445551", + "pmid:11391628", + "pmid:11358826", + "pmid:11295060", + "pmid:11169964", + "pmid:10797294", + "pmid:10741704", + "pmid:10653872", + "pmid:10652432", + "pmid:10541345", + "pmid:10430099", + "pmid:10389761", + "pmid:10383817", + "pmid:10235488", + "pmid:10206297", + "pmid:10052816", + "pmid:10024673", + "pmid:10022471", + "pmid:9935162", + "pmid:9823312", + "pmid:9755875", + "pmid:9727561", + "pmid:9690452", + "pmid:9591045", + "pmid:9579805", + "pmid:9575675", + "pmid:9551361", + "pmid:9427605", + "pmid:9419405", + "pmid:8967520", + "pmid:8643693", + "pmid:7594478", + "pmid:8579785", + "pmid:8567787", + "pmid:8519447", + "pmid:7628867", + "pmid:7816840", + "pmid:7946402", + "pmid:7514493", + "pmid:7690213", + "pmid:7685318" + ] + }, { - "motif": "TAAAA", - "count": 20, - "type": "internal_repeat" + "id": "NME_NAXE", + "disease_id": "NME", + "gene": "NAXE", + "evidence": [ + "Limited" + ], + "chrom": "chr1", + "start_hg38": 156591765, + "stop_hg38": 156591783, + "start_hg19": 156561557, + "stop_hg19": 156561575, + "start_t2t": 155728131, + "stop_t2t": 155728159, + "disease": "NAXE-related mitochondrial encephalopathy", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Patients with NAXE-related mitochondrial encephalopathy exhibit developmental delay, cognitive regression, altered consciousness, abnormalities in eye movement (including nystagmus), muscle weakness, respiratory failure, seizure, ataxia, and gait disturbance at the age of 1 to 2 years. The disease is characterized by fluctuating symptoms over time, often exacerbated by febrile illness; it is progressive and fatal in the long term [@pmid:39455596].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Single proband found in Japanese cohort [@pmid:39455596].", + "age_onset": "Single repeat expansion case had onset at 13 months, while NAXE-related mitochondrial encephalopathy more generally has predominately infantile onset, extending to 20y or older [@pmid:39455596].", + "age_onset_min": 1, + "age_onset_max": 1, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (2-7) alleles established by 484 control alleles and validated with orthogonal databases, while single proband had expansion of ~200 repeats inherited from mother via uniparental disomy [@pmid:39455596]. While the repeat expansion is newly reported, other variants in the NAXE gene have previously been associated with mitochondrial encephalopathy.", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Reduced NAXE expression from expansion in promoter; hypermethylation was detected at and downstream of the repeat sequence in the proband as well as the maternal copy of the expanded allele, which was not present in the maternal normal range allele nor in the controls [@pmid:39455596]", + "year": "2024 [@pmid:39455596]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGGCC" + ], + "pathogenic_motif_reference_orientation": [ + "GGGCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCGGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 7, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 200, + "pathogenic_max": 200, + "motif_len": 5, + "ref_copies": null, + "novel": "ref", + "gard": [ + "17991" + ], + "genereviews": [], + "malacard": [ + "ENC069" + ], + "medgen": [ + "934642" + ], + "mondo": [ + "0020781" + ], + "omim": [ + "617186" + ], + "orphanet": [ + "555407" + ], + "gnomad": [ + "NAXE" + ], + "stripy": [], + "tr_atlas": [ + "TR7952" + ], + "webstr_hg38": [ + "1184343", + "6351240" + ], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:39455596" + ], + "additional_literature": [ + "pmid:41091881" + ] }, { - "motif": "TGAAA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 105, - "pathogenic_max": 3680, - "motif_len": 5, - "ref_copies": 21.6, - "novel": "novel", - "gard": ["18082"], - "genereviews": ["NBK535148"], - "malacard": ["EPL201"], - "medgen": ["371424"], - "mondo": ["0010985"], - "omim": ["601068"], - "orphanet": ["86814"], - "gnomad": ["SAMD12"], - "stripy": ["SAMD12"], - "tr_atlas": ["TR89226"], - "webstr_hg38": ["1087693"], - "webstr_hg19": [], - "locus_tags": ["somatic_instability", "anticipation", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance", "maternal_expansion"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:29939203", "pmid:40503331", "pmid:29507423", "omim:601068", "pmid:38467784", "pmid:39569876", "pmid:38876750", "pmid:39349043"], - "additional_literature": ["pmid:41874439", "pmid:41850906", "pmid:41426430", "pmid:41219789", "pmid:38961870", "pmid:38467733", "pmid:38059543", "pmid:37592133", "pmid:36740228", "pmid:36622139", "pmid:36092952", "pmid:33791773", "pmid:33721773", "pmid:33681653", "pmid:33501421", "pmid:33040085", "pmid:32973343", "pmid:32203200", "pmid:32194077", "pmid:32174879", "pmid:31664039", "pmid:31483537", "pmid:30559482", "pmid:30351492", "pmid:30194086"] -}, -{ - "id": "XLID_SOX3", - "disease_id": "XLID, PHPX", - "gene": "SOX3", - "evidence": ["Limited"], - "chrom": "chrX", - "start_hg38": 140504316, - "stop_hg38": 140504361, - "start_hg19": 139586481, - "stop_hg19": 139586526, - "start_t2t": 138816203, - "stop_t2t": 138816248, - "disease": "X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX)", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without intellectual disability [@pmid:24346842].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "3 families reported, however they were distributed across the world [@omim:300123].", - "age_onset": "Typical: 0-3 (small sample size) [@pmid:19654509; @pmid:21289259]; range: 0-9 [@pmid:19654509].", - "age_onset_min": 0.0, - "age_onset_max": 9.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148]. There is phenotypic and allelic overlap between XLID and PHPX, with the pathogenic threshold for XLID estimated at 26 motifs and the pathogenic threshold for PHPX estimated at 22 motifs [@pmid:15800844, @pmid:12428212].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to aggresome formation and impaired transcriptional activity [@pmid:17127446].", - "year": "2002 [@pmid:12428212]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["NGC"], - "pathogenic_motif_reference_orientation": ["NGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 26, - "motif_len": 3, - "ref_copies": 15.0, - "novel": "ref", - "gard": [], - "genereviews": ["NBK535148"], - "malacard": ["PNH005", "INT405"], - "medgen": ["394771"], - "mondo": ["0010252"], - "omim": ["300123", "312000"], - "orphanet": ["67045"], - "gnomad": ["SOX3"], - "stripy": ["SOX3"], - "tr_atlas": ["TR173479"], - "webstr_hg38": [], - "webstr_hg19": ["STR_1597784"], - "locus_tags": ["contraction"], - "disease_tags": [], - "references": ["pmid:19654509", "pmid:21289259", "pmid:17127446", "genereviews:NBK535148", "pmid:15800844", "pmid:12428212", "omim:300123", "pmid:24346842"], - "additional_literature": [] -}, -{ - "id": "FAME2_STARD7", - "disease_id": "FAME2", - "gene": "STARD7", - "evidence": ["Strong"], - "chrom": "chr2", - "start_hg38": 96197066, - "stop_hg38": 96197124, - "start_hg19": 96862804, - "stop_hg19": 96862862, - "start_t2t": 96703674, - "stop_t2t": 96703732, - "disease": "Familial adult myoclonic epilepsy 2", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Finger, hand tremor with later-onset myoclonus and generalised tonic-clonic seizures [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "This repeat expansion is typically found in individuals of European ancestry [@pmid:38876750].", - "age_onset": "Typical: 12-30; Range: 4-60 [@pmid:31664034].", - "age_onset_min": 4.0, - "age_onset_max": 60.0, - "typ_age_onset_min": 12.0, - "typ_age_onset_max": 30.0, - "details": "Disease caused by novel insertion of pathogenic motif (not found in any controls); size of pathogenic motif observed in two probands ranged from ~274-558 repeats, while the expanded reference motif ranged from 340-390 [@pmid:31664034].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity theorized [@pmid:31664034; @pmid:38467784].", - "year": "2019 [@pmid:31664034]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["AAAAT"], - "pathogenic_motif_reference_orientation": ["AAATG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AAACC", "AAACG", "AAACT", "AACTC", "AACTG", "AATAC", "AATAG", "ATAAC"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "GGTTT", "CGTTT", "AGTTT", "AGTTG", "AGTTC", "ATTGT", "ATTCT", "ATGTT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "ALS1_NIPA1", + "disease_id": "ALS1", + "gene": "NIPA1", + "evidence": [ + "Disputed" + ], + "chrom": "chr15", + "start_hg38": 22786677, + "stop_hg38": 22786703, + "start_hg19": 23086363, + "stop_hg19": 23086389, + "start_t2t": 20458510, + "stop_t2t": 20458536, + "disease": "Amyotrophic lateral sclerosis", + "inheritance": [ + "AD" + ], + "association_type": [ + "Modifier" + ], + "disease_description": "Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life [@omim:105400].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "2.7-7.4/100,000 for all cases of ALS, NIPA1 + C9orf72 is 0.37% of ALS patients; frequency of NIPA1 expansion in controls is 3.74% [@pmid:31286297]. The NIPA1 expansion is associated with disease globally [@pmid:30342764], but likely unassociated in African probands [@pmid:34179866].", + "age_onset": "Typical: 44-60 [@pmid:26777436]; Range: 25 [@pmid:22378146] - 77 [@pmid:26777436].", + "age_onset_min": 25, + "age_onset_max": 77, + "typ_age_onset_min": 44, + "typ_age_onset_max": 60, + "details": "Allelic ranges taken from STRipy based on primary literature [@stripy:NIPA1]. Currently proposed as a modifier for ALS [@pmid:31286297]. Note: the motif for this locus is CGG in hg38 and T2T reference genomes, while in hg19, the motif is the reverse complement CCG because it is on the negative strand. GCA, GCT, and GCC interruptions have been reported [@pmid:40585427].", + "detection": null, + "mechanism": null, + "mechanism_detail": null, + "year": "2019 [@pmid:30342764]", + "location_in_gene": "Coding Exon 1/Intron 1 depending on transcript", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCG" + ], + "pathogenic_motif_reference_orientation": [ + "GCG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "GCA", + "GCT", + "GCC" + ], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AGC", + "CTG", + "CCG" + ], + "locus_structure": [], + "benign_min": 6, + "benign_max": 10, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 11, + "pathogenic_max": 56, + "motif_len": 3, + "ref_copies": 10.7, + "novel": "ref", + "gard": [ + "5786" + ], + "genereviews": [], + "malacard": [ + "FRN044" + ], + "medgen": [ + "400169" + ], + "mondo": [ + "0007103" + ], + "omim": [ + "105400" + ], + "orphanet": [ + "282", + "803" + ], + "gnomad": [ + "NIPA1" + ], + "stripy": [ + "NIPA1" + ], + "tr_atlas": [ + "TR133649" + ], + "webstr_hg38": [ + "5135087" + ], + "webstr_hg19": [], + "locus_tags": [ + "proposed_modifier" + ], + "disease_tags": [], + "references": [ + "pmid:26777436", + "pmid:22378146", + "stripy:NIPA1", + "pmid:31286297", + "pmid:40585427", + "pmid:30342764", + "pmid:34179866", + "omim:105400" + ], + "additional_literature": [ + "pmid:41426430", + "pmid:38667292", + "pmid:37043475", + "pmid:35869263", + "pmid:33414559", + "pmid:32954321", + "pmid:24866401", + "pmid:21419568", + "pmid:11839840", + "pmid:10987648", + "pmid:9736780" + ] + }, { - "motif": "AAATG", - "count": null, - "type": "pathogenic_repeat" + "id": "SCA36_NOP56", + "disease_id": "SCA36", + "gene": "NOP56", + "evidence": [ + "Definitive" + ], + "chrom": "chr20", + "start_hg38": 2652732, + "stop_hg38": 2652757, + "start_hg19": 2633378, + "stop_hg19": 2633403, + "start_t2t": 2683189, + "stop_t2t": 2683230, + "disease": "Spinocerebellar ataxia type 36", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 36 (SCA36) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1) characterized by gait and limb ataxia, lower limb spasticity, dysarthria, muscle fasciculations, tongue atrophy and hyperreflexia [@mondo:0013594].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Western Japan: 3.6% of all SCA; Costa da Morte region of Spain: 6.3% of all SCA [@pmid:37332636]; US: 0.7% of large undiagnosed ataxia cohort [@pmid:28761930]. Found across ancestries/ethnicities [@omim:614153].", + "age_onset": "Typical: 40-60 [@pmid:25101480]; Range: 28 [@pmid:37810464] - 67 [@pmid:37332636].", + "age_onset_min": 28, + "age_onset_max": 67, + "typ_age_onset_min": 40, + "typ_age_onset_max": 60, + "details": "Benign alleles range from 3-14 repeats and pathogenic alleles (650+ repeats) appear fully penetrant; the significance of intermediate alleles has yet to be elucidated [@pmid:25101480]. Interruptions documented: GGCTG, GGCCCTG, GGCCG, and GGCCTTG [@pmid:37051597].", + "detection": "RP-PCR with fragment analysis has been used to detect these expansions [@pmid:21683323]. Long-read sequencing has accurately sized alleles [@pmid:37051597].", + "mechanism": "GoF", + "mechanism_detail": "Toxic protein gain-of-function, RAN translation [@omim:614153].", + "year": "2011 [@pmid:21683323]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGCCTG" + ], + "pathogenic_motif_reference_orientation": [ + "GGCCTG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "GGCTG", + "GGCCCTG", + "GGCCG", + "GGCCTT" + ], + "pathogenic_motif_gene_orientation": [ + "CCTGGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "CTGGG", + "CCCTGGG", + "CCGGG", + "CCTTGG" + ], + "locus_structure": [ + { + "motif": "GGCCTG", + "count": null, + "type": "pathogenic_repeat" + }, + { + "motif": "CGCCTG", + "count": 3, + "type": "flank_repeat" + } + ], + "benign_min": 3, + "benign_max": 14, + "intermediate_min": 15, + "intermediate_max": 649, + "pathogenic_min": 650, + "pathogenic_max": 2500, + "motif_len": 6, + "ref_copies": 7.2, + "novel": "ref", + "gard": [ + "12367" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "SPN265" + ], + "medgen": [ + "483339" + ], + "mondo": [ + "0013594" + ], + "omim": [ + "614153" + ], + "orphanet": [ + "276198" + ], + "gnomad": [ + "NOP56" + ], + "stripy": [ + "NOP56" + ], + "tr_atlas": [ + "TR157810", + "TR157811" + ], + "webstr_hg38": [ + "6177296", + "890490" + ], + "webstr_hg19": [ + "STR_833720" + ], + "locus_tags": [ + "somatic_instability", + "length_affects_onset", + "length_affects_severity" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "pmid:25101480", + "pmid:37810464", + "pmid:37332636", + "omim:614153", + "pmid:37051597", + "pmid:28761930", + "pmid:21683323", + "mondo:0013594" + ], + "additional_literature": [ + "pmid:42038259", + "pmid:41337098", + "pmid:41074692", + "pmid:40898875", + "pmid:40765612", + "pmid:40488180", + "pmid:40015643", + "pmid:40004498", + "pmid:38961870", + "pmid:38934198", + "pmid:38811808", + "pmid:38667292", + "pmid:38227102", + "pmid:36599645", + "pmid:36572080", + "pmid:36530930", + "pmid:35599735", + "pmid:35077744", + "pmid:34179866", + "pmid:33705846", + "pmid:32989102", + "pmid:32407596", + "pmid:32375063", + "pmid:32375043", + "pmid:32270466", + "pmid:31737797", + "pmid:30610877", + "pmid:30109267", + "pmid:29316893", + "pmid:29281254", + "pmid:28918022", + "pmid:27123487", + "pmid:26661328", + "pmid:25476002", + "pmid:24985895", + "pmid:24269018", + "pmid:22744658", + "pmid:22492559" + ] }, { - "motif": "AAAAT", - "count": 11, - "type": "internal_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 274, - "pathogenic_max": 558, - "motif_len": 5, - "ref_copies": 11.6, - "novel": "novel", - "gard": ["18083"], - "genereviews": ["NBK535148"], - "malacard": ["EPL203"], - "medgen": ["375031"], - "mondo": ["0011930"], - "omim": ["607876"], - "orphanet": ["86814"], - "gnomad": ["STARD7"], - "stripy": ["STARD7"], - "tr_atlas": ["TR19329"], - "webstr_hg38": ["286156"], - "webstr_hg19": ["STR_754470"], - "locus_tags": ["somatic_instability", "motif_affects_instability", "motif_affects_penetrance"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:31664034", "pmid:38467784", "pmid:38876750", "pmid:39349043"], - "additional_literature": ["pmid:41219789", "pmid:33040085"] -}, -{ - "id": "XDP_TAF1", - "disease_id": "XDP", - "gene": "TAF1", - "evidence": ["Definitive"], - "chrom": "chrX", - "start_hg38": 71453054, - "stop_hg38": 71453131, - "start_hg19": 70672904, - "stop_hg19": 70672981, - "start_t2t": 69887153, - "stop_t2t": 69887230, - "disease": "X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3)", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "X-linked dystonia-parkinsonism (XDP) associated with antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron of TAF1. Clinical features include focal and generalised dystonia, parkinsonism, cognitive dysfunction. XX individuals who are heterozygous carriers usually do not develop the full syndrome, although some patients have non-progressive focal dystonia with parkinsonism. Disease severity is associated with number of hexanucleotide repeats within the SVA. (Adapted) [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Philippines overall 0.34:100,000. Panay Islands 5.24:100,000. Capiz province 18.9:100,000. To date, all known cases to date are of Filipino descent [@pmid:38876750].", - "age_onset": "Average age of onset for XDP is 39.7 years in males, 52 years in females, range 12-79 years. ~99% of cases are male [@pmid:29229810; @pmid:38876750; @pmid:15596620].", - "age_onset_min": 12.0, - "age_onset_max": 79.0, - "typ_age_onset_min": 39.7, - "typ_age_onset_max": 39.7, - "details": "Strong inverse relationship between age of onset and insertion length, which varied between 35-52 repeats [@pmid:29229810].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Altered splicing with intron retention, haploinsufficiency [@pmid:38876750].", - "year": "2017 [@pmid:29229810]", - "location_in_gene": "Intron 32", - "gene_strand": "+", - "reference_motif_reference_orientation": ["AGAGGG"], - "pathogenic_motif_reference_orientation": ["AGAGGG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGAGGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 35, - "pathogenic_max": 52, - "motif_len": 6, - "ref_copies": 4.0, - "novel": "ref", - "gard": ["10533"], - "genereviews": ["NBK1489"], - "malacard": ["DYS064"], - "medgen": ["326820"], - "mondo": ["0010747"], - "omim": ["314250"], - "orphanet": ["53351"], - "gnomad": [], - "stripy": [], - "tr_atlas": ["TR592600"], - "webstr_hg38": ["861907"], - "webstr_hg19": ["STR_1564408"], - "locus_tags": ["length_affects_onset"], - "disease_tags": [], - "references": ["pmid:29229810", "pmid:38876750", "pmid:15596620"], - "additional_literature": ["pmid:41443196", "pmid:40463055", "pmid:38834915", "pmid:38616406", "pmid:37234925", "pmid:35971992", "pmid:38835911", "pmid:35868859", "pmid:35481544", "pmid:35395816", "pmid:38835428", "pmid:34250228", "pmid:34111553", "pmid:32533168", "pmid:32152096", "pmid:27806289", "pmid:18952144", "pmid:18713817", "pmid:17273961", "pmid:7668293", "pmid:7829058", "pmid:1518853"] -}, -{ - "id": "OPDM_TBC1D7", - "disease_id": "OPDM", - "gene": "TBC1D7", - "evidence": ["Provisional"], - "chrom": "chr6", - "start_hg38": 13328476, - "stop_hg38": 13328603, - "start_hg19": 13328708, - "stop_hg19": 13328835, - "start_t2t": 13201716, - "stop_t2t": 13201843, - "disease": "Oculopharyngodistal myopathy", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "This is a newly proposed locus for OPDM, only having been reported in one paper [@pmid:41959811]. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in 3 families (7 total patients) of European ancestry [@pmid:41959811].", - "age_onset": "2nd to 6th decade (3/5 patients had onset in 2nd decade). Referred to as adult onset, so assuming high end of 2nd decade [@pmid:41959811]", - "age_onset_min": 18.0, - "age_onset_max": 59.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (0-60) estimated from population data and pathogenic range (83-148) gathered from 7 patients from 3 unrelated families [@pmid:41959811]. The hg38 coordinates reported in the paper (chr6:13328476-13328603) [@pmid:41959811] contain multiple annotated TRs and interruptions, so the true coordinates are likely more narrow.", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Gain of Function apparent, but mechanism is unknown. Methylation and RAN translation have been oberserved [@pmid:41959811].", - "year": "2026 [@pmid:41959811]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 0, - "benign_max": 60, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 83, - "pathogenic_max": 148, - "motif_len": 3, - "ref_copies": null, - "novel": "ref", - "gard": ["12592"], - "genereviews": [], - "malacard": [], - "medgen": ["320250"], - "mondo": [], - "omim": ["612655"], - "orphanet": ["98897"], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": ["oculopharyngodistal_myopathy"], - "references": ["pmid:41959811", "mondo:0025193"], - "additional_literature": [] -}, -{ - "id": "SCA17_TBP", - "disease_id": "SCA17", - "gene": "TBP", - "evidence": ["Definitive"], - "chrom": "chr6", - "start_hg38": 170561906, - "stop_hg38": 170562017, - "start_hg19": 170870994, - "stop_hg19": 170871105, - "start_t2t": 171935458, - "stop_t2t": 171935569, - "disease": "Spinocerebellar ataxia type 17", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "A rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by a variable clinical picture which can include dementia, psychiatric disorders, parkinsonism, dystonia, chorea, spasticity, and epilepsy [@mondo:0011781].", - "hpo_terms": null, - "prevalence": "0.2/100000", - "prevalence_details": "Unknown (global), <100 families, 0.47:1,000,000 (Japanese), 0.16/100,000 (England) [@genereviews:NBK1438; @pmid:29100084]: 0.2/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1438].", - "age_onset": "Typical: 19-48; Range: 3-62, has second variant to delay onset [@omim:607136].", - "age_onset_min": 3.0, - "age_onset_max": 62.0, - "typ_age_onset_min": 19.0, - "typ_age_onset_max": 48.0, - "details": "Benign range is 25-40 repeats, pathogenic range is 49+ repeats (largest to date 66 motifs, with mild correlation between size and age of onset), and intermediate alleles (41-48 repeats) are associated with reduced penetrance and potentially milder phenotypes [@genereviews:NBK1438]. Huntington's disease-like phenotype [@pmid:12805114]. CAA CAG CAA interruption is seen in all alleles stably transmitted across generations [@genereviews:NBK1438;@pmid:35245110].", - "detection": "Short-read sequencing is reported to detect expansions but cannot size alleles beyond 250 bp. PCR amplification may detect expansions of ≤66 repeats [@pmid:37906407; @genereviews:NBK1438].", - "mechanism": "LoF/GoF", - "mechanism_detail": "Polyglutamine expansion leading to transcriptional dysregulation [@pmid:35053321].", - "year": "1999 [@pmid:10484774]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["CAA"], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AAC"], - "locus_structure": [], - "benign_min": 25, - "benign_max": 40, - "intermediate_min": 41, - "intermediate_max": 48, - "pathogenic_min": 49, - "pathogenic_max": 66, - "motif_len": 3, - "ref_copies": 37.0, - "novel": "ref", - "gard": ["10469"], - "genereviews": ["NBK1438"], - "malacard": ["SPN296"], - "medgen": ["337637"], - "mondo": ["0011781"], - "omim": ["607136"], - "orphanet": ["98759"], - "gnomad": ["TBP"], - "stripy": ["TBP"], - "tr_atlas": ["TR72502"], - "webstr_hg38": ["83566"], - "webstr_hg19": [], - "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "motif_affects_instability"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["omim:607136,@pmid:35053321,@genereviews:NBK1438,@pmid:12805114,@genereviews:NBK1438", "pmid:35245110,@genereviews:NBK1438,@pmid:29100084,@pmid:10484774,@mondo:0011781"], - "additional_literature": ["pmid:42196324", "pmid:42038259", "pmid:41843312", "pmid:41762523", "pmid:41612618", "pmid:41009775", "pmid:40488180", "pmid:40478462", "pmid:39950762", "pmid:39820777", "pmid:39680235", "pmid:39456985", "pmid:39125760", "pmid:38973070", "pmid:38961870", "pmid:38494459", "pmid:37855597", "pmid:37632648", "pmid:37146135", "pmid:36599645", "pmid:36476347", "pmid:36422518", "pmid:35926480", "pmid:35868859", "pmid:35493319", "pmid:35482253", "pmid:35275350", "pmid:35182509", "pmid:34906452", "pmid:34600502", "pmid:34565721", "pmid:34256333", "pmid:34235484", "pmid:33502644", "pmid:33377399", "pmid:32675418", "pmid:32533168", "pmid:32386547", "pmid:31940111", "pmid:31919387", "pmid:31522753", "pmid:30920184", "pmid:30891880", "pmid:30617627", "pmid:30615214", "pmid:30532692", "pmid:30314815", "pmid:30120431", "pmid:29801887", "pmid:29564144", "pmid:29249939", "pmid:29057148", "pmid:28821675", "pmid:28585930", "pmid:28444220", "pmid:28153533", "pmid:27865706", "pmid:27400454", "pmid:27172828", "pmid:26476771", "pmid:26387956", "pmid:26374734", "pmid:26267067", "pmid:26077168", "pmid:25672822", "pmid:24972706", "pmid:24677642", "pmid:24534762", "pmid:23665119", "pmid:23475385", "pmid:21710129", "pmid:21562248", "pmid:21437269", "pmid:20587494", "pmid:20199210", "pmid:20004653", "pmid:19595623", "pmid:19566714", "pmid:18218637", "pmid:18043721", "pmid:17961920", "pmid:17420317", "pmid:17273961", "pmid:17033685", "pmid:16858508", "pmid:16626296", "pmid:16223509", "pmid:16054804", "pmid:15850778", "pmid:15533937", "pmid:15503103", "pmid:15381080", "pmid:15365789", "pmid:15225551", "pmid:15193429", "pmid:14985389", "pmid:14967767", "pmid:12953269", "pmid:12891385", "pmid:12853230", "pmid:12758065", "pmid:11939898", "pmid:11571212", "pmid:11313753", "pmid:9399691", "pmid:8886170", "pmid:7892196", "pmid:8503450"] -}, -{ - "id": "TOF_TBX1", - "disease_id": "TOF", - "gene": "TBX1", - "evidence": ["Limited"], - "chrom": "chr22", - "start_hg38": 19766762, - "stop_hg38": 19766807, - "start_hg19": 19754285, - "stop_hg19": 19754330, - "start_t2t": 20143615, - "stop_t2t": 20143660, - "disease": "Tetralogy of Fallot", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Tetralogy of Fallot is a congenital cardiac malformation that consists of an interventricular communication, also known as a ventricular septal defect, obstruction of the right ventricular outflow tract, override of the ventricular septum by the aortic root, and right ventricular hypertrophy [@mondo:0008542].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in one Turkish individual [@genereviews:NBK535148].", - "age_onset": "0", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Found in one Turkish individual with Tetralogy of Fallot who had 25 repeats rather than 15 [@genereviews:NBK535148].", - "detection": null, - "mechanism": "LoF/GoF", - "mechanism_detail": "Polyalanine expansion, leading to cytoplasmic aggregation [@omim:187500; @pmid:19948535].", - "year": "2010 [@pmid:19948535]", - "location_in_gene": "Coding Exon 9", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 25, - "pathogenic_max": 25, - "motif_len": 3, - "ref_copies": 15.0, - "novel": "ref", - "gard": ["2245"], - "genereviews": ["NBK535148"], - "malacard": ["TTR001"], - "medgen": ["21498"], - "mondo": ["0008542"], - "omim": ["187500"], - "orphanet": ["3303"], - "gnomad": ["TBX1"], - "stripy": ["TBX1"], - "tr_atlas": ["TR163862"], - "webstr_hg38": ["4900984"], - "webstr_hg19": ["STR_889797"], - "locus_tags": [], - "disease_tags": [], - "references": ["omim:187500", "pmid:19948535", "genereviews:NBK535148", "mondo:0008542"], - "additional_literature": ["pmid:41607489", "pmid:24797903", "pmid:16141220", "pmid:10440825"] -}, -{ - "id": "FECD3_TCF4", - "disease_id": "FECD3", - "gene": "TCF4", - "evidence": ["Definitive"], - "chrom": "chr18", - "start_hg38": 55586153, - "stop_hg38": 55586229, - "start_hg19": 53253384, - "stop_hg19": 53253460, - "start_t2t": 55789233, - "stop_t2t": 55789288, - "disease": "Fuchs endothelial corneal dystrophy 3", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Late-onset Fuchs endothelial corneal dystrophy (FECD) is a degenerative disorder ... distinguished from other corneal disorders by the progressive formation of guttae [@omim:613267]. Studies suggest that disease severity increases in women with greater lifetime exposure to oestrogen [@pmid:40374208].", - "hpo_terms": null, - "prevalence": "4.5/100", - "prevalence_details": "~4/100 (over 40) [@omim:613267]; 5/100 [@pmid:20825314]. Predominantly in women (~75%) [@pmid:16769829]. In one study of two cohorts (Dallas Heart Study and 1000 Genomes Project), expanded allele carrier rates were 3.1% (African American), 8.1% (European American), and 3.3% (Latinos)in DHS, and 2.7% (AFR), 9.5% (EUR), 5.2% (East Asians), 7.2% (South Asians), and 5.2% (admixed Americans) in 1KGP [@pmid:39669694]. The highest carrier prevalence (12.1%–12.5%) occurred in EUR and admixed American subpopulations, while rates were 0%–1.9% in West Africans vs 6.2% in a Kenyan subpopulation.", - "age_onset": "Typical: 40-59 [@pmid:1676829]; Range: 32 [@pmid:21245398] - 79 [@pmid:39998965].", - "age_onset_min": 32.0, - "age_onset_max": 79.0, - "typ_age_onset_min": 40.0, - "typ_age_onset_max": 59.0, - "details": "Most controls have <40 repeats while majority of patients have >50 repeats; penetrance is <100%, as unaffected individuals have been documented with >80 repeats and alleles of affected individuals range from 12-2600 [@genereviews:NBK535148; @pmid:25168903]. Expansions are causative in approximately 70% of disease cases [@genereviews:NBK535148].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Sequestration of MBNL1 in RNA foci, similar to the mechanism underlying myotonic dystrophy-1 [@pmid:25593321]. Variation in RAN translation [@pmid:38467784].", - "year": "2012 [@pmid:23185296]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CTG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 39, - "intermediate_min": 40, - "intermediate_max": 50, - "pathogenic_min": 51, - "pathogenic_max": 2600, - "motif_len": 3, - "ref_copies": 25.3, - "novel": "ref", - "gard": ["10018"], - "genereviews": ["NBK535148"], - "malacard": ["FCH001", "CRN120"], - "medgen": ["442479"], - "mondo": ["0013203"], - "omim": ["613267"], - "orphanet": ["98974"], - "gnomad": ["TCF4"], - "stripy": ["TCF4"], - "tr_atlas": ["TR151784"], - "webstr_hg38": ["6247607", "463325"], - "webstr_hg19": [], - "locus_tags": ["length_affects_penetrance"], - "disease_tags": [], - "references": ["pmid:1676829", "pmid:21245398", "pmid:39998965", "pmid:25593321", "pmid:38467784", "genereviews:NBK535148", "pmid:25168903", "omim:613267", "pmid:20825314", "pmid:16769829", "pmid:39669694", "pmid:23185296", "pmid:40374208"], - "additional_literature": ["pmid:42180433", "pmid:42010886", "pmid:41944554", "pmid:41944537", "pmid:41865104", "pmid:41736702", "pmid:41713739", "pmid:41562921", "pmid:41533935", "pmid:41501457", "pmid:41373515", "pmid:41344296", "pmid:41298634", "pmid:41074692", "pmid:40961119", "pmid:40852795", "pmid:40767442", "pmid:40720054", "pmid:40585427", "pmid:40268158", "pmid:40081749", "pmid:40048186", "pmid:39651202", "pmid:39332053", "pmid:39288343", "pmid:39278108", "pmid:39231626", "pmid:38713708", "pmid:38704483", "pmid:38300219", "pmid:37747538", "pmid:37204786", "pmid:37169279", "pmid:36883248", "pmid:36773096", "pmid:36701310", "pmid:36275201", "pmid:36250467", "pmid:34946954", "pmid:34946867", "pmid:34855896", "pmid:34698281", "pmid:34644448", "pmid:33782268", "pmid:36246012", "pmid:33116252", "pmid:32934897", "pmid:32639312", "pmid:31554942", "pmid:31469403", "pmid:31276570", "pmid:30973406", "pmid:30811544", "pmid:30733599", "pmid:30267097", "pmid:30122888", "pmid:30098193", "pmid:29966009", "pmid:29799290", "pmid:29526280", "pmid:29325021", "pmid:29196769", "pmid:29044056", "pmid:28886202", "pmid:28832669", "pmid:28608272", "pmid:28118661", "pmid:27755191", "pmid:26401622", "pmid:26218914", "pmid:26200491", "pmid:25722209", "pmid:25298419", "pmid:24255041", "pmid:20960280", "pmid:11526470", "pmid:10712198", "pmid:10395212"] -}, -{ - "id": "SCA_THAP11", - "disease_id": "SCA51", - "gene": "THAP11", - "evidence": ["Strong"], - "chrom": "chr16", - "start_hg38": 67842862, - "stop_hg38": 67842950, - "start_hg19": 67876765, - "stop_hg19": 67876853, - "start_t2t": 73638636, - "stop_t2t": 73638724, - "disease": "Spinocerebellar ataxia 51", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "THAP11-caused SCA involves symptoms including gait ataxia, dysarthria, dysphagia, slow saccades, ptosis, and/or nystagmus [@pmid:37148549].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Has been observed in Chinese families [@pmid:37148549; @pmid:24677642]. Interruptions predisposing to expansion/disease appear to vary by ancestry [@pmid:39651830].", - "age_onset": "Typical: 8-40 (small sample size); Range: 4-51 [@pmid:37148549].", - "age_onset_min": 4.0, - "age_onset_max": 51.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Expansion (45-100 repeats) found in affected individuals from 2 families and not in 500 controls (benign range: 20-38 repeats) [@pmid:37148549]. Longer alleles were associated with earlier age of onset. For example, an individual with 100 repeats had age of onset at 4 years. CAA interruptions can reduce toxicity [@pmid:37148549; @pmid:37148549].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to gain of function toxicity [@pmid:37148549; @pmid:38467784].", - "year": "2023 [@pmid:37148549]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["CAG"], - "pathogenic_motif_reference_orientation": ["CAG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": ["CAA"], - "pathogenic_motif_gene_orientation": ["AGC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": ["AAC"], - "locus_structure": [], - "benign_min": 20, - "benign_max": 38, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 45, - "pathogenic_max": 100, - "motif_len": 3, - "ref_copies": 29.3, - "novel": "ref", - "gard": ["10748"], - "genereviews": [], - "malacard": [], - "medgen": ["431598"], - "mondo": [], - "omim": ["620947"], - "orphanet": [], - "gnomad": ["THAP11"], - "stripy": [], - "tr_atlas": ["TR142069"], - "webstr_hg38": ["814002", "5973136"], - "webstr_hg19": ["STR_540982"], - "locus_tags": ["anticipation", "length_affects_onset", "length_affects_severity", "motif_affects_onset", "motif_affects_severity"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["pmid:37148549", "pmid:38467784", "pmid:24677642", "pmid:39651830"], - "additional_literature": ["pmid:40886825", "pmid:40488180", "pmid:15368101"] -}, -{ - "id": "FAME6_TNRC6A", - "disease_id": "FAME6", - "gene": "TNRC6A", - "evidence": ["Limited"], - "chrom": "chr16", - "start_hg38": 24613438, - "stop_hg38": 24613532, - "start_hg19": 24624759, - "stop_hg19": 24624853, - "start_t2t": 24890366, - "stop_t2t": 24890430, - "disease": "Familial adult myoclonic epilepsy type 6", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Limited clinical details from one family, 'early 20s to 70s'", - "age_onset_min": 23.0, - "age_onset_max": 74.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Novel, reported pathogenic alleles: (TTTTA)22 (TTTCA)exp (TTTTA)exp, but only the TTTCA is specific to affected individuals (size: 1100 repeats). Non-pathogenic reference TTTTA repeat was expanded in nine healthy subjects 40-120 repeats and in two individuals was potentially even longer [@pmid:29507423].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423; @pmid:38467784].", - "year": "2018 [@pmid:29507423]", - "location_in_gene": "Intron 1/23", - "gene_strand": "+", - "reference_motif_reference_orientation": ["TTTTA"], - "pathogenic_motif_reference_orientation": ["TTTCA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["TTTTT"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["TTTTT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "NIID_NOTCH2NLC", + "disease_id": "NIID", + "gene": "NOTCH2NLC", + "evidence": [ + "Definitive" + ], + "chrom": "chr1", + "start_hg38": 149390802, + "stop_hg38": 149390842, + "start_hg19": 145209323, + "stop_hg19": 145209354, + "start_t2t": 148519695, + "stop_t2t": 148519738, + "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which can precede neurologic manifestations by decades in one documented case [pmid:41929501]. Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms [@pmid:42058219; @pmid:42005169]. Subclinical peripheral neuropathy has been reported in NOTCH2NLC-related NIID [@pmid:42001002]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.", + "hpo_terms": [], + "prevalence": null, + "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 30-70 [@omim:603472]; Range: 10 [@pmid:37090934] - 78 [@pmid:37305750].", + "age_onset_min": 10, + "age_onset_max": 78, + "typ_age_onset_min": 30, + "typ_age_onset_max": 70, + "details": "Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats [@genereviews:NBK535148]. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype [@pmid:39055960; @pmid:39496005]: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders [@pmid:31178126]. Age of onset inversely related to allele size [@pmid:38377026]. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype [@pmid:34718964]. Interruptions documented: GGA, GGG [@pmid:35245110]; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed [@pmid:38467784]. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.", + "detection": "Short-read sequencing is reported to be unreliable for sizing of large or complex expansions [@pmid:34034831]. RP-PCR has screened for expansions [@pmid:37371433], while long-read sequencing has resolved size, structure, and methylation [@pmid:34774111].", + "mechanism": "GoF", + "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation [@pmid:42058219]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@pmid:39920690]. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported [@pmid:41539185]. Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression [@pmid:41942455].", + "year": "2019 [@pmid:31332380]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGC" + ], + "pathogenic_motif_reference_orientation": [ + "GGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "GGA", + "AGC" + ], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AGG", + "AGC" + ], + "locus_structure": [], + "benign_min": 7, + "benign_max": 37, + "intermediate_min": 38, + "intermediate_max": 65, + "pathogenic_min": 66, + "pathogenic_max": 517, + "motif_len": 3, + "ref_copies": 13.3, + "novel": "ref", + "gard": [ + "3971" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "NRN008" + ], + "medgen": [ + "355075" + ], + "mondo": [ + "0011327" + ], + "omim": [ + "603472", + "619473" + ], + "orphanet": [ + "2289" + ], + "gnomad": [ + "NOTCH2NLC" + ], + "stripy": [ + "NOTCH2NLC" + ], + "tr_atlas": [ + "TR7525" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [ + "somatic_instability", + "paternal_expansion", + "length_affects_onset", + "length_affects_phenotype", + "motif_affects_onset", + "motif_affects_phenotype" + ], + "disease_tags": [ + "phenotypic_spectrum" + ], + "references": [ + "omim:603472", + "pmid:37090934", + "pmid:37305750", + "pmid:36169768", + "pmid:38467784", + "pmid:42058219", + "doi:10.1186/s12964-025-02079-1", + "pmid:41539185", + "pmid:41942455", + "genereviews:NBK535148", + "pmid:39055960", + "pmid:39496005", + "pmid:31178126", + "pmid:38377026", + "pmid:34718964", + "pmid:35245110", + "pmid:37371433", + "pmid:38876750", + "pmid:31332380", + "mondo:0011327", + "pmid:41929501", + "pmid:42005169" + ], + "additional_literature": [ + "pmid:42058219", + "pmid:42033810", + "pmid:42021030", + "pmid:42015293", + "pmid:42005169", + "pmid:41964975", + "pmid:41942455", + "pmid:41929501", + "pmid:41888971", + "pmid:41882342", + "pmid:41862851", + "pmid:41792844", + "pmid:41762523", + "pmid:41756172", + "pmid:41731582", + "pmid:41688968", + "pmid:41634634", + "pmid:41556371", + "pmid:41526374", + "pmid:41235412", + "pmid:41154122", + "pmid:41074692", + "pmid:40934004", + "pmid:40879637", + "pmid:40765612", + "pmid:40708231", + "pmid:40645757", + "pmid:40635536", + "pmid:40609325", + "pmid:40517194", + "pmid:40515658", + "pmid:40514451", + "pmid:40267536", + "pmid:40084170", + "pmid:39936620", + "pmid:39920690", + "pmid:39609868", + "pmid:39529621", + "pmid:39505310", + "pmid:39492694", + "pmid:39418922", + "pmid:39167540", + "pmid:39078482", + "pmid:38779172", + "pmid:38667292", + "pmid:38579412", + "pmid:38477063", + "pmid:38288273", + "pmid:38145851", + "pmid:37975799", + "pmid:37923380", + "pmid:37864208", + "pmid:37823700", + "pmid:37644522", + "pmid:37365282", + "pmid:37271829", + "pmid:37237429", + "pmid:37184590", + "pmid:37131242", + "pmid:37001413", + "pmid:36948577", + "pmid:36942588", + "pmid:36825461", + "pmid:36823368", + "pmid:36809423", + "pmid:36715780", + "pmid:36672065", + "pmid:36621630", + "pmid:36588885", + "pmid:36570826", + "pmid:36545534", + "pmid:36483830", + "pmid:36458450", + "pmid:36417528", + "pmid:36263606", + "pmid:36216675", + "pmid:36207023", + "pmid:36191230", + "pmid:36172483", + "pmid:36150977", + "pmid:36086903", + "pmid:36061987", + "pmid:36041634", + "pmid:36033605", + "pmid:35974122", + "pmid:35866887", + "pmid:35857137", + "pmid:35838850", + "pmid:35788208", + "pmid:35772299", + "pmid:35700120", + "pmid:35419641", + "pmid:35411397", + "pmid:35402653", + "pmid:35366689", + "pmid:35314910", + "pmid:35297556", + "pmid:35180462", + "pmid:35152460", + "pmid:35148830", + "pmid:35147270", + "pmid:34927285", + "pmid:34797461", + "pmid:34774111", + "pmid:34750918", + "pmid:34694469", + "pmid:34675106", + "pmid:34641814", + "pmid:34392981", + "pmid:34306035", + "pmid:34243731", + "pmid:34054431", + "pmid:34017298", + "pmid:33943039", + "pmid:33887199", + "pmid:33871559", + "pmid:33871549", + "pmid:33766934", + "pmid:33693509", + "pmid:33679585", + "pmid:33626493", + "pmid:33625684", + "pmid:33388663", + "pmid:33377220", + "pmid:33377207", + "pmid:33239111", + "pmid:33201994", + "pmid:33201988", + "pmid:33146692", + "pmid:33146671", + "pmid:33026126", + "pmid:33016348", + "pmid:32989102", + "pmid:32931575", + "pmid:32852534", + "pmid:32827029", + "pmid:32817896", + "pmid:32777174", + "pmid:32768149", + "pmid:32602554", + "pmid:32535679", + "pmid:32516806", + "pmid:32495371", + "pmid:32449905", + "pmid:32268889", + "pmid:32250060", + "pmid:32081467", + "pmid:32039647", + "pmid:31886491", + "pmid:31819945", + "pmid:31433517", + "pmid:31413119", + "pmid:31332381" + ] + }, { - "motif": "TTTTA", - "count": 10, - "type": "internal_repeat" + "id": "OPML1_NUTM2B-AS1", + "disease_id": "OPML1", + "gene": "NUTM2B-AS1", + "evidence": [ + "Moderate" + ], + "chrom": "chr10", + "start_hg38": 79826383, + "stop_hg38": 79826404, + "start_hg19": 81586139, + "stop_hg19": 81586160, + "start_t2t": 80695718, + "stop_t2t": 80695748, + "disease": "Oculopharyngeal myopathy with leukoencephalopathy 1", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Oculopharyngodistal myopathy and white matter abnormalities [@pmid:38876750]; Ptosis, ophthalmoplegia, dysphagia, dysarthria [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Rare, found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "15-40 (only characterized in one family) [@pmid:31332380].", + "age_onset_min": 15, + "age_onset_max": 40, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (3-16 repeats) established in 1000 controls, studied alongside pathogenic probands of up to 700 repeats [@pmid:31332380]. Pathogenicity occurs at repeats as short as 161 motifs [@pmid:38159879; @pmid:37923380], while intermediate alleles may correlate to milder phenotypes [@pmid:38159879]. Alt transcript in opposite direction: LOC642361.", + "detection": "RP-PCR has effectively detected these expansions [@pmid:39308795], while long-read sequencing has resolved size and structure [@pmid:38159879].", + "mechanism": "GoF?", + "mechanism_detail": "RNA mediated toxicity hypothesized, overall mechanism unknown [@omim:618637; @pmid:36169768].", + "year": "2019 [@pmid:31332380]", + "location_in_gene": "Exon 1 of lncRNA (noncoding)", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGC" + ], + "pathogenic_motif_reference_orientation": [ + "GGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 3, + "benign_max": 16, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 161, + "pathogenic_max": 700, + "motif_len": 3, + "ref_copies": 7, + "novel": "ref", + "gard": [], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "OCL077" + ], + "medgen": [ + "1684701" + ], + "mondo": [ + "0032843" + ], + "omim": [ + "618637" + ], + "orphanet": [], + "gnomad": [ + "NUTM2B-AS1" + ], + "stripy": [ + "NUTM2B-AS1" + ], + "tr_atlas": [ + "TR102881" + ], + "webstr_hg38": [], + "webstr_hg19": [ + "STR_173942" + ], + "locus_tags": [ + "length_affects_severity", + "length_affects_phenotype" + ], + "disease_tags": [], + "references": [ + "pmid:31332380", + "omim:618637", + "pmid:36169768", + "pmid:38159879", + "pmid:37923380", + "pmid:38876750", + "pmid:39349043" + ], + "additional_literature": [ + "pmid:40645757", + "pmid:39308795", + "pmid:39176128", + "pmid:35152460" + ] }, { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 1100, - "pathogenic_max": 1100, - "motif_len": 3, - "ref_copies": 18.8, - "novel": "novel", - "gard": ["16758"], - "genereviews": ["NBK535148"], - "malacard": ["EPL227"], - "medgen": ["1648448"], - "mondo": ["0054846"], - "omim": ["618074"], - "orphanet": ["86814"], - "gnomad": ["TNRC6A"], - "stripy": ["TNRC6A"], - "tr_atlas": ["TR139999"], - "webstr_hg38": ["5951520"], - "webstr_hg19": ["STR_519979"], - "locus_tags": ["motif_affects_penetrance"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:29507423", "pmid:38467784", "pmid:38876750"], - "additional_literature": ["pmid:41219789", "pmid:36092952", "pmid:33040085", "pmid:31483537", "pmid:30351492", "pmid:23042244"] -}, -{ - "id": "CPUM_TYMS", - "disease_id": "CPUM", - "gene": "TYMS", - "evidence": ["Limited"], - "chrom": "chr18", - "start_hg38": 666891, - "stop_hg38": 667632, - "start_hg19": 666891, - "stop_hg19": 667632, - "start_t2t": 821235, - "stop_t2t": 821905, - "disease": "Congenital Progressive Universal Melanosis", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "CPUM is characterized by progressive widespread hyperpigmentation beginning at birth without accompanying symptoms. Studied children with CPUM have been born to unaffected parents. The children studied have been born with diffuse, universal, and progressive hyperpigmentation at 15 years of age. At this time the hyperpigmentation had fully progressed [@pmid:40589716]. It is not entirely clear that this is a distinct disease as it shares features with acquired universal melanosis (most similar), erythema dyschromicum perstans, lichen planus pigmentosus, and familial progressive hypigmentation.", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in two monozygotic twins in Thailand [@pmid:40589716].", - "age_onset": "0 (birth) [@pmid:40589716]", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "A study has identified an intronic GATGGT hexanucleotide tandem repeat in the TYMS gene. Both parents were found to be heterozygous carriers of the expansion, suggesting a recessive inheritance pattern. Evidence is limited, only a single family with monozygotic twins have been reported and no change in expression of the gene has been observed [@pmid:40589716].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Proposed mechanism involves repeat expansions in non-coding regions of the gene, reducing expression in melanocytes or keratinocytes, leading to a disruption in nucleotide balance in DNA repair and hyperpigmentation. Missense mutations disrupt nucleotide metabolism, resulting in loss-of-function and genome instability [@pmid:40589716].", - "year": "2025 [@pmid:40589716]", - "location_in_gene": "Intron 3", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GATGGT"], - "pathogenic_motif_reference_orientation": ["GATGGT"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ACCATC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 42, - "benign_max": 172, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 210, - "pathogenic_max": 259, - "motif_len": 6, - "ref_copies": null, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": [], - "medgen": [], - "mondo": [], - "omim": [], - "orphanet": [], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:40589716"], - "additional_literature": ["pmid:41507280", "pmid:41181325", "pmid:41074680", "pmid:41024012", "pmid:40890629", "pmid:40589716", "pmid:40195828", "pmid:38625071", "pmid:38411001", "pmid:38379425", "pmid:38311638", "pmid:38280392", "pmid:38134936", "pmid:36398398", "pmid:36209056", "pmid:35608245", "pmid:35233526", "pmid:35055435", "pmid:34650802", "pmid:34526668", "pmid:34197619", "pmid:34149004", "pmid:33805940", "pmid:33086767", "pmid:32813677", "pmid:32695278", "pmid:32612964", "pmid:32110891", "pmid:31817852", "pmid:31370354", "pmid:31161452", "pmid:30838312", "pmid:30823845", "pmid:30533396", "pmid:30464574", "pmid:30122542", "pmid:29995270", "pmid:29660633", "pmid:29394274", "pmid:29321350", "pmid:29162511", "pmid:28895423", "pmid:28349270", "pmid:28280649", "pmid:28074308", "pmid:28074022", "pmid:27995989", "pmid:27868347", "pmid:27864985", "pmid:27685916", "pmid:27375073", "pmid:29767611", "pmid:26745074", "pmid:26621114", "pmid:26277606", "pmid:26196219", "pmid:26189437", "pmid:25955097", "pmid:25648260", "pmid:25536611", "pmid:25366766", "pmid:25341694", "pmid:25294632", "pmid:25279663", "pmid:25258183", "pmid:25246386", "pmid:25028118", "pmid:25007187", "pmid:24726028", "pmid:24686188", "pmid:24641398", "pmid:24596472", "pmid:24554028", "pmid:24422758", "pmid:24415354", "pmid:24302747", "pmid:24137384", "pmid:23968134", "pmid:23571497", "pmid:23481061", "pmid:23232805", "pmid:23226765", "pmid:23148637", "pmid:22799365", "pmid:22763757", "pmid:22576918", "pmid:22086855", "pmid:22044939", "pmid:21630057", "pmid:21449681", "pmid:21269855", "pmid:21196216", "pmid:21075014", "pmid:20966539", "pmid:20962453", "pmid:20932673", "pmid:20880668", "pmid:20824655", "pmid:20651387", "pmid:20645403", "pmid:20570968", "pmid:20531375", "pmid:20372856", "pmid:20005374", "pmid:19998340", "pmid:19917450", "pmid:19798689", "pmid:19632929", "pmid:19349389", "pmid:19306093", "pmid:19200948", "pmid:19082493", "pmid:18843018", "pmid:18728661", "pmid:18704422", "pmid:18661526", "pmid:18406541", "pmid:18273818", "pmid:18267032", "pmid:18203297", "pmid:18095031", "pmid:17508355", "pmid:17396161", "pmid:17278107", "pmid:17273745", "pmid:17220568", "pmid:17201138", "pmid:17187508", "pmid:17047490", "pmid:17018589", "pmid:16929515", "pmid:16818689", "pmid:16596248", "pmid:16456808", "pmid:16334126", "pmid:16333305", "pmid:16234002", "pmid:16182121", "pmid:15897576", "pmid:15817609", "pmid:15749593", "pmid:15646842", "pmid:15579479", "pmid:15571262", "pmid:15510613", "pmid:15457444", "pmid:15386371", "pmid:15284183", "pmid:15115918", "pmid:14522928", "pmid:12684695", "pmid:12604405", "pmid:12460463", "pmid:12232785", "pmid:12215845", "pmid:12039668", "pmid:11913730", "pmid:11867566", "pmid:11751507", "pmid:11529907", "pmid:11445856", "pmid:10652619", "pmid:10636923", "pmid:10625460", "pmid:8751943", "pmid:3002689"] -}, -{ - "id": "HMNR7_VWA1", - "disease_id": "HMNR7", - "gene": "VWA1", - "evidence": ["Definitive"], - "chrom": "chr1", - "start_hg38": 1435798, - "stop_hg38": 1435818, - "start_hg19": 1371178, - "stop_hg19": 1371198, - "start_t2t": 870158, - "stop_t2t": 870178, - "disease": "Neuronopathy, distal hereditary motor, autosomal recessive 7", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Autosomal recessive distal hereditary motor neuronopathy-7 (HMNR7) is characterized by onset of lower leg weakness in the first decade. Affected individuals have difficulty climbing stairs and problems standing on their heels... Most patients have foot deformities, and some may have leg muscle atrophy. The disorder is slowly progressive and often involves the upper limbs [@omim:619216].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Biallelic variants found in 0.01% of 100 KGP participants; enriched in those with motor disease. 80% of VWA1 pathogenic variants are expansions/contractions [@genereviews:NBK535148]. The repeat expansion was found in several ethnicities; founder mutation 7,000 years prior [@pmid:33559681].", - "age_onset": "Typical: 1-3 [@pmid:33559681]; Range: 0-10 [@omim:619216].", - "age_onset_min": 0.0, - "age_onset_max": 10.0, - "typ_age_onset_min": 1.0, - "typ_age_onset_max": 3.0, - "details": "Any deviation from 2 motifs is thought to be pathogenic [@genereviews:NBK535148].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Loss of function [@pmid:38467784].", - "year": "2021 [@pmid:33559681]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GGCGCGGAGC"], - "pathogenic_motif_reference_orientation": ["GGCGCGGAGC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["AGCGGCGCGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 2, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 1, - "pathogenic_max": 3, - "motif_len": 10, - "ref_copies": null, - "novel": null, - "gard": ["18444"], - "genereviews": ["NBK535148"], - "malacard": ["NRN074"], - "medgen": ["1786836"], - "mondo": ["0030977"], - "omim": ["619216"], - "orphanet": ["314485"], - "gnomad": ["VWA1"], - "stripy": [], - "tr_atlas": ["TR32"], - "webstr_hg38": ["1099767"], - "webstr_hg19": [], - "locus_tags": ["contraction"], - "disease_tags": [], - "references": ["pmid:33559681", "omim:619216", "pmid:38467784", "genereviews:NBK535148"], - "additional_literature": ["pmid:42003611"] -}, -{ - "id": "DBQD2_XYLT1", - "disease_id": "DBQD2, BSS", - "gene": "XYLT1", - "evidence": ["Moderate"], - "chrom": "chr16", - "start_hg38": 17470907, - "stop_hg38": 17470922, - "start_hg19": 17564764, - "stop_hg19": 17564779, - "start_t2t": 17477909, - "stop_t2t": 17478002, - "disease": "Baratela-Scott Syndrome/Desbuquois dysplasia 2", - "inheritance": ["AR"], - "association_type": ["Mendelian"], - "disease_description": "Desbuquois dysplasia, which belongs to the multiple dislocation group of disorders, is characterized by dislocations of large joints, severe pre- and postnatal growth retardation, joint laxity, and flat face with prominent eyes. Radiologic features include short long bones with an exaggerated trochanter that gives a 'monkey wrench' appearance to the proximal femur, and advanced carpal and tarsal ossification [@pmid:24581741].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "<1/1,000,000 births [@orphanet:1425]; repeat expansions comprise half of DBQD variants [@genereviews:NBK535148]. <50 DBQD cases. Has been found in Belgian, Emirati families", - "age_onset": "0 (birth)", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": 0.0, - "typ_age_onset_max": 0.0, - "details": "Benign range (0-20) taken from primary literature of unaffected individuals and gnomAD data [@pmid:30554721; @gnomad:XYLT1]. Minimum repeat size to cause disease thought to range between 72 and 110 repeats [@pmid:30554721]. Repeat is within a 238bp sequence which is missing from hg38 but present in T2T-CHM13", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Methylation [@pmid:30554721].", - "year": "2019 [@pmid:30554721]", - "location_in_gene": "5' promoter region. Note, it can also be annotated coding or introntic depending on the reference, due to missing sequences in some reference genomes.", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "OPMD_PABPN1", + "disease_id": "OPMD", + "gene": "PABPN1", + "evidence": [ + "Definitive" + ], + "chrom": "chr14", + "start_hg38": 23321472, + "stop_hg38": 23321503, + "start_hg19": 23790681, + "stop_hg19": 23790712, + "start_t2t": 17522488, + "stop_t2t": 17522519, + "disease": "Oculopharyngeal muscular dystrophy", + "inheritance": [ + "AD", + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "OPMD is a late-onset neuromuscular disease, characterized by ptosis, dysphagia, and general facial weakness [@omim:164300; @pmid:39349043; @pmid:38876750]. Proximal limb weakness commonly develops later in the disease course [@pmid:42157275].", + "hpo_terms": null, + "prevalence": "1/100000", + "prevalence_details": "1/100,000 (population specific) [@pmid:29100084]. Frequency of (GCN)11 alleles is 1-2% of North America/Europe/Japan [@genereviews:NBK1126]. Disease is significantly enriched in individuals of Jewish Bukharian descent[@pmid:42157275]. Disease is found worldwide, in more than 30 countries [@genereviews:NBK1126].", + "age_onset": "Typical: 40-59 [@pmid:37519616]; Range: 20-79 [@pmid:35112761].", + "age_onset_min": 20, + "age_onset_max": 79, + "typ_age_onset_min": 40, + "typ_age_onset_max": 59, + "details": "Disease is caused by a GCN polyalanine expansion in the first exon of PABPN1. Most known patients have (GCG)+, but GCN (any polyalanine) may be pathogenic [@genereviews:NBK1126]. This locus is heterozygous in ~90% of cases (autosomal dominant inheritance), while expansions are biallelic in ~10% of cases (consistent with autosomal recessive inheritance). Disease is generally more severe in cases with two expanded alleles. Age of onset is inverse to allele size, while penetrance and severity increase with allele size [@genereviews:NBK1126]. Mild, late-onset disease can occur in individuals with a (GCN)10(GCN)11 genotype, suggesting variable penetrance [@pmid:28011929]. The definition of this locus differs in the literature with prior work counting exact GCG motifs for a benign size of (GCG)6 [@pmid:9462747], while later resources count GCNs (any alanine codon), widening the region by 4 motifs to a benign size of (GCN)10 [@genereviews:NBK1126; @pmid:39349043]. STRchive is using the GCN definition.", + "detection": "Flanking PCR with fragment analysis has accurately detected expansions [@pmid:27980005]. Heterozygous expansions have been sized by Sanger sequencing. Biallelic expanded variants were assessed using short-read sequencing or PCR fragment analysis.", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyalanine expansions leading to cellular toxicity (loss of function) as well as abnormal aggregation and inefficient protein degradation, which may impact mRNA processing [@genereviews:NBK1126].", + "year": "1998 [@pmid:9462747]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 10, + "intermediate_min": 11, + "intermediate_max": 11, + "pathogenic_min": 12, + "pathogenic_max": 18, + "motif_len": 3, + "ref_copies": 7, + "novel": "ref", + "gard": [ + "7245" + ], + "genereviews": [ + "NBK1126" + ], + "malacard": [ + "OCL088" + ], + "medgen": [ + "1054618" + ], + "mondo": [ + "0958176" + ], + "omim": [ + "164300" + ], + "orphanet": [ + "270" + ], + "gnomad": [ + "PABPN1" + ], + "stripy": [ + "PABPN1" + ], + "tr_atlas": [ + "TR128439" + ], + "webstr_hg38": [ + "1442709", + "5271481" + ], + "webstr_hg19": [ + "Expansion_OPMD/PAPBN1" + ], + "locus_tags": [ + "length_affects_onset", + "length_affects_severity" + ], + "disease_tags": [], + "references": [ + "pmid:37519616", + "pmid:35112761", + "genereviews:NBK1126", + "pmid:28011929", + "pmid:9462747", + "pmid:39349043", + "pmid:29100084", + "omim:164300", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:42196324", + "pmid:42157275", + "pmid:41764774", + "pmid:41676387", + "pmid:41587185", + "pmid:40594369", + "pmid:40552959", + "pmid:40220918", + "pmid:39113268", + "pmid:38165364", + "pmid:37698929", + "pmid:37559347", + "pmid:36790141", + "pmid:35859342", + "pmid:34927285", + "pmid:34225694", + "pmid:34047774", + "pmid:31294444", + "pmid:30455479", + "pmid:28361972", + "pmid:27980005", + "pmid:26428746", + "pmid:23793615", + "pmid:23399899", + "pmid:22519734", + "pmid:21742497", + "pmid:21647273", + "pmid:21602480", + "pmid:21316245", + "pmid:19641605", + "pmid:19101703", + "pmid:18481858", + "pmid:18367172", + "pmid:18343218", + "pmid:17138075", + "pmid:16648376", + "pmid:16642034", + "pmid:16481821", + "pmid:16378590", + "pmid:16239242", + "pmid:15811916", + "pmid:15755680", + "pmid:15725589", + "pmid:15645184", + "pmid:14627730", + "pmid:12673802", + "pmid:11712939", + "pmid:11304042", + "pmid:11222452", + "pmid:11150975", + "pmid:11087766", + "pmid:11003790", + "pmid:10734263", + "pmid:10680791", + "pmid:9084936" + ] + }, + { + "id": "CCHS_PHOX2B", + "disease_id": "CCHS", + "gene": "PHOX2B", + "evidence": [ + "Definitive" + ], + "chrom": "chr4", + "start_hg38": 41745972, + "stop_hg38": 41746032, + "start_hg19": 41747989, + "stop_hg19": 41748049, + "start_t2t": 41719745, + "stop_t2t": 41719805, + "disease": "Congenital central hypoventilation syndrome", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of the PHOX-2B gene is found in 90% of the patients. Association with Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026]. Hyperinsulinism has been observed in patients [@pmid:41531556].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Incidence is 1:148000-200000 births (Estimated, may include mild/undiagnosed or be overestimated globally) [@genereviews:NBK1427]. Rare, but reported worldwide [@pmid:15121777].", + "age_onset": "Typical: 0-2 [@genereviews:NBK1427; @pmid:15121777]; Range: 0-36 [@pmid:16873766].", + "age_onset_min": 0, + "age_onset_max": 36, + "typ_age_onset_min": 0, + "typ_age_onset_max": 2, + "details": "Alleles of 24 repeats (and sometimes 25 repeats) correspond to delayed disease onset and/or milder phenotype; alleles above benign range (9-20 repeats) and below the pathogenic range (26-33 repeats) have uncertain significance [@genereviews:NBK1427].", + "detection": "Short-read sequencing and exome sequencing are reportedly unable to accurately detect these expansions. Fragment analysis is the standard detection method, while Sanger sequencing determines the exact repeat size [@genereviews:NBK1427].", + "mechanism": "LoF/GoF", + "mechanism_detail": "Polyalanine expansion leading to loss or gain of function, dependent on altered protein product [@pmid:38467784; @genereviews:NBK1427]. Correlation between length and reduced transcriptional activity [@pmid:15888479].", + "year": "2003 [@pmid:12640453]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 9, + "benign_max": 20, + "intermediate_min": 21, + "intermediate_max": 25, + "pathogenic_min": 26, + "pathogenic_max": 33, + "motif_len": 3, + "ref_copies": 15.7, + "novel": "ref", + "gard": [ + "8535" + ], + "genereviews": [ + "NBK1427" + ], + "malacard": [ + "CNT119" + ], + "medgen": [ + "1794285" + ], + "mondo": [ + "0800026" + ], + "omim": [ + "209880" + ], + "orphanet": [ + "661" + ], + "gnomad": [ + "PHOX2B" + ], + "stripy": [ + "PHOX2B" + ], + "tr_atlas": [ + "TR42548" + ], + "webstr_hg38": [ + "4725362" + ], + "webstr_hg19": [ + "Expansion_CCHS/PHOX2B" + ], + "locus_tags": [ + "length_affects_onset", + "length_affects_severity" + ], + "disease_tags": [], + "references": [ + "genereviews:NBK1427", + "pmid:15121777", + "pmid:16873766", + "pmid:38467784", + "pmid:15888479", + "pmid:12640453", + "mondo:0800026", + "pmid:41531556" + ], + "additional_literature": [ + "pmid:41420984", + "pmid:41188450", + "pmid:38467313", + "pmid:38454954", + "pmid:38431667", + "pmid:38001308", + "pmid:36394266", + "pmid:35421844", + "pmid:34626313", + "pmid:34012823", + "pmid:33958749", + "pmid:33855005", + "pmid:33047879", + "pmid:32822965", + "pmid:31950261", + "pmid:30786110", + "pmid:30672101", + "pmid:30227298", + "pmid:29058474", + "pmid:28992836", + "pmid:27485184", + "pmid:27129232", + "pmid:26378991", + "pmid:26375764", + "pmid:26063465", + "pmid:26011159", + "pmid:25975378", + "pmid:25085640", + "pmid:24442913", + "pmid:24135798", + "pmid:23460545", + "pmid:23460419", + "pmid:23103552", + "pmid:23045564", + "pmid:22922260", + "pmid:22829249", + "pmid:22821709", + "pmid:22437207", + "pmid:22278185", + "pmid:22125732", + "pmid:21373876", + "pmid:20236122", + "pmid:19881470", + "pmid:19608868", + "pmid:18798833", + "pmid:18157832", + "pmid:17928950", + "pmid:17909190", + "pmid:17045833", + "pmid:16888290", + "pmid:16258163", + "pmid:16249188" + ] + }, + { + "id": "MRUPAV_PLIN4", + "disease_id": "MRUPAV", + "gene": "PLIN4", + "evidence": [ + "Moderate" + ], + "chrom": "chr19", + "start_hg38": 4510727, + "stop_hg38": 4513659, + "start_hg19": 4510739, + "stop_hg19": 4513671, + "start_t2t": 4494212, + "stop_t2t": 4497342, + "disease": "Myopathy with Rimmed Ubiquitin-Positive Autophagic Vacuolation, PLIN4-Related Myopathy", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Autosomal dominant myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV) is characterized by adult onset of slowly progressive skeletal muscle weakness variably affecting the distal or proximal lower limbs. Some patients may also have upper limb involvement or neck muscle weakness, but respiratory and bulbar involvement only rarely occurs. EMG studies show a myopathic process, and myotonia may also be observed [@omim:601846]. An early characterisation of the disease was reported in Blasi, et al. [@pmid:15236412].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Studied in patients of chinese ancestry and two families of spanish ancestry [@pmid:36151849; @pmid:40693562].", + "age_onset": "22-66 [@pmid:36151849; @pmid:37145156; @pmid:35499779; @pmid:40693562].", + "age_onset_min": 22, + "age_onset_max": 66, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "This is an expanded variable number tandem repeat (VNTR) in the PLIN4 gene, located in exon 3. This repeat consists of a 99 bp motif which encodes 33 amino-acids within the perilipin-4 protein [@pmid:32451610]. Expansions of this 99 bp motif lead to insertion of multiple imperfect 33–amino acid repeats. These repetitive sequences are thought to contribute to abnormal protein aggregation and dysregulated autophagy seen in affected muscle tissue [@omim:601846].", + "detection": "Short-read sequencing and exome sequencing are reported to not reliably detect this repeat. Long-range PCR is used for detection, while long-read sequencing is used to fully resolve size and structure [@pmid:32451610; @pmid:33811808].", + "mechanism": "GoF", + "mechanism_detail": "The present disease is characterized by dominantly inherited progressively increasing mobilization of aggrephagy at sites of progressive accumulation of a mutated protein, suggesting that the mutation is leading to aggregation, likely through misfolding, exceeding aggrephagic capacity [@pmid:32451610]", + "year": "2020 [@pmid:32451610]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC" + ], + "pathogenic_motif_reference_orientation": [ + "TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AAAGGAACCATCCAGACCGGCGTGGACACCAGTAAGACTGTCCTAACAGGTACCAAGGACACCGTCTGTAGTGGGGTGACTGGTGCCATGAATGTGGCC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 29, + "benign_max": 31, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 37, + "pathogenic_max": 50, + "motif_len": 99, + "ref_copies": 31, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": [], + "medgen": [ + "355637" + ], + "mondo": [ + "0011155" + ], + "omim": [ + "601846" + ], + "orphanet": [ + "696063" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [ + "anticipation", + "length_affects_onset" + ], + "disease_tags": [], + "references": [ + "pmid:36151849", + "pmid:37145156", + "pmid:35499779", + "pmid:40693562", + "pmid:32451610", + "omim:601846", + "pmid:15236412" + ], + "additional_literature": [ + "pmid:39492694" + ] + }, { - "motif": "GCC", - "count": 0, - "type": "internal_repeat" + "id": "CPEO_POLG", + "disease_id": "CPEO", + "gene": "POLG", + "evidence": [ + "Disputed" + ], + "chrom": "chr15", + "start_hg38": 89333588, + "stop_hg38": 89333629, + "start_hg19": 89876819, + "stop_hg19": 89876860, + "start_t2t": 87088411, + "stop_t2t": 87088452, + "disease": "Progressive external ophthalmoplegia, Parkinson's disease", + "inheritance": [], + "association_type": [ + "Mendelian", + "Risk", + "Modifier" + ], + "disease_description": "sensory ataxic neuropathy, dysarthria, and ophthalmoparesis [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Disease association unclear but largely studied in European cohorts/patients [@omim:258450; @omim:157640].", + "age_onset": "Typical: 57 [@pmid:20399836] - 59 [@pmid:20826197]; Range: 23-87 [@pmid:20399836].", + "age_onset_min": 23, + "age_onset_max": 87, + "typ_age_onset_min": 57, + "typ_age_onset_max": 59, + "details": "There is conflicting evidence for the association between this repeat expansion and Parkinson's risk [@pmid:20399836; @pmid:10196696; @pmid:22963882], as well as overall disease significance. May be predisposing factor in earlier age of onset in FRDA patients [@pmid:19043662].", + "detection": null, + "mechanism": null, + "mechanism_detail": null, + "year": null, + "location_in_gene": "Coding Exon 2", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCT" + ], + "pathogenic_motif_reference_orientation": [ + "GCT" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "GCT", + "count": 2, + "type": "flank_repeat" + }, + { + "motif": "GTT", + "count": 1, + "type": "flank_repeat" + }, + { + "motif": "GCT", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 10, + "benign_max": 10, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": null, + "pathogenic_max": null, + "motif_len": 3, + "ref_copies": 13.7, + "novel": "ref", + "gard": [ + "15215", + "13174" + ], + "genereviews": [], + "malacard": [ + "PRG130", + "PRK002" + ], + "medgen": [ + "897191", + "371919" + ], + "mondo": [ + "0009783", + "0024528" + ], + "omim": [ + "258450", + "157640" + ], + "orphanet": [ + "520820" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [ + "TR137533" + ], + "webstr_hg38": [ + "5177947" + ], + "webstr_hg19": [ + "STR_493430" + ], + "locus_tags": [ + "proposed_modifier" + ], + "disease_tags": [], + "references": [ + "pmid:20399836", + "pmid:20826197", + "pmid:10196696", + "pmid:22963882", + "pmid:19043662", + "omim:258450", + "omim:157640", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:41009775", + "pmid:40844737", + "pmid:39812846", + "pmid:34600502", + "pmid:29029963", + "pmid:28444220", + "pmid:25767537", + "pmid:24491464", + "pmid:23912752", + "pmid:23493802", + "pmid:20803511", + "pmid:15694274", + "pmid:12036482" + ] }, { - "motif": "TCGGCTCGCCGCTGCTCCTCCTCC", - "count": 0, - "type": "interruption" + "id": "SCA12_PPP2R2B", + "disease_id": "SCA12", + "gene": "PPP2R2B", + "evidence": [ + "Moderate" + ], + "chrom": "chr5", + "start_hg38": 146878727, + "stop_hg38": 146878759, + "start_hg19": 146258290, + "stop_hg19": 146258322, + "start_t2t": 147414733, + "stop_t2t": 147414780, + "disease": "Spinocerebellar ataxia type 12", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 12 (SCA12) is a very rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by the presence of action tremor associated with relatively mild cerebellar ataxia. Associated pyramidal and extrapyramidal signs and dementia have been reported [@mondo:0011439].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Frequent in India; rare in other populations [@pmid:34711523].", + "age_onset": "Typical: 26-50; Range: 8-62 [@omim:604326; @pmid:42105155].", + "age_onset_min": 8, + "age_onset_max": 62, + "typ_age_onset_min": 26, + "typ_age_onset_max": 50, + "details": "Benign range is 6-32 repeats, intermediate range 40-49, and pathogenic range is 51-78 [@pmid:37906407]; intermediate alleles are associated with reduced penetrance [@pmid:11198281].", + "detection": "RP-PCR generally detects expansions, while PCR fragment analysis approximates allele size. Large expansions may require Southern blot confirmation [@pmid:35262663; @pmid:10581021].", + "mechanism": "GoF", + "mechanism_detail": "Polyalanine gain of function associated with RAN translation [@pmid:38467784].", + "year": "1999 [@pmid:10581021]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCT" + ], + "pathogenic_motif_reference_orientation": [ + "GCT" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 32, + "intermediate_min": 40, + "intermediate_max": 49, + "pathogenic_min": 51, + "pathogenic_max": 78, + "motif_len": 3, + "ref_copies": 10.7, + "novel": "ref", + "gard": [ + "10476" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "SPN293" + ], + "medgen": [ + "347653" + ], + "mondo": [ + "0011439" + ], + "omim": [ + "604326" + ], + "orphanet": [ + "98762" + ], + "gnomad": [ + "PPP2R2B" + ], + "stripy": [ + "PPP2R2B" + ], + "tr_atlas": [ + "TR59714" + ], + "webstr_hg38": [ + "985593", + "6072892" + ], + "webstr_hg19": [ + "Expansion_SCA12/PPP2R2B" + ], + "locus_tags": [ + "length_affects_penetrance" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "omim:604326", + "pmid:38467784", + "pmid:37906407", + "pmid:11198281", + "pmid:34711523", + "pmid:10581021", + "mondo:0011439" + ], + "additional_literature": [ + "pmid:42105155", + "pmid:42038259", + "pmid:41788301", + "pmid:41762523", + "pmid:41691974", + "pmid:41612618", + "pmid:41074692", + "pmid:40488180", + "pmid:39565297", + "pmid:39469072", + "pmid:38961870", + "pmid:38798069", + "pmid:38711441", + "pmid:38227102", + "pmid:38058854", + "pmid:35531119", + "pmid:33502644", + "pmid:32675418", + "pmid:32124191", + "pmid:30130680", + "pmid:29057148", + "pmid:27864267", + "pmid:26340331", + "pmid:26077168", + "pmid:25634432", + "pmid:25586539", + "pmid:25274186", + "pmid:24269018", + "pmid:21029765", + "pmid:20937954", + "pmid:20533062", + "pmid:18940801", + "pmid:18484086", + "pmid:17961920", + "pmid:16054804", + "pmid:11171892" + ] }, { - "motif": "GCC", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": 0, - "benign_max": 20, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 72, - "pathogenic_max": 110, - "motif_len": 3, - "ref_copies": 0.0, - "novel": "ref", - "gard": ["16466"], - "genereviews": ["NBK535148"], - "malacard": ["DSB005"], - "medgen": ["862731"], - "mondo": ["0014343"], - "omim": ["615777"], - "orphanet": ["1425"], - "gnomad": ["XYLT1"], - "stripy": ["XYLT1"], - "tr_atlas": ["TR139509"], - "webstr_hg38": ["793606"], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:30554721", "gnomad:XYLT1", "orphanet:1425", "genereviews:NBK535148", "pmid:24581741"], - "additional_literature": [] -}, -{ - "id": "FAME4_YEATS2", - "disease_id": "FAME4", - "gene": "YEATS2", - "evidence": ["Limited"], - "chrom": "chr3", - "start_hg38": 183712187, - "stop_hg38": 183712226, - "start_hg19": 183429975, - "stop_hg19": 183430014, - "start_t2t": 186521667, - "stop_t2t": 186521706, - "disease": "Familial adult myoclonic epilepsy 4", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 20-25 [@pmid:22713812]; Range: 10-33 [@pmid:31539032].", - "age_onset_min": 10.0, - "age_onset_max": 33.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Novel insertion of ~1000 repeats observed to cause disease [@pmid:31539032].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity hypothesized [@pmid:31539032].", - "year": "2019 [@pmid:31539032]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["TTTTA"], - "pathogenic_motif_reference_orientation": ["TTTCA"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": ["TTTTT", "TGTTA"], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["ATTTC"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": ["TTTTT", "ATGTT"], - "interruption_gene_orientation": [], - "locus_structure": [ + "id": "HSAN-VIII_PRDM12", + "disease_id": "HSAN VIII", + "gene": "PRDM12", + "evidence": [ + "Moderate" + ], + "chrom": "chr9", + "start_hg38": 130681605, + "stop_hg38": 130681641, + "start_hg19": 133556992, + "stop_hg19": 133557028, + "start_t2t": 142886568, + "stop_t2t": 142886595, + "disease": "Hereditary sensory and autonomic neuropathy type VIII", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A hereditary sensory neuropathy characterized by congenital insensitivity to pain and decreased sweating and tear production that has material basis in homozygous mutation in the PRDM12 gene on chromosome 9q34 [@mondo:0014662].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Expansions found in 2 families from Pakistan and Saudi Arabia [@pmid:26005867]. All PRDM12 disease mutations < 1/1,000,000", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Pathogenic expansion found in 2 families, from whom pathogenic range (18-19) is inferred [@pmid:26005867]. Benign range (7-14) inferred from Human Gene Mutation Database [@genereviews:NBK535148].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Mutations abrogate the histone-modifying potential of PRDM12, consistent with a loss of function mechanism [@omim:616488].", + "year": "2015 [@pmid:26005867]", + "location_in_gene": "Coding Exon 5", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 7, + "benign_max": 14, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 18, + "pathogenic_max": 19, + "motif_len": 3, + "ref_copies": 12, + "novel": "ref", + "gard": [ + "17866" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "NRP044" + ], + "medgen": [ + "894363" + ], + "mondo": [ + "0014662" + ], + "omim": [ + "616488" + ], + "orphanet": [ + "478664" + ], + "gnomad": [ + "PRDM12" + ], + "stripy": [ + "PRDM12" + ], + "tr_atlas": [ + "TR97506" + ], + "webstr_hg38": [ + "1543400" + ], + "webstr_hg19": [ + "STR_1521945" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "omim:616488", + "pmid:26005867", + "genereviews:NBK535148", + "mondo:0014662" + ], + "additional_literature": [ + "pmid:41630927" + ] + }, + { + "id": "CJD_PRNP", + "disease_id": "CJD", + "gene": "PRNP", + "evidence": [ + "Moderate" + ], + "chrom": "chr20", + "start_hg38": 4699397, + "stop_hg38": 4699493, + "start_hg19": 4680043, + "stop_hg19": 4680139, + "start_t2t": 4738633, + "stop_t2t": 4738705, + "disease": "Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Schneiker syndrome (GSS) are a rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus [@genereviews:NBK1229]. These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat [@doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "<0.0225/1,000,000: <15% of CJ variants are repeat expansions [@genereviews:NBK535148]. 15% newly diagnosed prion disease cases are genetic [@genereviews:NBK1229], 1 individual per million per year worldwide (350 cases annually in US) [@pmid:29939637]. Found worldwide [@genereviews:NBK1229].", + "age_onset": "Typical: 50-60 [@genereviews:NBK1229]; Range: 31-63 [@pmid:37379724].", + "age_onset_min": 31, + "age_onset_max": 63, + "typ_age_onset_min": 50, + "typ_age_onset_max": 60, + "details": "Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln; any additional repeat leads to pathogenicity, with the largest repeat observed 16 motifs [@genereviews:NBK1229]. Insertion length may correspond to phenotype, such as CJD versus frontotemporal dementia [@pmid:36977684].", + "detection": null, + "mechanism": "LoF?", + "mechanism_detail": "Loss of function hypothesized [@pmid:38467784]", + "year": "1991 [@pmid:1683708]", + "location_in_gene": "Coding Exon 2", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGTGGTGGCTGGGGGCAGCCTCAT" + ], + "pathogenic_motif_reference_orientation": [ + "CCTCATGGTGGTGGCTGGGGGCAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGCCTCATGGTGGTGGCTGGGGGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "CCTCAGGGCGGTGGTGGCTGGGGGCAG", + "count": 1, + "type": "flank_repeat" + }, + { + "motif": "CCTCATGGTGGTGGCTGGGGGCAG", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 4, + "benign_max": 4, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 5, + "pathogenic_max": 16, + "motif_len": 24, + "ref_copies": null, + "novel": "ref", + "gard": [ + "17307" + ], + "genereviews": [ + "NBK1229" + ], + "malacard": [ + "CRT072" + ], + "medgen": [ + "155837" + ], + "mondo": [ + "0007403" + ], + "omim": [ + "123400" + ], + "orphanet": [ + "282166" + ], + "gnomad": [ + "PRNP" + ], + "stripy": [], + "tr_atlas": [ + "TR157963", + "TR157964" + ], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [ + "length_affects_phenotype" + ], + "disease_tags": [], + "references": [ + "genereviews:NBK1229", + "pmid:37379724", + "pmid:38467784", + "pmid:36977684", + "genereviews:NBK535148", + "pmid:29939637", + "pmid:1683708", + "doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1" + ], + "additional_literature": [ + "pmid:41890154", + "pmid:41009775", + "pmid:40803449", + "pmid:39256877", + "pmid:35926480", + "pmid:35903139", + "pmid:35752680", + "pmid:35585119", + "pmid:33131137", + "pmid:31795947", + "pmid:31127772", + "pmid:30777654", + "pmid:30530974", + "pmid:29966485", + "pmid:28003435", + "pmid:27400454", + "pmid:25239657", + "pmid:23998997", + "pmid:21686668", + "pmid:19092329", + "pmid:18397498", + "pmid:18366654", + "pmid:17709704", + "pmid:16858508", + "pmid:14729275", + "pmid:12805114", + "pmid:12451210", + "pmid:11593450", + "pmid:10611945", + "pmid:9710033", + "pmid:9565627", + "pmid:8030952" + ] + }, + { + "id": "FAME8_RAI1", + "disease_id": "FAME8", + "gene": "RAI1", + "evidence": [ + "Limited" + ], + "chrom": "chr17", + "start_hg38": 17808358, + "stop_hg38": 17808460, + "start_hg19": 17711672, + "stop_hg19": 17711774, + "start_t2t": 17754961, + "stop_t2t": 17755053, + "disease": "Familial adult myoclonic epilepsy type 8", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Observed in a single family from Mali with ten affected individuals [@pmid:37994247].", + "age_onset": "7-68 (one family)", + "age_onset_min": 7, + "age_onset_max": 68, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1 gene that co-segregated with disease status in a single large family from Mali [@pmid:37994247]. Ten affected individuals were studied. Both TTTTA and TTTCA motifs were observed in all eight of the affected individuals with spanning reads, with allele sizes in the range: (TTTTA)278-773(TTTCA)9-334. A single individual was observed with additional motifs and interruptions in one allele with the structure: (TTTTA)exp(GGGGT)ins(GGGAT)ins(TTTCA)ins. TTTCA repeats were absent in 200 Malian controls, who had alleles in the range: (TTTCA)16-20. Reviewed in [@pmid:38876750]. It is uncertain if expansions at both the TTTTA and TTTCA motifs, or only the TTTCA motif are required for pathogenicity. The pathogenic range in STRchive is for the TTTCA motif only. Note: locus is partially deleted in T2T reference genome.", + "detection": null, + "mechanism": "Unknown", + "mechanism_detail": "Expression isn't changed [@pmid:7994247].", + "year": "2024 [@pmid:37994247]", + "location_in_gene": "Intron 4", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "TTTTA" + ], + "pathogenic_motif_reference_orientation": [ + "TTTCA" + ], + "benign_motif_reference_orientation": [ + "TTTTA" + ], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "GGGGT", + "GGGAT" + ], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [ + "ATTTT" + ], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "GGGGT", + "ATGGG" + ], + "locus_structure": [ + { + "motif": "TTTTA", + "count": 18, + "type": "internal_repeat" + }, + { + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 9, + "pathogenic_max": 334, + "motif_len": 5, + "ref_copies": 20.8, + "novel": "novel", + "gard": [ + "16758" + ], + "genereviews": [], + "malacard": [], + "medgen": [], + "mondo": [], + "omim": [], + "orphanet": [ + "86814" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [ + "486849" + ], + "webstr_hg19": [], + "locus_tags": [ + "motif_affects_onset" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:7994247", + "pmid:37994247", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:41874439", + "pmid:41219789", + "pmid:40541176", + "pmid:38871700", + "pmid:37339841", + "pmid:34565721", + "pmid:33186760", + "pmid:32283749", + "pmid:32281848", + "pmid:30891880", + "pmid:30622881", + "pmid:25663198", + "pmid:23897707", + "pmid:17457615", + "pmid:15148657", + "pmid:11594924", + "pmid:10915763", + "pmid:8817239" + ] + }, + { + "id": "FAME7_RAPGEF2", + "disease_id": "FAME7", + "gene": "RAPGEF2", + "evidence": [ + "Limited" + ], + "chrom": "chr4", + "start_hg38": 159342526, + "stop_hg38": 159342618, + "start_hg19": 160263678, + "stop_hg19": 160263770, + "start_t2t": 162693303, + "stop_t2t": 162693405, + "disease": "Familial adult myoclonic epilepsy type 7", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. Repeat expansion found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 20-33 [@pmid:30351492]; Range: 18 [@pmid:29507423] - 37 [@pmid:30351492].", + "age_onset_min": 18, + "age_onset_max": 37, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "The locus structure is (TTTTA)exp(TTTCA)exp(TTTTA)n, where only the TTTCA is specific to affected individuals as a pathogenic insertion [@pmid:29507423; @pmid:30351492]. Pathogenic expansions range from 60 to thousands of repeats [@pmid:29507423; @pmid:30351492]. Interruptions seen: TATTA, TTTTTA [@pmid:35245110].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423].", + "year": "2018 [@pmid:29507423]", + "location_in_gene": "Intron 14", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "TTTTA" + ], + "pathogenic_motif_reference_orientation": [ + "TTTCA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "TTTTT", + "TTATG" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "TTTTT", + "ATGTT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "TTTTA", + "count": 17, + "type": "internal_repeat" + }, + { + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 60, + "pathogenic_max": 2200, + "motif_len": 5, + "ref_copies": 17.4, + "novel": "novel", + "gard": [ + "16758" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "EPL228" + ], + "medgen": [ + "1648435" + ], + "mondo": [ + "0054847" + ], + "omim": [ + "618075" + ], + "orphanet": [ + "86814" + ], + "gnomad": [ + "RAPGEF2" + ], + "stripy": [ + "RAPGEF2" + ], + "tr_atlas": [ + "TR49300" + ], + "webstr_hg38": [ + "154264", + "4792219" + ], + "webstr_hg19": [ + "STR_1096016" + ], + "locus_tags": [ + "motif_affects_penetrance" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:30351492", + "pmid:29507423", + "pmid:35245110", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:41219789", + "pmid:36092952", + "pmid:33040085", + "pmid:31483537" + ] + }, + { + "id": "CANVAS_RFC1", + "disease_id": "CANVAS", + "gene": "RFC1", + "evidence": [ + "Definitive" + ], + "chrom": "chr4", + "start_hg38": 39348424, + "stop_hg38": 39348483, + "start_hg19": 39350044, + "stop_hg19": 39350103, + "start_t2t": 39318077, + "stop_t2t": 39318136, + "disease": "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Sensory disturbances, imbalance, oscillopsia, chronic dry cough, dysarthria and dysphagia [@pmid:38876750]; Late-onset ataxia, sensory neuropathy, vestibular areflexia syndrome [@pmid:39349043]. This expansion has been implicated in the genetic etiology of Parkinson's disease [@pmid:41177915].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Carrier frequency in Europeans is 0.7-4% and in Chinese Han population is 2.24%; estimated prevalence of 1/20,000 to 1/625 [@genereviews:NBK564656]. Many cases are likely not diagnosed due to heterogeneous presentation [@pmid:39230846]. Observed in multiple ethnicities [@pmid:38876750]; patients diagnosed with European, Chinese Han, and Maori ancestry, as well as found in Japan, Canada, Brazil, the UK, Italy, Germany, and Australia [@genereviews:NBK564656].", + "age_onset": "Typical: 36-52; Range: 19-76 [@genereviews:NBK564656].", + "age_onset_min": 19, + "age_onset_max": 76, + "typ_age_onset_min": 36, + "typ_age_onset_max": 52, + "details": "Disease is caused by an insertion of a pathogenic motif, although motif presence is variable and can expand up to 200 repeats without apparently causing a phenotype [@genereviews:NBK564656]. Pathogenic expansions (ranging from 400-2750 pathogenic motifs) may be flanked by other motifs [@genereviews:NBK564656]. For example, (AAAGG)10-25(AAGGG)exp(AAAGG)4-6 [@pmid:32851396]. Motif heterogeneity is common in unaffected individuals [@genereviews:NBK564656], and motif associations are described by Delforge et al. [@pmid:38627134]. The pathogenic size threshold appears to differ for the AAAGG motif: AAAGG expansions >= 600 repeats have been observed in CANVAS patients (vs 400 with established pathogenic motif AAGGG), while ~100-380 AAAGG repeats were found in unaffected controls [@pmid:37450567]. Length appears to impact age of onset and disease severity, with particular impact from the smaller allele [@doi:10.1136/jnnp-2024-ABN.259]. Phenotypic spectrum may include Parkinsonism [@pmid:39833204], chronic cough [@pmid:39811557], idiopathic sensory neuropathy, small fiber neuropathy, and sensorimotor neuropathy [@pmid:41964406].", + "detection": "Expansions are suggested by flanking PCR failure and a pathogenic RP-PCR sawtooth pattern, but biallelic confirmation and sizing rely on Southern blotting [@genereviews:NBK564656]. Long-read sequencing or optical genome mapping are useful for resolving this variable, complex motif structure [@pmid:37892228; @pmid:37450567].", + "mechanism": "LoF", + "mechanism_detail": "LoF; exact mechanism unknown [@pmid:38467784].", + "year": "2019 [@pmid:31230722]", + "location_in_gene": "Intron 2", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "AAAAG" + ], + "pathogenic_motif_reference_orientation": [ + "AAGGG", + "ACAGG", + "AAAGG", + "AGGGC" + ], + "benign_motif_reference_orientation": [ + "AAAAG", + "AAAGGG" + ], + "unknown_motif_reference_orientation": [ + "AAAAA", + "AAAAC", + "AACGG", + "AAGAC", + "AAGGT", + "AGGGG", + "AAGAG", + "AAAAGG", + "AAACG", + "AACAG", + "AGGTG", + "ACGGG", + "AAAAAG", + "AAGGC" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CCCTT", + "CCTGT", + "CCTTT", + "CCCTG" + ], + "benign_motif_gene_orientation": [ + "CTTTT", + "CCCTTT" + ], + "unknown_motif_gene_orientation": [ + "TTTTT", + "GTTTT", + "CCGTT", + "CTTGT", + "ACCTT", + "CCCCT", + "CTCTT", + "CCTTTT", + "CGTTT", + "CTGTT", + "ACCTC", + "CCCGT", + "CTTTTT", + "CCTTG" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "AAAAG", + "count": 11, + "type": "internal_repeat" + }, + { + "motif": "AAGGG", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 0, + "benign_max": 11, + "intermediate_min": 11, + "intermediate_max": 200, + "pathogenic_min": 400, + "pathogenic_max": 2750, + "motif_len": 5, + "ref_copies": 11.8, + "novel": "novel", + "gard": [ + "17937" + ], + "genereviews": [ + "NBK564656" + ], + "malacard": [ + "CRB196" + ], + "medgen": [ + "482853" + ], + "mondo": [ + "0044720" + ], + "omim": [ + "614575" + ], + "orphanet": [ + "504476" + ], + "gnomad": [ + "RFC1" + ], + "stripy": [ + "RFC1" + ], + "tr_atlas": [ + "TR42349" + ], + "webstr_hg38": [ + "4722884", + "99101" + ], + "webstr_hg19": [ + "STR_1036603" + ], + "locus_tags": [ + "motif_affects_penetrance", + "length_affects_onset", + "length_affects_severity" + ], + "disease_tags": [ + "ataxia", + "phenotypic_spectrum" + ], + "references": [ + "genereviews:NBK564656", + "pmid:38467784", + "pmid:32851396", + "pmid:38627134", + "pmid:37450567", + "doi:10.1136/jnnp-2024-ABN.259", + "pmid:39833204", + "pmid:39811557", + "pmid:41964406", + "pmid:39230846", + "pmid:38876750", + "pmid:31230722", + "pmid:39349043", + "pmid:41177915" + ], + "additional_literature": [ + "pmid:42178418", + "pmid:42096001", + "pmid:42094143", + "pmid:42038259", + "pmid:41840142", + "pmid:41780084", + "pmid:41689662", + "pmid:41614301", + "pmid:41592538", + "pmid:41532091", + "pmid:41426430", + "pmid:41327893", + "pmid:41322202", + "pmid:41278766", + "pmid:41145152", + "pmid:41118032", + "pmid:41084404", + "pmid:41074692", + "pmid:41055766", + "pmid:40898875", + "pmid:40894141", + "pmid:40802152", + "pmid:40765612", + "pmid:40637932", + "pmid:40595562", + "pmid:40594369", + "pmid:40488180", + "pmid:40481300", + "pmid:40461673", + "pmid:40417743", + "pmid:40313272", + "pmid:40273470", + "pmid:40221271", + "pmid:40211677", + "pmid:40204545", + "pmid:40141365", + "pmid:40113266", + "pmid:40007153", + "pmid:39812846", + "pmid:39721397", + "pmid:39571249", + "pmid:39543176", + "pmid:39507594", + "pmid:39416949", + "pmid:39406499", + "pmid:39342186", + "pmid:39286915", + "pmid:39231235", + "pmid:39219417", + "pmid:39152783", + "pmid:39076534", + "pmid:38978724", + "pmid:38916676", + "pmid:38789445", + "pmid:38579416", + "pmid:38487929", + "pmid:38447794", + "pmid:38381906", + "pmid:38381176", + "pmid:38324175", + "pmid:38311638", + "pmid:38306376", + "pmid:38266156", + "pmid:38193360", + "pmid:38168171", + "pmid:38145611", + "pmid:38062616", + "pmid:38054570", + "pmid:37917284", + "pmid:37892228", + "pmid:37853169", + "pmid:37747091", + "pmid:37660923", + "pmid:37578187", + "pmid:37546920", + "pmid:37476326", + "pmid:37460231", + "pmid:37414537", + "pmid:37399286", + "pmid:36805468", + "pmid:36753892", + "pmid:36705320", + "pmid:36381255", + "pmid:36289003", + "pmid:36250766", + "pmid:36227727", + "pmid:36214978", + "pmid:36177974", + "pmid:36088850", + "pmid:36061987", + "pmid:36046423", + "pmid:36034314", + "pmid:35884855", + "pmid:35883251", + "pmid:35864213", + "pmid:35633373", + "pmid:35585435", + "pmid:35502508", + "pmid:35355059", + "pmid:35306791", + "pmid:35253317", + "pmid:38835435", + "pmid:35013364", + "pmid:34968871", + "pmid:34927205", + "pmid:34600502", + "pmid:34537679", + "pmid:34101140", + "pmid:33969391", + "pmid:33940977", + "pmid:33884451", + "pmid:33807868", + "pmid:33745133", + "pmid:33666721", + "pmid:33495376", + "pmid:33188504", + "pmid:33103729", + "pmid:33068477", + "pmid:33068476", + "pmid:32949124", + "pmid:32939785", + "pmid:32910249", + "pmid:32873692", + "pmid:32732387", + "pmid:32694621", + "pmid:32682126", + "pmid:32582864", + "pmid:32151945", + "pmid:32066831", + "pmid:32040566", + "pmid:31824583", + "pmid:31817852", + "pmid:31370354", + "pmid:30926972", + "pmid:25648260", + "pmid:25007187", + "pmid:24686188", + "pmid:22086855", + "pmid:15457444", + "pmid:12556494" + ] + }, + { + "id": "OPDM4_RILPL1", + "disease_id": "OPDM4", + "gene": "RILPL1", + "evidence": [ + "Moderate" + ], + "chrom": "chr12", + "start_hg38": 123533720, + "stop_hg38": 123533750, + "start_hg19": 124018267, + "stop_hg19": 124018297, + "start_t2t": 123532573, + "stop_t2t": 123532603, + "disease": "Oculopharyngodistal myopathy type 4", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Population dependent: 21.6% of one OPDM cohort [@pmid:35148830]. Typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 18-30 [@pmid:35148830]; Range: 10-30 [@pmid:35700120].", + "age_onset_min": 10, + "age_onset_max": 30, + "typ_age_onset_min": 18, + "typ_age_onset_max": 30, + "details": "Benign alleles have been documented to have 6-16 repeats [@pmid:37864208], while pathogenic repeats range from 120 to 197 repeats; there is no apparent relationship between allele size and age of onset [@pmid:37864208; @pmid:35148830]. Intermediate alleles may be associated with incomplete penetrance, or milder phenotypes [@pmid:35148830]. AGG, TGG, and CGT interruptions observed [@pmid:35148830; @pmid:35700120].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to RNA-mediated gain-of-function mechanism [@pmid:38467784].", + "year": "2022 [@pmid:35148830]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GGC" + ], + "pathogenic_motif_reference_orientation": [ + "GGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "TGG", + "CGT", + "AGG" + ], + "pathogenic_motif_gene_orientation": [ + "CCG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "ACC", + "ACG", + "CCT" + ], + "locus_structure": [], + "benign_min": 6, + "benign_max": 16, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 120, + "pathogenic_max": 197, + "motif_len": 3, + "ref_copies": 11.7, + "novel": "ref", + "gard": [ + "12592" + ], + "genereviews": [], + "malacard": [ + "OCL085" + ], + "medgen": [ + "1809981" + ], + "mondo": [ + "0030712" + ], + "omim": [], + "orphanet": [ + "98897" + ], + "gnomad": [ + "RILPL1" + ], + "stripy": [ + "RILPL1" + ], + "tr_atlas": [ + "TR121403" + ], + "webstr_hg38": [ + "5128610", + "609239" + ], + "webstr_hg19": [ + "STR_347096" + ], + "locus_tags": [], + "disease_tags": [ + "oculopharyngodistal_myopathy" + ], + "references": [ + "pmid:35148830", + "pmid:35700120", + "pmid:38467784", + "pmid:37864208", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:41792844", + "pmid:40645757", + "pmid:40084170", + "pmid:39044557", + "pmid:39013564", + "pmid:37923380" + ] + }, + { + "id": "CCD_RUNX2", + "disease_id": "CCD", + "gene": "RUNX2", + "evidence": [ + "Definitive" + ], + "chrom": "chr6", + "start_hg38": 45422750, + "stop_hg38": 45422801, + "start_hg19": 45390487, + "stop_hg19": 45390538, + "start_t2t": 45257567, + "stop_t2t": 45257618, + "disease": "Cleidocranial dysplasia", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A condition that primarily affects the development of the bones and teeth. Characteristic features include underdeveloped or absent collarbones (clavicles); dental abnormalities; and delayed closing of the spaces between the skull bones (fontanels). Other features may include decreased bone density (osteopenia), osteoporosis, hearing loss, bone abnormalities of the hands, and recurrent sinus and ear infections [@mondo:0007340].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "All conditions 1/1,000,000 births (likely underdiagnosed); Utah population frequency 0.12/10,000. Found in many ethnic groups [@orphanet:1452]. TR expansions causative in 2 individuals [@genereviews:NBK535148].", + "age_onset": "0 (birth) [@genereviews:NBK1513].", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (4-17 repeats) established from gnomAD and primary literature; pathogenic ranges (20-27) reflect two clinical cases to date [@gnomad:RUNX2; @pmid:26220009]. Intermediate alleles (i.e, 18 repeats; 19 not reported) appear to not be associated with disease [@pmid:20560987; @pmid:26220009]. The gene RUNX2 was previously called CBFA1, as reflected in some of the literature [@pmid:9182765].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansion leading to haploinsufficiency [@pmid:26220009].", + "year": "Causation identified in 2015 [@pmid:26220009]; clinical association found in 1997 [@pmid:9182765]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 17, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 20, + "pathogenic_max": 27, + "motif_len": 3, + "ref_copies": 15, + "novel": "ref", + "gard": [ + "6118" + ], + "genereviews": [ + "NBK1513" + ], + "malacard": [ + "CLD001" + ], + "medgen": [ + "3486" + ], + "mondo": [ + "0007340" + ], + "omim": [ + "119600" + ], + "orphanet": [ + "1452" + ], + "gnomad": [ + "RUNX2" + ], + "stripy": [ + "RUNX2" + ], + "tr_atlas": [ + "TR65117" + ], + "webstr_hg38": [ + "5789216" + ], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "genereviews:NBK1513", + "pmid:26220009", + "gnomad:RUNX2", + "pmid:20560987", + "pmid:9182765", + "orphanet:1452", + "genereviews:NBK535148", + "mondo:0007340" + ], + "additional_literature": [ + "pmid:41468806", + "pmid:40585427", + "pmid:37365568", + "pmid:37202645", + "pmid:32386547", + "pmid:24497578", + "pmid:22912713", + "pmid:21887706", + "pmid:19264154" + ] + }, + { + "id": "FAME1_SAMD12", + "disease_id": "FAME1", + "gene": "SAMD12", + "evidence": [ + "Definitive" + ], + "chrom": "chr8", + "start_hg38": 118366812, + "stop_hg38": 118366918, + "start_hg19": 119379051, + "stop_hg19": 119379157, + "start_t2t": 119495247, + "stop_t2t": 119495353, + "disease": "Familial adult myoclonic epilepsy type 1", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical myoclonus, with seizures in up to a half of patients [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. Typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 21-39 [@pmid:29939203]; Range: 8 [@pmid:40503331] - 68 [@pmid:29507423].", + "age_onset_min": 8, + "age_onset_max": 68, + "typ_age_onset_min": 21, + "typ_age_onset_max": 39, + "details": "Novel, pathogenic alleles include expansions of TTTTAn + TTTCAn, but only the TTTCA insertion is specific to affected individuals and associated with symptom age of onset [@pmid:39569876]; pathogenic expansions range from 105 to 3860 repeats [@omim:601068; @pmid:29507423]", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA mediated gain of function proposed [@omim:601068; @pmid:38467784].", + "year": "2018 [@pmid:29507423]", + "location_in_gene": "Intron 4/4", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "TAAAA" + ], + "pathogenic_motif_reference_orientation": [ + "TGAAA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "AAAAA", + "TAAAC", + "TAACA", + "TACAA", + "TACAC" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "TTTTT", + "AGTTT", + "ATGTT", + "ATTGT", + "AGTGT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "TAAAA", + "count": 20, + "type": "internal_repeat" + }, + { + "motif": "TGAAA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 105, + "pathogenic_max": 3680, + "motif_len": 5, + "ref_copies": 21.6, + "novel": "novel", + "gard": [ + "18082" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "EPL201" + ], + "medgen": [ + "371424" + ], + "mondo": [ + "0010985" + ], + "omim": [ + "601068" + ], + "orphanet": [ + "86814" + ], + "gnomad": [ + "SAMD12" + ], + "stripy": [ + "SAMD12" + ], + "tr_atlas": [ + "TR89226" + ], + "webstr_hg38": [ + "1087693" + ], + "webstr_hg19": [], + "locus_tags": [ + "somatic_instability", + "anticipation", + "motif_affects_instability", + "motif_affects_onset", + "motif_affects_penetrance", + "maternal_expansion" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:29939203", + "pmid:40503331", + "pmid:29507423", + "omim:601068", + "pmid:38467784", + "pmid:39569876", + "pmid:38876750", + "pmid:39349043" + ], + "additional_literature": [ + "pmid:41874439", + "pmid:41850906", + "pmid:41426430", + "pmid:41219789", + "pmid:38961870", + "pmid:38467733", + "pmid:38059543", + "pmid:37592133", + "pmid:36740228", + "pmid:36622139", + "pmid:36092952", + "pmid:33791773", + "pmid:33721773", + "pmid:33681653", + "pmid:33501421", + "pmid:33040085", + "pmid:32973343", + "pmid:32203200", + "pmid:32194077", + "pmid:32174879", + "pmid:31664039", + "pmid:31483537", + "pmid:30559482", + "pmid:30351492", + "pmid:30194086" + ] + }, + { + "id": "XLID_SOX3", + "disease_id": "XLID, PHPX", + "gene": "SOX3", + "evidence": [ + "Limited" + ], + "chrom": "chrX", + "start_hg38": 140504316, + "stop_hg38": 140504361, + "start_hg19": 139586481, + "stop_hg19": 139586526, + "start_t2t": 138816203, + "stop_t2t": 138816248, + "disease": "X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX)", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without intellectual disability [@pmid:24346842].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "3 families reported, however they were distributed across the world [@omim:300123].", + "age_onset": "Typical: 0-3 (small sample size) [@pmid:19654509; @pmid:21289259]; range: 0-9 [@pmid:19654509].", + "age_onset_min": 0, + "age_onset_max": 9, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148]. There is phenotypic and allelic overlap between XLID and PHPX, with the pathogenic threshold for XLID estimated at 26 motifs and the pathogenic threshold for PHPX estimated at 22 motifs [@pmid:15800844, @pmid:12428212].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to aggresome formation and impaired transcriptional activity [@pmid:17127446].", + "year": "2002 [@pmid:12428212]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "NGC" + ], + "pathogenic_motif_reference_orientation": [ + "NGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 26, + "motif_len": 3, + "ref_copies": 15, + "novel": "ref", + "gard": [], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "PNH005", + "INT405" + ], + "medgen": [ + "394771" + ], + "mondo": [ + "0010252" + ], + "omim": [ + "300123", + "312000" + ], + "orphanet": [ + "67045" + ], + "gnomad": [ + "SOX3" + ], + "stripy": [ + "SOX3" + ], + "tr_atlas": [ + "TR173479" + ], + "webstr_hg38": [], + "webstr_hg19": [ + "STR_1597784" + ], + "locus_tags": [ + "contraction" + ], + "disease_tags": [], + "references": [ + "pmid:19654509", + "pmid:21289259", + "pmid:17127446", + "genereviews:NBK535148", + "pmid:15800844", + "pmid:12428212", + "omim:300123", + "pmid:24346842" + ], + "additional_literature": [] + }, + { + "id": "FAME2_STARD7", + "disease_id": "FAME2", + "gene": "STARD7", + "evidence": [ + "Strong" + ], + "chrom": "chr2", + "start_hg38": 96197066, + "stop_hg38": 96197124, + "start_hg19": 96862804, + "stop_hg19": 96862862, + "start_t2t": 96703674, + "stop_t2t": 96703732, + "disease": "Familial adult myoclonic epilepsy 2", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Finger, hand tremor with later-onset myoclonus and generalised tonic-clonic seizures [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "This repeat expansion is typically found in individuals of European ancestry [@pmid:38876750].", + "age_onset": "Typical: 12-30; Range: 4-60 [@pmid:31664034].", + "age_onset_min": 4, + "age_onset_max": 60, + "typ_age_onset_min": 12, + "typ_age_onset_max": 30, + "details": "Disease caused by novel insertion of pathogenic motif (not found in any controls); size of pathogenic motif observed in two probands ranged from ~274-558 repeats, while the expanded reference motif ranged from 340-390 [@pmid:31664034].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity theorized [@pmid:31664034; @pmid:38467784].", + "year": "2019 [@pmid:31664034]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "AAAAT" + ], + "pathogenic_motif_reference_orientation": [ + "AAATG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "AAAAA", + "AAAAC", + "AAACC", + "AAACG", + "AAACT", + "AACTC", + "AACTG", + "AATAC", + "AATAG", + "ATAAC" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "TTTTT", + "GTTTT", + "GGTTT", + "CGTTT", + "AGTTT", + "AGTTG", + "AGTTC", + "ATTGT", + "ATTCT", + "ATGTT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "AAATG", + "count": null, + "type": "pathogenic_repeat" + }, + { + "motif": "AAAAT", + "count": 11, + "type": "internal_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 274, + "pathogenic_max": 558, + "motif_len": 5, + "ref_copies": 11.6, + "novel": "novel", + "gard": [ + "18083" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "EPL203" + ], + "medgen": [ + "375031" + ], + "mondo": [ + "0011930" + ], + "omim": [ + "607876" + ], + "orphanet": [ + "86814" + ], + "gnomad": [ + "STARD7" + ], + "stripy": [ + "STARD7" + ], + "tr_atlas": [ + "TR19329" + ], + "webstr_hg38": [ + "286156" + ], + "webstr_hg19": [ + "STR_754470" + ], + "locus_tags": [ + "somatic_instability", + "motif_affects_instability", + "motif_affects_penetrance" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:31664034", + "pmid:38467784", + "pmid:38876750", + "pmid:39349043" + ], + "additional_literature": [ + "pmid:41219789", + "pmid:33040085" + ] + }, + { + "id": "XDP_TAF1", + "disease_id": "XDP", + "gene": "TAF1", + "evidence": [ + "Definitive" + ], + "chrom": "chrX", + "start_hg38": 71453054, + "stop_hg38": 71453131, + "start_hg19": 70672904, + "stop_hg19": 70672981, + "start_t2t": 69887153, + "stop_t2t": 69887230, + "disease": "X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3)", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "X-linked dystonia-parkinsonism (XDP) associated with antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron of TAF1. Clinical features include focal and generalised dystonia, parkinsonism, cognitive dysfunction. XX individuals who are heterozygous carriers usually do not develop the full syndrome, although some patients have non-progressive focal dystonia with parkinsonism. Disease severity is associated with number of hexanucleotide repeats within the SVA. (Adapted) [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Philippines overall 0.34:100,000. Panay Islands 5.24:100,000. Capiz province 18.9:100,000. To date, all known cases to date are of Filipino descent [@pmid:38876750].", + "age_onset": "Average age of onset for XDP is 39.7 years in males, 52 years in females, range 12-79 years. ~99% of cases are male [@pmid:29229810; @pmid:38876750; @pmid:15596620].", + "age_onset_min": 12, + "age_onset_max": 79, + "typ_age_onset_min": 39.7, + "typ_age_onset_max": 39.7, + "details": "Strong inverse relationship between age of onset and insertion length, which varied between 35-52 repeats [@pmid:29229810].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Altered splicing with intron retention, haploinsufficiency [@pmid:38876750].", + "year": "2017 [@pmid:29229810]", + "location_in_gene": "Intron 32", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "AGAGGG" + ], + "pathogenic_motif_reference_orientation": [ + "AGAGGG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGAGGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 35, + "pathogenic_max": 52, + "motif_len": 6, + "ref_copies": 4, + "novel": "ref", + "gard": [ + "10533" + ], + "genereviews": [ + "NBK1489" + ], + "malacard": [ + "DYS064" + ], + "medgen": [ + "326820" + ], + "mondo": [ + "0010747" + ], + "omim": [ + "314250" + ], + "orphanet": [ + "53351" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [ + "TR592600" + ], + "webstr_hg38": [ + "861907" + ], + "webstr_hg19": [ + "STR_1564408" + ], + "locus_tags": [ + "length_affects_onset" + ], + "disease_tags": [], + "references": [ + "pmid:29229810", + "pmid:38876750", + "pmid:15596620" + ], + "additional_literature": [ + "pmid:41443196", + "pmid:40463055", + "pmid:38834915", + "pmid:38616406", + "pmid:37234925", + "pmid:35971992", + "pmid:38835911", + "pmid:35868859", + "pmid:35481544", + "pmid:35395816", + "pmid:38835428", + "pmid:34250228", + "pmid:34111553", + "pmid:32533168", + "pmid:32152096", + "pmid:27806289", + "pmid:18952144", + "pmid:18713817", + "pmid:17273961", + "pmid:7668293", + "pmid:7829058", + "pmid:1518853" + ] + }, + { + "id": "OPDM_TBC1D7", + "disease_id": "OPDM", + "gene": "TBC1D7", + "evidence": [ + "Provisional" + ], + "chrom": "chr6", + "start_hg38": 13328476, + "stop_hg38": 13328603, + "start_hg19": 13328708, + "stop_hg19": 13328835, + "start_t2t": 13201716, + "stop_t2t": 13201843, + "disease": "Oculopharyngodistal myopathy", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "This is a newly proposed locus for OPDM, only having been reported in one paper [@pmid:41959811]. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in 3 families (7 total patients) of European ancestry [@pmid:41959811].", + "age_onset": "2nd to 6th decade (3/5 patients had onset in 2nd decade). Referred to as adult onset, so assuming high end of 2nd decade [@pmid:41959811]", + "age_onset_min": 18, + "age_onset_max": 59, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (0-60) estimated from population data and pathogenic range (83-148) gathered from 7 patients from 3 unrelated families [@pmid:41959811]. The hg38 coordinates reported in the paper (chr6:13328476-13328603) [@pmid:41959811] contain multiple annotated TRs and interruptions, so the true coordinates are likely more narrow.", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Gain of Function apparent, but mechanism is unknown. Methylation and RAN translation have been oberserved [@pmid:41959811].", + "year": "2026 [@pmid:41959811]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 0, + "benign_max": 60, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 83, + "pathogenic_max": 148, + "motif_len": 3, + "ref_copies": null, + "novel": "ref", + "gard": [ + "12592" + ], + "genereviews": [], + "malacard": [], + "medgen": [ + "320250" + ], + "mondo": [], + "omim": [ + "612655" + ], + "orphanet": [ + "98897" + ], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [ + "oculopharyngodistal_myopathy" + ], + "references": [ + "pmid:41959811", + "mondo:0025193" + ], + "additional_literature": [] + }, + { + "id": "SCA17_TBP", + "disease_id": "SCA17", + "gene": "TBP", + "evidence": [ + "Definitive" + ], + "chrom": "chr6", + "start_hg38": 170561906, + "stop_hg38": 170562017, + "start_hg19": 170870994, + "stop_hg19": 170871105, + "start_t2t": 171935458, + "stop_t2t": 171935569, + "disease": "Spinocerebellar ataxia type 17", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by a variable clinical picture which can include dementia, psychiatric disorders, parkinsonism, dystonia, chorea, spasticity, and epilepsy [@mondo:0011781].", + "hpo_terms": null, + "prevalence": "0.2/100000", + "prevalence_details": "Unknown (global), <100 families, 0.47:1,000,000 (Japanese), 0.16/100,000 (England) [@genereviews:NBK1438; @pmid:29100084]: 0.2/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1438].", + "age_onset": "Typical: 19-48; Range: 3-62, has second variant to delay onset [@omim:607136].", + "age_onset_min": 3, + "age_onset_max": 62, + "typ_age_onset_min": 19, + "typ_age_onset_max": 48, + "details": "Benign range is 25-40 repeats, pathogenic range is 49+ repeats (largest to date 66 motifs, with mild correlation between size and age of onset), and intermediate alleles (41-48 repeats) are associated with reduced penetrance and potentially milder phenotypes [@genereviews:NBK1438]. Huntington's disease-like phenotype [@pmid:12805114]. CAA CAG CAA interruption is seen in all alleles stably transmitted across generations [@genereviews:NBK1438;@pmid:35245110].", + "detection": "Short-read sequencing is reported to detect expansions but cannot size alleles beyond 250 bp. PCR amplification may detect expansions of ≤66 repeats [@pmid:37906407; @genereviews:NBK1438].", + "mechanism": "LoF/GoF", + "mechanism_detail": "Polyglutamine expansion leading to transcriptional dysregulation [@pmid:35053321].", + "year": "1999 [@pmid:10484774]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "CAA" + ], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AAC" + ], + "locus_structure": [], + "benign_min": 25, + "benign_max": 40, + "intermediate_min": 41, + "intermediate_max": 48, + "pathogenic_min": 49, + "pathogenic_max": 66, + "motif_len": 3, + "ref_copies": 37, + "novel": "ref", + "gard": [ + "10469" + ], + "genereviews": [ + "NBK1438" + ], + "malacard": [ + "SPN296" + ], + "medgen": [ + "337637" + ], + "mondo": [ + "0011781" + ], + "omim": [ + "607136" + ], + "orphanet": [ + "98759" + ], + "gnomad": [ + "TBP" + ], + "stripy": [ + "TBP" + ], + "tr_atlas": [ + "TR72502" + ], + "webstr_hg38": [ + "83566" + ], + "webstr_hg19": [], + "locus_tags": [ + "somatic_instability", + "anticipation", + "paternal_expansion", + "length_affects_onset", + "length_affects_penetrance", + "length_affects_phenotype", + "motif_affects_instability" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "omim:607136,@pmid:35053321,@genereviews:NBK1438,@pmid:12805114,@genereviews:NBK1438", + "pmid:35245110,@genereviews:NBK1438,@pmid:29100084,@pmid:10484774,@mondo:0011781" + ], + "additional_literature": [ + "pmid:42196324", + "pmid:42038259", + "pmid:41843312", + "pmid:41762523", + "pmid:41612618", + "pmid:41009775", + "pmid:40488180", + "pmid:40478462", + "pmid:39950762", + "pmid:39820777", + "pmid:39680235", + "pmid:39456985", + "pmid:39125760", + "pmid:38973070", + "pmid:38961870", + "pmid:38494459", + "pmid:37855597", + "pmid:37632648", + "pmid:37146135", + "pmid:36599645", + "pmid:36476347", + "pmid:36422518", + "pmid:35926480", + "pmid:35868859", + "pmid:35493319", + "pmid:35482253", + "pmid:35275350", + "pmid:35182509", + "pmid:34906452", + "pmid:34600502", + "pmid:34565721", + "pmid:34256333", + "pmid:34235484", + "pmid:33502644", + "pmid:33377399", + "pmid:32675418", + "pmid:32533168", + "pmid:32386547", + "pmid:31940111", + "pmid:31919387", + "pmid:31522753", + "pmid:30920184", + "pmid:30891880", + "pmid:30617627", + "pmid:30615214", + "pmid:30532692", + "pmid:30314815", + "pmid:30120431", + "pmid:29801887", + "pmid:29564144", + "pmid:29249939", + "pmid:29057148", + "pmid:28821675", + "pmid:28585930", + "pmid:28444220", + "pmid:28153533", + "pmid:27865706", + "pmid:27400454", + "pmid:27172828", + "pmid:26476771", + "pmid:26387956", + "pmid:26374734", + "pmid:26267067", + "pmid:26077168", + "pmid:25672822", + "pmid:24972706", + "pmid:24677642", + "pmid:24534762", + "pmid:23665119", + "pmid:23475385", + "pmid:21710129", + "pmid:21562248", + "pmid:21437269", + "pmid:20587494", + "pmid:20199210", + "pmid:20004653", + "pmid:19595623", + "pmid:19566714", + "pmid:18218637", + "pmid:18043721", + "pmid:17961920", + "pmid:17420317", + "pmid:17273961", + "pmid:17033685", + "pmid:16858508", + "pmid:16626296", + "pmid:16223509", + "pmid:16054804", + "pmid:15850778", + "pmid:15533937", + "pmid:15503103", + "pmid:15381080", + "pmid:15365789", + "pmid:15225551", + "pmid:15193429", + "pmid:14985389", + "pmid:14967767", + "pmid:12953269", + "pmid:12891385", + "pmid:12853230", + "pmid:12758065", + "pmid:11939898", + "pmid:11571212", + "pmid:11313753", + "pmid:9399691", + "pmid:8886170", + "pmid:7892196", + "pmid:8503450" + ] + }, + { + "id": "TOF_TBX1", + "disease_id": "TOF", + "gene": "TBX1", + "evidence": [ + "Limited" + ], + "chrom": "chr22", + "start_hg38": 19766762, + "stop_hg38": 19766807, + "start_hg19": 19754285, + "stop_hg19": 19754330, + "start_t2t": 20143615, + "stop_t2t": 20143660, + "disease": "Tetralogy of Fallot", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Tetralogy of Fallot is a congenital cardiac malformation that consists of an interventricular communication, also known as a ventricular septal defect, obstruction of the right ventricular outflow tract, override of the ventricular septum by the aortic root, and right ventricular hypertrophy [@mondo:0008542].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in one Turkish individual [@genereviews:NBK535148].", + "age_onset": "0", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Found in one Turkish individual with Tetralogy of Fallot who had 25 repeats rather than 15 [@genereviews:NBK535148].", + "detection": null, + "mechanism": "LoF/GoF", + "mechanism_detail": "Polyalanine expansion, leading to cytoplasmic aggregation [@omim:187500; @pmid:19948535].", + "year": "2010 [@pmid:19948535]", + "location_in_gene": "Coding Exon 9", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 25, + "pathogenic_max": 25, + "motif_len": 3, + "ref_copies": 15, + "novel": "ref", + "gard": [ + "2245" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "TTR001" + ], + "medgen": [ + "21498" + ], + "mondo": [ + "0008542" + ], + "omim": [ + "187500" + ], + "orphanet": [ + "3303" + ], + "gnomad": [ + "TBX1" + ], + "stripy": [ + "TBX1" + ], + "tr_atlas": [ + "TR163862" + ], + "webstr_hg38": [ + "4900984" + ], + "webstr_hg19": [ + "STR_889797" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "omim:187500", + "pmid:19948535", + "genereviews:NBK535148", + "mondo:0008542" + ], + "additional_literature": [ + "pmid:41607489", + "pmid:24797903", + "pmid:16141220", + "pmid:10440825" + ] + }, + { + "id": "FECD3_TCF4", + "disease_id": "FECD3", + "gene": "TCF4", + "evidence": [ + "Definitive" + ], + "chrom": "chr18", + "start_hg38": 55586153, + "stop_hg38": 55586229, + "start_hg19": 53253384, + "stop_hg19": 53253460, + "start_t2t": 55789233, + "stop_t2t": 55789288, + "disease": "Fuchs endothelial corneal dystrophy 3", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Late-onset Fuchs endothelial corneal dystrophy (FECD) is a degenerative disorder ... distinguished from other corneal disorders by the progressive formation of guttae [@omim:613267]. Studies suggest that disease severity increases in women with greater lifetime exposure to oestrogen [@pmid:40374208].", + "hpo_terms": null, + "prevalence": "4.5/100", + "prevalence_details": "~4/100 (over 40) [@omim:613267]; 5/100 [@pmid:20825314]. Predominantly in women (~75%) [@pmid:16769829]. In one study of two cohorts (Dallas Heart Study and 1000 Genomes Project), expanded allele carrier rates were 3.1% (African American), 8.1% (European American), and 3.3% (Latinos)in DHS, and 2.7% (AFR), 9.5% (EUR), 5.2% (East Asians), 7.2% (South Asians), and 5.2% (admixed Americans) in 1KGP [@pmid:39669694]. The highest carrier prevalence (12.1%–12.5%) occurred in EUR and admixed American subpopulations, while rates were 0%–1.9% in West Africans vs 6.2% in a Kenyan subpopulation.", + "age_onset": "Typical: 40-59 [@pmid:1676829]; Range: 32 [@pmid:21245398] - 79 [@pmid:39998965].", + "age_onset_min": 32, + "age_onset_max": 79, + "typ_age_onset_min": 40, + "typ_age_onset_max": 59, + "details": "Most controls have <40 repeats while majority of patients have >50 repeats; penetrance is <100%, as unaffected individuals have been documented with >80 repeats and alleles of affected individuals range from 12-2600 [@genereviews:NBK535148; @pmid:25168903]. Expansions are causative in approximately 70% of disease cases [@genereviews:NBK535148].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Sequestration of MBNL1 in RNA foci, similar to the mechanism underlying myotonic dystrophy-1 [@pmid:25593321]. Variation in RAN translation [@pmid:38467784].", + "year": "2012 [@pmid:23185296]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CTG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 39, + "intermediate_min": 40, + "intermediate_max": 50, + "pathogenic_min": 51, + "pathogenic_max": 2600, + "motif_len": 3, + "ref_copies": 25.3, + "novel": "ref", + "gard": [ + "10018" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "FCH001", + "CRN120" + ], + "medgen": [ + "442479" + ], + "mondo": [ + "0013203" + ], + "omim": [ + "613267" + ], + "orphanet": [ + "98974" + ], + "gnomad": [ + "TCF4" + ], + "stripy": [ + "TCF4" + ], + "tr_atlas": [ + "TR151784" + ], + "webstr_hg38": [ + "6247607", + "463325" + ], + "webstr_hg19": [], + "locus_tags": [ + "length_affects_penetrance" + ], + "disease_tags": [], + "references": [ + "pmid:1676829", + "pmid:21245398", + "pmid:39998965", + "pmid:25593321", + "pmid:38467784", + "genereviews:NBK535148", + "pmid:25168903", + "omim:613267", + "pmid:20825314", + "pmid:16769829", + "pmid:39669694", + "pmid:23185296", + "pmid:40374208" + ], + "additional_literature": [ + "pmid:42180433", + "pmid:42010886", + "pmid:41944554", + "pmid:41944537", + "pmid:41865104", + "pmid:41736702", + "pmid:41713739", + "pmid:41562921", + "pmid:41533935", + "pmid:41501457", + "pmid:41373515", + "pmid:41344296", + "pmid:41298634", + "pmid:41074692", + "pmid:40961119", + "pmid:40852795", + "pmid:40767442", + "pmid:40720054", + "pmid:40585427", + "pmid:40268158", + "pmid:40081749", + "pmid:40048186", + "pmid:39651202", + "pmid:39332053", + "pmid:39288343", + "pmid:39278108", + "pmid:39231626", + "pmid:38713708", + "pmid:38704483", + "pmid:38300219", + "pmid:37747538", + "pmid:37204786", + "pmid:37169279", + "pmid:36883248", + "pmid:36773096", + "pmid:36701310", + "pmid:36275201", + "pmid:36250467", + "pmid:34946954", + "pmid:34946867", + "pmid:34855896", + "pmid:34698281", + "pmid:34644448", + "pmid:33782268", + "pmid:36246012", + "pmid:33116252", + "pmid:32934897", + "pmid:32639312", + "pmid:31554942", + "pmid:31469403", + "pmid:31276570", + "pmid:30973406", + "pmid:30811544", + "pmid:30733599", + "pmid:30267097", + "pmid:30122888", + "pmid:30098193", + "pmid:29966009", + "pmid:29799290", + "pmid:29526280", + "pmid:29325021", + "pmid:29196769", + "pmid:29044056", + "pmid:28886202", + "pmid:28832669", + "pmid:28608272", + "pmid:28118661", + "pmid:27755191", + "pmid:26401622", + "pmid:26218914", + "pmid:26200491", + "pmid:25722209", + "pmid:25298419", + "pmid:24255041", + "pmid:20960280", + "pmid:11526470", + "pmid:10712198", + "pmid:10395212" + ] + }, + { + "id": "SCA_THAP11", + "disease_id": "SCA51", + "gene": "THAP11", + "evidence": [ + "Strong" + ], + "chrom": "chr16", + "start_hg38": 67842862, + "stop_hg38": 67842950, + "start_hg19": 67876765, + "stop_hg19": 67876853, + "start_t2t": 73638636, + "stop_t2t": 73638724, + "disease": "Spinocerebellar ataxia 51", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "THAP11-caused SCA involves symptoms including gait ataxia, dysarthria, dysphagia, slow saccades, ptosis, and/or nystagmus [@pmid:37148549].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Has been observed in Chinese families [@pmid:37148549; @pmid:24677642]. Interruptions predisposing to expansion/disease appear to vary by ancestry [@pmid:39651830].", + "age_onset": "Typical: 8-40 (small sample size); Range: 4-51 [@pmid:37148549].", + "age_onset_min": 4, + "age_onset_max": 51, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Expansion (45-100 repeats) found in affected individuals from 2 families and not in 500 controls (benign range: 20-38 repeats) [@pmid:37148549]. Longer alleles were associated with earlier age of onset. For example, an individual with 100 repeats had age of onset at 4 years. CAA interruptions can reduce toxicity [@pmid:37148549; @pmid:37148549].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to gain of function toxicity [@pmid:37148549; @pmid:38467784].", + "year": "2023 [@pmid:37148549]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "CAG" + ], + "pathogenic_motif_reference_orientation": [ + "CAG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [ + "CAA" + ], + "pathogenic_motif_gene_orientation": [ + "AGC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [ + "AAC" + ], + "locus_structure": [], + "benign_min": 20, + "benign_max": 38, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 45, + "pathogenic_max": 100, + "motif_len": 3, + "ref_copies": 29.3, + "novel": "ref", + "gard": [ + "10748" + ], + "genereviews": [], + "malacard": [], + "medgen": [ + "431598" + ], + "mondo": [], + "omim": [ + "620947" + ], + "orphanet": [], + "gnomad": [ + "THAP11" + ], + "stripy": [], + "tr_atlas": [ + "TR142069" + ], + "webstr_hg38": [ + "814002", + "5973136" + ], + "webstr_hg19": [ + "STR_540982" + ], + "locus_tags": [ + "anticipation", + "length_affects_onset", + "length_affects_severity", + "motif_affects_onset", + "motif_affects_severity" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "pmid:37148549", + "pmid:38467784", + "pmid:24677642", + "pmid:39651830" + ], + "additional_literature": [ + "pmid:40886825", + "pmid:40488180", + "pmid:15368101" + ] + }, + { + "id": "FAME6_TNRC6A", + "disease_id": "FAME6", + "gene": "TNRC6A", + "evidence": [ + "Limited" + ], + "chrom": "chr16", + "start_hg38": 24613438, + "stop_hg38": 24613532, + "start_hg19": 24624759, + "stop_hg19": 24624853, + "start_t2t": 24890366, + "stop_t2t": 24890430, + "disease": "Familial adult myoclonic epilepsy type 6", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Limited clinical details from one family, 'early 20s to 70s'", + "age_onset_min": 23, + "age_onset_max": 74, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Novel, reported pathogenic alleles: (TTTTA)22 (TTTCA)exp (TTTTA)exp, but only the TTTCA is specific to affected individuals (size: 1100 repeats). Non-pathogenic reference TTTTA repeat was expanded in nine healthy subjects 40-120 repeats and in two individuals was potentially even longer [@pmid:29507423].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423; @pmid:38467784].", + "year": "2018 [@pmid:29507423]", + "location_in_gene": "Intron 1/23", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "TTTTA" + ], + "pathogenic_motif_reference_orientation": [ + "TTTCA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "TTTTT" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "TTTTT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "TTTTA", + "count": 10, + "type": "internal_repeat" + }, + { + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 1100, + "pathogenic_max": 1100, + "motif_len": 3, + "ref_copies": 18.8, + "novel": "novel", + "gard": [ + "16758" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "EPL227" + ], + "medgen": [ + "1648448" + ], + "mondo": [ + "0054846" + ], + "omim": [ + "618074" + ], + "orphanet": [ + "86814" + ], + "gnomad": [ + "TNRC6A" + ], + "stripy": [ + "TNRC6A" + ], + "tr_atlas": [ + "TR139999" + ], + "webstr_hg38": [ + "5951520" + ], + "webstr_hg19": [ + "STR_519979" + ], + "locus_tags": [ + "motif_affects_penetrance" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:29507423", + "pmid:38467784", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:41219789", + "pmid:36092952", + "pmid:33040085", + "pmid:31483537", + "pmid:30351492", + "pmid:23042244" + ] + }, + { + "id": "CPUM_TYMS", + "disease_id": "CPUM", + "gene": "TYMS", + "evidence": [ + "Limited" + ], + "chrom": "chr18", + "start_hg38": 666891, + "stop_hg38": 667632, + "start_hg19": 666891, + "stop_hg19": 667632, + "start_t2t": 821235, + "stop_t2t": 821905, + "disease": "Congenital Progressive Universal Melanosis", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "CPUM is characterized by progressive widespread hyperpigmentation beginning at birth without accompanying symptoms. Studied children with CPUM have been born to unaffected parents. The children studied have been born with diffuse, universal, and progressive hyperpigmentation at 15 years of age. At this time the hyperpigmentation had fully progressed [@pmid:40589716]. It is not entirely clear that this is a distinct disease as it shares features with acquired universal melanosis (most similar), erythema dyschromicum perstans, lichen planus pigmentosus, and familial progressive hypigmentation.", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in two monozygotic twins in Thailand [@pmid:40589716].", + "age_onset": "0 (birth) [@pmid:40589716]", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "A study has identified an intronic GATGGT hexanucleotide tandem repeat in the TYMS gene. Both parents were found to be heterozygous carriers of the expansion, suggesting a recessive inheritance pattern. Evidence is limited, only a single family with monozygotic twins have been reported and no change in expression of the gene has been observed [@pmid:40589716].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Proposed mechanism involves repeat expansions in non-coding regions of the gene, reducing expression in melanocytes or keratinocytes, leading to a disruption in nucleotide balance in DNA repair and hyperpigmentation. Missense mutations disrupt nucleotide metabolism, resulting in loss-of-function and genome instability [@pmid:40589716].", + "year": "2025 [@pmid:40589716]", + "location_in_gene": "Intron 3", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GATGGT" + ], + "pathogenic_motif_reference_orientation": [ + "GATGGT" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ACCATC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 42, + "benign_max": 172, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 210, + "pathogenic_max": 259, + "motif_len": 6, + "ref_copies": null, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": [], + "medgen": [], + "mondo": [], + "omim": [], + "orphanet": [], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:40589716" + ], + "additional_literature": [ + "pmid:41507280", + "pmid:41181325", + "pmid:41074680", + "pmid:41024012", + "pmid:40890629", + "pmid:40589716", + "pmid:40195828", + "pmid:38625071", + "pmid:38411001", + "pmid:38379425", + "pmid:38311638", + "pmid:38280392", + "pmid:38134936", + "pmid:36398398", + "pmid:36209056", + "pmid:35608245", + "pmid:35233526", + "pmid:35055435", + "pmid:34650802", + "pmid:34526668", + "pmid:34197619", + "pmid:34149004", + "pmid:33805940", + "pmid:33086767", + "pmid:32813677", + "pmid:32695278", + "pmid:32612964", + "pmid:32110891", + "pmid:31817852", + "pmid:31370354", + "pmid:31161452", + "pmid:30838312", + "pmid:30823845", + "pmid:30533396", + "pmid:30464574", + "pmid:30122542", + "pmid:29995270", + "pmid:29660633", + "pmid:29394274", + "pmid:29321350", + "pmid:29162511", + "pmid:28895423", + "pmid:28349270", + "pmid:28280649", + "pmid:28074308", + "pmid:28074022", + "pmid:27995989", + "pmid:27868347", + "pmid:27864985", + "pmid:27685916", + "pmid:27375073", + "pmid:29767611", + "pmid:26745074", + "pmid:26621114", + "pmid:26277606", + "pmid:26196219", + "pmid:26189437", + "pmid:25955097", + "pmid:25648260", + "pmid:25536611", + "pmid:25366766", + "pmid:25341694", + "pmid:25294632", + "pmid:25279663", + "pmid:25258183", + "pmid:25246386", + "pmid:25028118", + "pmid:25007187", + "pmid:24726028", + "pmid:24686188", + "pmid:24641398", + "pmid:24596472", + "pmid:24554028", + "pmid:24422758", + "pmid:24415354", + "pmid:24302747", + "pmid:24137384", + "pmid:23968134", + "pmid:23571497", + "pmid:23481061", + "pmid:23232805", + "pmid:23226765", + "pmid:23148637", + "pmid:22799365", + "pmid:22763757", + "pmid:22576918", + "pmid:22086855", + "pmid:22044939", + "pmid:21630057", + "pmid:21449681", + "pmid:21269855", + "pmid:21196216", + "pmid:21075014", + "pmid:20966539", + "pmid:20962453", + "pmid:20932673", + "pmid:20880668", + "pmid:20824655", + "pmid:20651387", + "pmid:20645403", + "pmid:20570968", + "pmid:20531375", + "pmid:20372856", + "pmid:20005374", + "pmid:19998340", + "pmid:19917450", + "pmid:19798689", + "pmid:19632929", + "pmid:19349389", + "pmid:19306093", + "pmid:19200948", + "pmid:19082493", + "pmid:18843018", + "pmid:18728661", + "pmid:18704422", + "pmid:18661526", + "pmid:18406541", + "pmid:18273818", + "pmid:18267032", + "pmid:18203297", + "pmid:18095031", + "pmid:17508355", + "pmid:17396161", + "pmid:17278107", + "pmid:17273745", + "pmid:17220568", + "pmid:17201138", + "pmid:17187508", + "pmid:17047490", + "pmid:17018589", + "pmid:16929515", + "pmid:16818689", + "pmid:16596248", + "pmid:16456808", + "pmid:16334126", + "pmid:16333305", + "pmid:16234002", + "pmid:16182121", + "pmid:15897576", + "pmid:15817609", + "pmid:15749593", + "pmid:15646842", + "pmid:15579479", + "pmid:15571262", + "pmid:15510613", + "pmid:15457444", + "pmid:15386371", + "pmid:15284183", + "pmid:15115918", + "pmid:14522928", + "pmid:12684695", + "pmid:12604405", + "pmid:12460463", + "pmid:12232785", + "pmid:12215845", + "pmid:12039668", + "pmid:11913730", + "pmid:11867566", + "pmid:11751507", + "pmid:11529907", + "pmid:11445856", + "pmid:10652619", + "pmid:10636923", + "pmid:10625460", + "pmid:8751943", + "pmid:3002689" + ] + }, + { + "id": "HMNR7_VWA1", + "disease_id": "HMNR7", + "gene": "VWA1", + "evidence": [ + "Definitive" + ], + "chrom": "chr1", + "start_hg38": 1435798, + "stop_hg38": 1435818, + "start_hg19": 1371178, + "stop_hg19": 1371198, + "start_t2t": 870158, + "stop_t2t": 870178, + "disease": "Neuronopathy, distal hereditary motor, autosomal recessive 7", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Autosomal recessive distal hereditary motor neuronopathy-7 (HMNR7) is characterized by onset of lower leg weakness in the first decade. Affected individuals have difficulty climbing stairs and problems standing on their heels... Most patients have foot deformities, and some may have leg muscle atrophy. The disorder is slowly progressive and often involves the upper limbs [@omim:619216].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Biallelic variants found in 0.01% of 100 KGP participants; enriched in those with motor disease. 80% of VWA1 pathogenic variants are expansions/contractions [@genereviews:NBK535148]. The repeat expansion was found in several ethnicities; founder mutation 7,000 years prior [@pmid:33559681].", + "age_onset": "Typical: 1-3 [@pmid:33559681]; Range: 0-10 [@omim:619216].", + "age_onset_min": 0, + "age_onset_max": 10, + "typ_age_onset_min": 1, + "typ_age_onset_max": 3, + "details": "Any deviation from 2 motifs is thought to be pathogenic [@genereviews:NBK535148].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Loss of function [@pmid:38467784].", + "year": "2021 [@pmid:33559681]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GGCGCGGAGC" + ], + "pathogenic_motif_reference_orientation": [ + "GGCGCGGAGC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "AGCGGCGCGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 2, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 1, + "pathogenic_max": 3, + "motif_len": 10, + "ref_copies": null, + "novel": null, + "gard": [ + "18444" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "NRN074" + ], + "medgen": [ + "1786836" + ], + "mondo": [ + "0030977" + ], + "omim": [ + "619216" + ], + "orphanet": [ + "314485" + ], + "gnomad": [ + "VWA1" + ], + "stripy": [], + "tr_atlas": [ + "TR32" + ], + "webstr_hg38": [ + "1099767" + ], + "webstr_hg19": [], + "locus_tags": [ + "contraction" + ], + "disease_tags": [], + "references": [ + "pmid:33559681", + "omim:619216", + "pmid:38467784", + "genereviews:NBK535148" + ], + "additional_literature": [ + "pmid:42003611" + ] + }, + { + "id": "DBQD2_XYLT1", + "disease_id": "DBQD2, BSS", + "gene": "XYLT1", + "evidence": [ + "Moderate" + ], + "chrom": "chr16", + "start_hg38": 17470907, + "stop_hg38": 17470922, + "start_hg19": 17564764, + "stop_hg19": 17564779, + "start_t2t": 17477909, + "stop_t2t": 17478002, + "disease": "Baratela-Scott Syndrome/Desbuquois dysplasia 2", + "inheritance": [ + "AR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Desbuquois dysplasia, which belongs to the multiple dislocation group of disorders, is characterized by dislocations of large joints, severe pre- and postnatal growth retardation, joint laxity, and flat face with prominent eyes. Radiologic features include short long bones with an exaggerated trochanter that gives a 'monkey wrench' appearance to the proximal femur, and advanced carpal and tarsal ossification [@pmid:24581741].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "<1/1,000,000 births [@orphanet:1425]; repeat expansions comprise half of DBQD variants [@genereviews:NBK535148]. <50 DBQD cases. Has been found in Belgian, Emirati families", + "age_onset": "0 (birth)", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": 0, + "typ_age_onset_max": 0, + "details": "Benign range (0-20) taken from primary literature of unaffected individuals and gnomAD data [@pmid:30554721; @gnomad:XYLT1]. Minimum repeat size to cause disease thought to range between 72 and 110 repeats [@pmid:30554721]. Repeat is within a 238bp sequence which is missing from hg38 but present in T2T-CHM13", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Methylation [@pmid:30554721].", + "year": "2019 [@pmid:30554721]", + "location_in_gene": "5' promoter region. Note, it can also be annotated coding or introntic depending on the reference, due to missing sequences in some reference genomes.", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "GCC", + "count": 0, + "type": "internal_repeat" + }, + { + "motif": "TCGGCTCGCCGCTGCTCCTCCTCC", + "count": 0, + "type": "interruption" + }, + { + "motif": "GCC", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": 0, + "benign_max": 20, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 72, + "pathogenic_max": 110, + "motif_len": 3, + "ref_copies": 0, + "novel": "ref", + "gard": [ + "16466" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "DSB005" + ], + "medgen": [ + "862731" + ], + "mondo": [ + "0014343" + ], + "omim": [ + "615777" + ], + "orphanet": [ + "1425" + ], + "gnomad": [ + "XYLT1" + ], + "stripy": [ + "XYLT1" + ], + "tr_atlas": [ + "TR139509" + ], + "webstr_hg38": [ + "793606" + ], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:30554721", + "gnomad:XYLT1", + "orphanet:1425", + "genereviews:NBK535148", + "pmid:24581741" + ], + "additional_literature": [] + }, + { + "id": "FAME4_YEATS2", + "disease_id": "FAME4", + "gene": "YEATS2", + "evidence": [ + "Limited" + ], + "chrom": "chr3", + "start_hg38": 183712187, + "stop_hg38": 183712226, + "start_hg19": 183429975, + "stop_hg19": 183430014, + "start_t2t": 186521667, + "stop_t2t": 186521706, + "disease": "Familial adult myoclonic epilepsy 4", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 20-25 [@pmid:22713812]; Range: 10-33 [@pmid:31539032].", + "age_onset_min": 10, + "age_onset_max": 33, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Novel insertion of ~1000 repeats observed to cause disease [@pmid:31539032].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity hypothesized [@pmid:31539032].", + "year": "2019 [@pmid:31539032]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "TTTTA" + ], + "pathogenic_motif_reference_orientation": [ + "TTTCA" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [ + "TTTTT", + "TGTTA" + ], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "ATTTC" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [ + "TTTTT", + "ATGTT" + ], + "interruption_gene_orientation": [], + "locus_structure": [ + { + "motif": "TTTTA", + "count": 7, + "type": "internal_repeat" + }, + { + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + } + ], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 1000, + "pathogenic_max": 1000, + "motif_len": 5, + "ref_copies": 7.8, + "novel": "novel", + "gard": [ + "16758" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "EPL107" + ], + "medgen": [ + "767474" + ], + "mondo": [ + "0014055" + ], + "omim": [ + "615127" + ], + "orphanet": [ + "86814" + ], + "gnomad": [ + "YEATS2" + ], + "stripy": [ + "YEATS2" + ], + "tr_atlas": [ + "TR38932" + ], + "webstr_hg38": [ + "5034940", + "769177" + ], + "webstr_hg19": [ + "STR_1006941" + ], + "locus_tags": [ + "motif_affects_penetrance" + ], + "disease_tags": [ + "familial_adult_myoclonic_epilepsy" + ], + "references": [ + "pmid:22713812", + "pmid:31539032", + "pmid:38876750" + ], + "additional_literature": [ + "pmid:41874439", + "pmid:41219789", + "pmid:38128822" + ] + }, + { + "id": "SCA4_ZFHX3", + "disease_id": "SCA4", + "gene": "ZFHX3", + "evidence": [ + "Definitive" + ], + "chrom": "chr16", + "start_hg38": 72787694, + "stop_hg38": 72787758, + "start_hg19": 72821593, + "stop_hg19": 72821657, + "start_t2t": 78605502, + "stop_t2t": 78605569, + "disease": "Spinocerebellar ataxia 4", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Spinocerebellar ataxia type 4 (SCA4) is a very rare progressive subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by ataxia with sensory neuropathy (adapted from Mondo) [@mondo:0010847].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Observed in Swedish individuals: 2 original kindreds and 3 additional families [@omim:600223]; common ancestral allele has been identified [@pmid:39635987].", + "age_onset": "Typical: 37- 56; Range: 12 - 65 [@pmid:39666847; @pmid:38973251].", + "age_onset_min": 12, + "age_onset_max": 65, + "typ_age_onset_min": 37, + "typ_age_onset_max": 56, + "details": "Disease-causing expansions range from 46 repeats [@pmid:38973251] to 74 repeats [@pmid:38035881]. Possible anticipation in disease [@pmid:38197134; @pmid:38035881]; intermediate alleles may correspond to premutations [@pmid:38973251]. Most unaffected individuals had 21 motifs, but benign alleles range from 14-26 repeats [@pmid:38035881].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "Potential RNA-mediated gain of function mechanism theorized [@pmid:38467784]", + "year": "2023 [@pmid:38035881]", + "location_in_gene": "Coding, Last Exon (exon number is transcript dependent)", + "gene_strand": "-", + "reference_motif_reference_orientation": [ + "GCC" + ], + "pathogenic_motif_reference_orientation": [ + "GCC" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 14, + "benign_max": 26, + "intermediate_min": 27, + "intermediate_max": 45, + "pathogenic_min": 46, + "pathogenic_max": 74, + "motif_len": 3, + "ref_copies": 21.3, + "novel": "ref", + "gard": [ + "9970" + ], + "genereviews": [], + "malacard": [ + "SPN105" + ], + "medgen": [ + "199815" + ], + "mondo": [ + "0010847" + ], + "omim": [ + "600223" + ], + "orphanet": [ + "98765" + ], + "gnomad": [ + "ZFHX3" + ], + "stripy": [], + "tr_atlas": [ + "TR142346" + ], + "webstr_hg38": [ + "5977326" + ], + "webstr_hg19": [ + "STR_545217" + ], + "locus_tags": [ + "length_affects_onset" + ], + "disease_tags": [ + "spinocerebellar_ataxia" + ], + "references": [ + "pmid:39666847", + "pmid:38973251", + "pmid:38467784", + "pmid:38035881", + "pmid:38197134", + "omim:600223", + "pmid:39635987", + "mondo:0010847" + ], + "additional_literature": [ + "pmid:40898875", + "pmid:40594369", + "pmid:40488180", + "pmid:40459184", + "pmid:40166539", + "pmid:39095619", + "pmid:38684900", + "pmid:38472396", + "pmid:38145611", + "pmid:20586826", + "pmid:10855793" + ] + }, + { + "id": "HPE5_ZIC2", + "disease_id": "HPE5", + "gene": "ZIC2", + "evidence": [ + "Definitive" + ], + "chrom": "chr13", + "start_hg38": 99985448, + "stop_hg38": 99985494, + "start_hg19": 100637702, + "stop_hg19": 100637748, + "start_t2t": 99196358, + "stop_t2t": 99196404, + "disease": "Holoprosencephaly-5", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "Holoprosencephaly associated with mutations in the ZIC2 gene [@mondo:0012322].", + "hpo_terms": null, + "prevalence": "1.4/1000000", + "prevalence_details": "0.05-0.23/100,000; math done by 40% of pathogenic variants in ZIC2 are expansion [@genereviews:NBK1530]; 5% of non-syndromic HPE are ZIC2 gene [@genereviews:NBK1530], and nonsyndromic HPE is 25-50% of HPE, which affects 1/10,000 newborns [@url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/] - ZIC2 is 9.2% of HPE cases, which occur in 1/16,000 live births [@pmid:17274816]. Holoprosencephaly has worldwide distribution [@orphanet:2162], but STR-specific distribution is unknown.", + "age_onset": "0", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": 0, + "typ_age_onset_max": 0, + "details": "The benign allele of 15 repeats expands to 25 repeats to cause disease [@genereviews:NBK51932], although the expansion can potentially present with a mild phenotype [@doi:10.1016/j.gimo.2024.101607]", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansion interfering with DNA binding and transcriptional activation [@pmid:19177455; @pmid:15590697].", + "year": "2001 [@pmid:11285244]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 25, + "pathogenic_max": 25, + "motif_len": 3, + "ref_copies": 15.3, + "novel": "ref", + "gard": [ + "6665" + ], + "genereviews": [ + "NBK51932" + ], + "malacard": [ + "HLP028" + ], + "medgen": [ + "355304" + ], + "mondo": [ + "0012322" + ], + "omim": [ + "609637" + ], + "orphanet": [ + "2162" + ], + "gnomad": [ + "ZIC2" + ], + "stripy": [ + "ZIC2" + ], + "tr_atlas": [ + "TR127312" + ], + "webstr_hg38": [ + "5374719" + ], + "webstr_hg19": [ + "STR_395661" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:19177455", + "pmid:15590697", + "genereviews:NBK51932", + "doi:10.1016/j.gimo.2024.101607", + "genereviews:NBK1530", + "url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/", + "pmid:17274816", + "orphanet:2162", + "pmid:11285244", + "mondo:0012322" + ], + "additional_literature": [ + "pmid:40033291" + ] + }, { - "motif": "TTTTA", - "count": 7, - "type": "internal_repeat" + "id": "VACTERLX_ZIC3", + "disease_id": "VACTERLX", + "gene": "ZIC3", + "evidence": [ + "Limited" + ], + "chrom": "chrX", + "start_hg38": 137566826, + "stop_hg38": 137566856, + "start_hg19": 136648985, + "stop_hg19": 136649015, + "start_t2t": 135876774, + "stop_t2t": 135876804, + "disease": "X-linked VACTERL syndrome", + "inheritance": [ + "XR" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "VACTERL is an acronym for vertebral anomalies (similar to those of spondylocostal dysplasia), anal atresia, cardiac malformations, tracheoesophageal fistula, renal anomalies (urethral atresia with hydronephrosis), and limb anomalies [@omim:314390].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in one patient [@genereviews:NBK535148] with European ancestry [@pmid:20452998].", + "age_onset": "0", + "age_onset_min": 0, + "age_onset_max": 0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Frequently genotyped as (NGC)*, although locus structure has been reported as (GCC)8(GCT)(GCC) [@pmid:38467784]. 1 patient with VACTERL died at birth with 12 repeats [@pmid:20452998]. 8 patients with X-linked oculo-auriculo-vertebral spectrum (OAVS) had 11 repeats (intermediate allele size); 1 individual in OAVS cohort with 12 repeats; likely phenotypic spectrum [@pmid:32639022].", + "detection": null, + "mechanism": "Unknown", + "mechanism_detail": "Polyalanine expansion with unknown mechanism [@pmid:17581576].", + "year": "2010 [@pmid:20452998]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCN" + ], + "pathogenic_motif_reference_orientation": [ + "GCN" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CNG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 10, + "intermediate_min": 11, + "intermediate_max": 11, + "pathogenic_min": 12, + "pathogenic_max": 12, + "motif_len": 3, + "ref_copies": 9, + "novel": "ref", + "gard": [ + "15309" + ], + "genereviews": [ + "NBK535148" + ], + "malacard": [ + "VCT005" + ], + "medgen": [ + "419019" + ], + "mondo": [ + "0010752" + ], + "omim": [ + "314390" + ], + "orphanet": [], + "gnomad": [ + "ZIC3" + ], + "stripy": [ + "ZIC3" + ], + "tr_atlas": [ + "TR173313" + ], + "webstr_hg38": [ + "883856" + ], + "webstr_hg19": [ + "STR_1596381" + ], + "locus_tags": [], + "disease_tags": [ + "phenotypic_spectrum" + ], + "references": [ + "pmid:17581576", + "pmid:38467784", + "pmid:20452998", + "pmid:32639022", + "genereviews:NBK535148", + "omim:314390" + ], + "additional_literature": [ + "pmid:40585427" + ] }, { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - }], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 1000, - "pathogenic_max": 1000, - "motif_len": 5, - "ref_copies": 7.8, - "novel": "novel", - "gard": ["16758"], - "genereviews": ["NBK535148"], - "malacard": ["EPL107"], - "medgen": ["767474"], - "mondo": ["0014055"], - "omim": ["615127"], - "orphanet": ["86814"], - "gnomad": ["YEATS2"], - "stripy": ["YEATS2"], - "tr_atlas": ["TR38932"], - "webstr_hg38": ["5034940", "769177"], - "webstr_hg19": ["STR_1006941"], - "locus_tags": ["motif_affects_penetrance"], - "disease_tags": ["familial_adult_myoclonic_epilepsy"], - "references": ["pmid:22713812", "pmid:31539032", "pmid:38876750"], - "additional_literature": ["pmid:41874439", "pmid:41219789", "pmid:38128822"] -}, -{ - "id": "SCA4_ZFHX3", - "disease_id": "SCA4", - "gene": "ZFHX3", - "evidence": ["Definitive"], - "chrom": "chr16", - "start_hg38": 72787694, - "stop_hg38": 72787758, - "start_hg19": 72821593, - "stop_hg19": 72821657, - "start_t2t": 78605502, - "stop_t2t": 78605569, - "disease": "Spinocerebellar ataxia 4", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Spinocerebellar ataxia type 4 (SCA4) is a very rare progressive subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by ataxia with sensory neuropathy (adapted from Mondo) [@mondo:0010847].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Observed in Swedish individuals: 2 original kindreds and 3 additional families [@omim:600223]; common ancestral allele has been identified [@pmid:39635987].", - "age_onset": "Typical: 37- 56; Range: 12 - 65 [@pmid:39666847; @pmid:38973251].", - "age_onset_min": 12.0, - "age_onset_max": 65.0, - "typ_age_onset_min": 37.0, - "typ_age_onset_max": 56.0, - "details": "Disease-causing expansions range from 46 repeats [@pmid:38973251] to 74 repeats [@pmid:38035881]. Possible anticipation in disease [@pmid:38197134; @pmid:38035881]; intermediate alleles may correspond to premutations [@pmid:38973251]. Most unaffected individuals had 21 motifs, but benign alleles range from 14-26 repeats [@pmid:38035881].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "Potential RNA-mediated gain of function mechanism theorized [@pmid:38467784]", - "year": "2023 [@pmid:38035881]", - "location_in_gene": "Coding, Last Exon (exon number is transcript dependent)", - "gene_strand": "-", - "reference_motif_reference_orientation": ["GCC"], - "pathogenic_motif_reference_orientation": ["GCC"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 14, - "benign_max": 26, - "intermediate_min": 27, - "intermediate_max": 45, - "pathogenic_min": 46, - "pathogenic_max": 74, - "motif_len": 3, - "ref_copies": 21.3, - "novel": "ref", - "gard": ["9970"], - "genereviews": [], - "malacard": ["SPN105"], - "medgen": ["199815"], - "mondo": ["0010847"], - "omim": ["600223"], - "orphanet": ["98765"], - "gnomad": ["ZFHX3"], - "stripy": [], - "tr_atlas": ["TR142346"], - "webstr_hg38": ["5977326"], - "webstr_hg19": ["STR_545217"], - "locus_tags": ["length_affects_onset"], - "disease_tags": ["spinocerebellar_ataxia"], - "references": ["pmid:39666847", "pmid:38973251", "pmid:38467784", "pmid:38035881", "pmid:38197134", "omim:600223", "pmid:39635987", "mondo:0010847"], - "additional_literature": ["pmid:40898875", "pmid:40594369", "pmid:40488180", "pmid:40459184", "pmid:40166539", "pmid:39095619", "pmid:38684900", "pmid:38472396", "pmid:38145611", "pmid:20586826", "pmid:10855793"] -}, -{ - "id": "HPE5_ZIC2", - "disease_id": "HPE5", - "gene": "ZIC2", - "evidence": ["Definitive"], - "chrom": "chr13", - "start_hg38": 99985448, - "stop_hg38": 99985494, - "start_hg19": 100637702, - "stop_hg19": 100637748, - "start_t2t": 99196358, - "stop_t2t": 99196404, - "disease": "Holoprosencephaly-5", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "Holoprosencephaly associated with mutations in the ZIC2 gene [@mondo:0012322].", - "hpo_terms": null, - "prevalence": "1.4/1000000", - "prevalence_details": "0.05-0.23/100,000; math done by 40% of pathogenic variants in ZIC2 are expansion [@genereviews:NBK1530]; 5% of non-syndromic HPE are ZIC2 gene [@genereviews:NBK1530], and nonsyndromic HPE is 25-50% of HPE, which affects 1/10,000 newborns [@url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/] - ZIC2 is 9.2% of HPE cases, which occur in 1/16,000 live births [@pmid:17274816]. Holoprosencephaly has worldwide distribution [@orphanet:2162], but STR-specific distribution is unknown.", - "age_onset": "0", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": 0.0, - "typ_age_onset_max": 0.0, - "details": "The benign allele of 15 repeats expands to 25 repeats to cause disease [@genereviews:NBK51932], although the expansion can potentially present with a mild phenotype [@doi:10.1016/j.gimo.2024.101607]", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansion interfering with DNA binding and transcriptional activation [@pmid:19177455; @pmid:15590697].", - "year": "2001 [@pmid:11285244]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 25, - "pathogenic_max": 25, - "motif_len": 3, - "ref_copies": 15.3, - "novel": "ref", - "gard": ["6665"], - "genereviews": ["NBK51932"], - "malacard": ["HLP028"], - "medgen": ["355304"], - "mondo": ["0012322"], - "omim": ["609637"], - "orphanet": ["2162"], - "gnomad": ["ZIC2"], - "stripy": ["ZIC2"], - "tr_atlas": ["TR127312"], - "webstr_hg38": ["5374719"], - "webstr_hg19": ["STR_395661"], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:19177455", "pmid:15590697", "genereviews:NBK51932", "doi:10.1016/j.gimo.2024.101607", "genereviews:NBK1530", "url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/", "pmid:17274816", "orphanet:2162", "pmid:11285244", "mondo:0012322"], - "additional_literature": ["pmid:40033291"] -}, -{ - "id": "VACTERLX_ZIC3", - "disease_id": "VACTERLX", - "gene": "ZIC3", - "evidence": ["Limited"], - "chrom": "chrX", - "start_hg38": 137566826, - "stop_hg38": 137566856, - "start_hg19": 136648985, - "stop_hg19": 136649015, - "start_t2t": 135876774, - "stop_t2t": 135876804, - "disease": "X-linked VACTERL syndrome", - "inheritance": ["XR"], - "association_type": ["Mendelian"], - "disease_description": "VACTERL is an acronym for vertebral anomalies (similar to those of spondylocostal dysplasia), anal atresia, cardiac malformations, tracheoesophageal fistula, renal anomalies (urethral atresia with hydronephrosis), and limb anomalies [@omim:314390].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in one patient [@genereviews:NBK535148] with European ancestry [@pmid:20452998].", - "age_onset": "0", - "age_onset_min": 0.0, - "age_onset_max": 0.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Frequently genotyped as (NGC)*, although locus structure has been reported as (GCC)8(GCT)(GCC) [@pmid:38467784]. 1 patient with VACTERL died at birth with 12 repeats [@pmid:20452998]. 8 patients with X-linked oculo-auriculo-vertebral spectrum (OAVS) had 11 repeats (intermediate allele size); 1 individual in OAVS cohort with 12 repeats; likely phenotypic spectrum [@pmid:32639022].", - "detection": null, - "mechanism": "Unknown", - "mechanism_detail": "Polyalanine expansion with unknown mechanism [@pmid:17581576].", - "year": "2010 [@pmid:20452998]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCN"], - "pathogenic_motif_reference_orientation": ["GCN"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CNG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 10, - "intermediate_min": 11, - "intermediate_max": 11, - "pathogenic_min": 12, - "pathogenic_max": 12, - "motif_len": 3, - "ref_copies": 9.0, - "novel": "ref", - "gard": ["15309"], - "genereviews": ["NBK535148"], - "malacard": ["VCT005"], - "medgen": ["419019"], - "mondo": ["0010752"], - "omim": ["314390"], - "orphanet": [], - "gnomad": ["ZIC3"], - "stripy": ["ZIC3"], - "tr_atlas": ["TR173313"], - "webstr_hg38": ["883856"], - "webstr_hg19": ["STR_1596381"], - "locus_tags": [], - "disease_tags": ["phenotypic_spectrum"], - "references": ["pmid:17581576", "pmid:38467784", "pmid:20452998", "pmid:32639022", "genereviews:NBK535148", "omim:314390"], - "additional_literature": ["pmid:40585427"] -}, -{ - "id": "FRA7A_ZNF713", - "disease_id": "FRA7A", - "gene": "ZNF713", - "evidence": ["Limited"], - "chrom": "chr7", - "start_hg38": 55887600, - "stop_hg38": 55887639, - "start_hg19": 55955293, - "stop_hg19": 55955332, - "start_t2t": 56047900, - "stop_t2t": 56047939, - "disease": "Autism spectrum disorder associated with fragile site FRA7A", - "inheritance": ["AD"], - "association_type": ["Mendelian"], - "disease_description": "A spectrum of developmental disorders that includes autism, and Asperger syndrome. Signs and symptoms include poor communication skills, defective social interactions, and repetitive behaviors [@mondo:0005258].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "1 proband reported alongside 3 individuals with premutations, found in 2 families without discussion of ancestry/ethnicity [@pmid:25196122].", - "age_onset": "2-3 (four individuals) [@pmid:25196122].", - "age_onset_min": 2.0, - "age_onset_max": 3.0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "176 controls were used to establish the benign range (5-22 repeats), whereas a singular proband was identified with ~450 repeats [@pmid:25196122]. The observed intermediate alleles were presumed to function as premutations, with variable amounts of methylation [@pmid:25196122].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Methylation, evidence of transcriptional misregulation [@omim:616181; @pmid:25196122].", - "year": "2014 [@pmid:25196122]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": ["GCG"], - "pathogenic_motif_reference_orientation": ["GCG"], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": ["CGG"], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 22, - "intermediate_min": 42, - "intermediate_max": 85, - "pathogenic_min": 450, - "pathogenic_max": 450, - "motif_len": 3, - "ref_copies": 13.0, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": ["ATS007"], - "medgen": [], - "mondo": [], - "omim": ["616181"], - "orphanet": [], - "gnomad": ["ZNF713"], - "stripy": [], - "tr_atlas": ["TR300995"], - "webstr_hg38": ["1380240", "5696269"], - "webstr_hg19": ["STR_1325788"], - "locus_tags": [], - "disease_tags": [], - "references": ["pmid:25196122", "omim:616181", "mondo:0005258"], - "additional_literature": [] -}] + "id": "FRA7A_ZNF713", + "disease_id": "FRA7A", + "gene": "ZNF713", + "evidence": [ + "Limited" + ], + "chrom": "chr7", + "start_hg38": 55887600, + "stop_hg38": 55887639, + "start_hg19": 55955293, + "stop_hg19": 55955332, + "start_t2t": 56047900, + "stop_t2t": 56047939, + "disease": "Autism spectrum disorder associated with fragile site FRA7A", + "inheritance": [ + "AD" + ], + "association_type": [ + "Mendelian" + ], + "disease_description": "A spectrum of developmental disorders that includes autism, and Asperger syndrome. Signs and symptoms include poor communication skills, defective social interactions, and repetitive behaviors [@mondo:0005258].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "1 proband reported alongside 3 individuals with premutations, found in 2 families without discussion of ancestry/ethnicity [@pmid:25196122].", + "age_onset": "2-3 (four individuals) [@pmid:25196122].", + "age_onset_min": 2, + "age_onset_max": 3, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "176 controls were used to establish the benign range (5-22 repeats), whereas a singular proband was identified with ~450 repeats [@pmid:25196122]. The observed intermediate alleles were presumed to function as premutations, with variable amounts of methylation [@pmid:25196122].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Methylation, evidence of transcriptional misregulation [@omim:616181; @pmid:25196122].", + "year": "2014 [@pmid:25196122]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": [ + "GCG" + ], + "pathogenic_motif_reference_orientation": [ + "GCG" + ], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": [ + "CGG" + ], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 22, + "intermediate_min": 42, + "intermediate_max": 85, + "pathogenic_min": 450, + "pathogenic_max": 450, + "motif_len": 3, + "ref_copies": 13, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": [ + "ATS007" + ], + "medgen": [], + "mondo": [], + "omim": [ + "616181" + ], + "orphanet": [], + "gnomad": [ + "ZNF713" + ], + "stripy": [], + "tr_atlas": [ + "TR300995" + ], + "webstr_hg38": [ + "1380240", + "5696269" + ], + "webstr_hg19": [ + "STR_1325788" + ], + "locus_tags": [], + "disease_tags": [], + "references": [ + "pmid:25196122", + "omim:616181", + "mondo:0005258" + ], + "additional_literature": [] + } +] \ No newline at end of file From ac2c58180e49d7b1627d4008b0b12485e128f946 Mon Sep 17 00:00:00 2001 From: strchive-bot <224851451+strchive-bot@users.noreply.github.com> Date: Wed, 24 Jun 2026 20:11:21 +0000 Subject: [PATCH 2/4] Update data --- data/STRchive-loci.json | 22301 ++++------------ ...TRchive-disease-loci.T2T-chm13.general.bed | 2 +- ...chive-disease-loci.T2T-chm13.stranger.json | 4 +- .../STRchive-disease-loci.hg19.general.bed | 2 +- .../STRchive-disease-loci.hg19.stranger.json | 4 +- .../STRchive-disease-loci.hg38.general.bed | 2 +- .../STRchive-disease-loci.hg38.stranger.json | 4 +- data/plots/age-onset.json | 8 +- data/plots/path-size.json | 48 +- 9 files changed, 5554 insertions(+), 16821 deletions(-) diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index fb5ab915..7dc7b775 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -1,16853 +1,5586 @@ [ - +{ + "id": "OPDM5_ABCD3", + "disease_id": "OPDM5", + "gene": "ABCD3", + "evidence": ["Moderate"], + "chrom": "chr1", + "start_hg38": 94418421, + "stop_hg38": 94418444, + "start_hg19": 94883977, + "stop_hg19": 94884000, + "start_t2t": 94266544, + "stop_t2t": 94266567, + "disease": "Oculopharyngodistal myopathy type 5", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in individuals of European, Japanese, and Chinese ancestry [@pmid:38876750; @pmid:34047774].", + "age_onset": "Typical: 24-30; Range: 10-50 [@pmid:39068203]. Age of onset data is limited to 8 families.", + "age_onset_min": 10.0, + "age_onset_max": 50.0, + "typ_age_onset_min": 24.0, + "typ_age_onset_max": 30.0, + "details": "Characterized in eight unrelated families which were used to establish benign (3-44) and pathogenic (118-694) ranges [@pmid:39068203].", + "detection": "RP-PCR has been used for detection [@pmid:39068203]. Short-read sequencing has significantly underestimated repeat count, while long-read sequencing has accurately resolved size [@pmid:39068203].", + "mechanism": null, + "mechanism_detail": "Potentially over-expression of transcripts [@pmid:39068203].", + "year": "2023 [@pmid:39068203]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 3, + "benign_max": 44, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 118, + "pathogenic_max": 694, + "motif_len": 3, + "ref_copies": 7.7, + "novel": "ref", + "gard": ["12592"], + "genereviews": [], + "malacard": [], + "medgen": ["320250"], + "mondo": ["0025193"], + "omim": [], + "orphanet": ["98897"], + "gnomad": ["ABCD3"], + "stripy": [], + "tr_atlas": ["TR5671"], + "webstr_hg38": ["1164141", "6329150"], + "webstr_hg19": ["STR_58687"], + "locus_tags": [], + "disease_tags": ["oculopharyngodistal_myopathy"], + "references": ["pmid:39068203", "pmid:38876750", "pmid:34047774", "mondo:0025193"], + "additional_literature": ["pmid:41959811", "pmid:41792844", "pmid:40645757"] +}, +{ + "id": "FRAXE_AFF2", + "disease_id": "FRAXE", + "gene": "AFF2", + "evidence": ["Definitive"], + "chrom": "chrX", + "start_hg38": 148500604, + "stop_hg38": 148500753, + "start_hg19": 147582124, + "stop_hg19": 147582273, + "start_t2t": 146765190, + "stop_t2t": 146765342, + "disease": "Intellectual developmental disorder, Fragile X intellectual disability", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659].", + "hpo_terms": ["HP:0000718 Aggressive behavior", "HP:0000713 Agitation", "HP:0000729 Autistic behavior", "HP:0002312 Clumsiness", "HP:0000722 Compulsive behaviors", "HP:0000750 Delayed speech and language development", "HP:0001249 Intellectual disability"], + "prevalence": "2/50000", + "prevalence_details": "1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464].", + "age_onset": "Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548].", + "age_onset_min": 1.0, + "age_onset_max": 10.0, + "typ_age_onset_min": 2.0, + "typ_age_onset_max": 10.0, + "details": "Allele ranges (benign:4-39; pathogenic: >200) inferred from The Human Gene Mutation Database [@genereviews:NBK535148]. Intermediate alleles correspond to a premutation [@pmid:23914978]. Non-canonical motifs include: CGG/CCT/GTG/CAG/CTG3 [@pmid:35245110; @pmid:34111553].", + "detection": "RP-PCR has been used to detect expansions and size alleles to ~80 repeats, while Southern blotting has sized full expansions and detected methylation using Notl, a methylation-sensitive restriction enzyme [@pmid:34282157].", + "mechanism": "LoF", + "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", + "year": "1993 [@pmid:8334699]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 39, + "intermediate_min": 40, + "intermediate_max": 200, + "pathogenic_min": 201, + "pathogenic_max": 2000, + "motif_len": 3, + "ref_copies": 50.3, + "novel": "ref", + "gard": ["2378"], + "genereviews": ["NBK535148"], + "malacard": ["INT399"], + "medgen": ["155512"], + "mondo": ["0010659"], + "omim": ["309548"], + "orphanet": ["100973"], + "gnomad": ["AFF2"], + "stripy": ["AFF2"], + "tr_atlas": ["TR173976"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "length_affects_penetrance", "length_affects_severity"], + "disease_tags": [], + "references": ["pmid:11246464", "omim:309548", "pmid:16205714", "pmid:36169768", "genereviews:NBK535148", "pmid:23914978", "pmid:35245110", "pmid:34111553", "url:medlineplus.gov/genetics/condition/fragile-xe-syndrome", "pmid:8334699", "mondo:0010659"], + "additional_literature": ["pmid:41074692", "pmid:40708890", "pmid:35431806", "pmid:28812997", "pmid:25171808", "pmid:24763282", "pmid:22718980", "pmid:21739600", "pmid:21254876", "pmid:21051337", "pmid:17635840", "pmid:17516099", "pmid:16469443", "pmid:11119302", "pmid:10780779", "pmid:10674158", "pmid:10424820", "pmid:9630071", "pmid:9415475", "pmid:9415473", "pmid:9341861", "pmid:8808600", "pmid:8844091", "pmid:8755928", "pmid:8673086", "pmid:7541938", "pmid:7783163", "pmid:7881407", "pmid:7977354", "pmid:8023854", "pmid:8162055", "pmid:8118462"] +}, +{ + "id": "FRA2A_AFF3", + "disease_id": "FRA2A", + "gene": "AFF3", + "evidence": ["Definitive"], + "chrom": "chr2", + "start_hg38": 100104798, + "stop_hg38": 100104824, + "start_hg19": 100721260, + "stop_hg19": 100721286, + "start_t2t": 100563685, + "stop_t2t": 100563738, + "disease": "Intellectual disability associated with fragile site FRA2A", + "inheritance": ["AD"], + "association_type": ["Mendelian", "Risk"], + "disease_description": "These expansions are associated with intellectual disability and clinical phenotypes such as delayed motor development or delays in speech/language [@pmid:24763282].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "1/862 (1/654-1266) population prevalence of methylated AFF3 expansions (mild cognitive disability) [@pmid:39313615]. Disease cases observed in South Australia [@pmid:24763282].", + "age_onset": "Early childhood (small sample size) [@pmid:24763282].", + "age_onset_min": 1.0, + "age_onset_max": 7.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Allele ranges established in study of 3 families; intermediate alleles likely premutations [@pmid:24763282]. Pathogenic threshold may be higher than 300 as this was the largest allele that could be accurately sized by the assay.", + "detection": "Standard PCR has detected small alleles, while RP-PCR and Southern blotting have detected large expansions. Short-read sequencing may underestimate the size of large expansions and exact sizing usually uses long-read sequencing [@pmid:24763282; @pmid:39313615].", + "mechanism": "LoF/methylation", + "mechanism_detail": "Silencing of the FMR2 gene as a consequence of a CCG expansion located upstream of this gene [@malacard:KNS007].", + "year": "2014 [@pmid:24763282]", + "location_in_gene": "Intron 3", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 3, + "benign_max": 20, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 300, + "pathogenic_max": 300, + "motif_len": 3, + "ref_copies": 8.7, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": ["KNS007"], + "medgen": [], + "mondo": [], + "omim": ["601464"], + "orphanet": [], + "gnomad": ["AFF3"], + "stripy": [], + "tr_atlas": ["TR252468"], + "webstr_hg38": ["288936"], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:24763282", "malacard:KNS007", "pmid:39313615"], + "additional_literature": ["pmid:40417743", "pmid:37205357"] +}, +{ + "id": "SBMA_AR", + "disease_id": "SBMA", + "gene": "AR", + "evidence": ["Definitive"], + "chrom": "chrX", + "start_hg38": 67545316, + "stop_hg38": 67545419, + "start_hg19": 66765158, + "stop_hg19": 66765261, + "start_t2t": 65975147, + "stop_t2t": 65975250, + "disease": "Spinal and bulbar muscular atrophy, Kennedy Disease", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting [@mondo:0010735].", + "hpo_terms": null, + "prevalence": "1/30000", + "prevalence_details": "1-2/100,000 (population-specific, higher in Finnish population, Canadian population) [@pmid:37628685]; 1/30,000 [@orphanet:481]; mutation frequency of 1:3182 10x more frequent than reported disease prevalence of 1 in 30,000 [@pmid:36797998]. Only documented in patients with European/Asian ancestry, including Scandinavian, English, Belgian, French, Italian, German, Polish, Spanish, Swiss, Moroccan, Turkish, Chinese, Japanese (more common because of a founder effect), East Indian (potentially related to Japanese founder mutation) [@pmid:37578398], Korean, and Vietnamese populations [@genereviews:NBK1333].", + "age_onset": "Typical: 20-49 [@pmid:11436124], Range: 8 [@pmid:15851746] - 83 [@doi:10.17161/2tmg0f25].", + "age_onset_min": 8.0, + "age_onset_max": 83.0, + "typ_age_onset_min": 20.0, + "typ_age_onset_max": 49.0, + "details": "Intermediate alleles indicate reduced penetrance [@genereviews:NBK1333]. Expansions larger than the pathogenic threshold in the AR gene should be evaluated carefully. Interruptions have not been observed in patient cases; it has been proposed that longer alleles with interruptions may not be pathogenic [@pmid:24041967]. Non-canonical motif CAA observed [@pmid:35245110]. Expansions are also detected ten-fold more often in a general population than would be expected by disease prevalence [@pmid:36797998]. Clinical evaluation and phenotypic matching may be necessary to determine diagnosis even in the presence of a pure expanded allele. It has been proposed that contractions may play a role in disease [@pmid:10398229]. Disease may be subclinical in females [@pmid:34922802], and can be clinically heterogeneous even within the same family [@pmid:20184516].", + "detection": "Although short-read sequencing screens have been used to detect this expansion [@pmid:36797998], sizing is generally validated with standard PCR fragment analysis or RP-PCR [@genereviews:NBK1333].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine alters protein conformation leading to gain-of-function neurodegeneration [@pmid:29398703; @pmid:36169768]. Transcriptional dysregulation, axonal transport disruption, and mitochondrial dysfunction also play causative roles in the neurodegeneration [@pmid:22609045].", + "year": "1991 [@pmid:2062380]; the first triplet disease to be discovered [@pmid:15313856]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCA"], + "pathogenic_motif_reference_orientation": ["GCA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 9, + "benign_max": 34, + "intermediate_min": 36, + "intermediate_max": 37, + "pathogenic_min": 38, + "pathogenic_max": 68, + "motif_len": 3, + "ref_copies": 34.0, + "novel": "ref", + "gard": ["6818"], + "genereviews": ["NBK1333"], + "malacard": ["SPN404"], + "medgen": ["333282"], + "mondo": ["0010735"], + "omim": ["313200"], + "orphanet": ["481"], + "gnomad": ["AR"], + "stripy": ["AR"], + "tr_atlas": ["TR169377"], + "webstr_hg38": ["859199"], + "webstr_hg19": [], + "locus_tags": ["contraction", "somatic_instability", "anticipation", "paternal_expansion", "length_affects_severity", "length_affects_penetrance", "length_affects_onset"], + "disease_tags": [], + "references": ["pmid:11436124", "pmid:15851746", "doi:10.17161/2tmg0f25", "pmid:29398703", "pmid:36169768", "pmid:22609045", "genereviews:NBK1333", "pmid:24041967", "pmid:35245110", "pmid:36797998", "pmid:10398229", "pmid:34922802", "pmid:20184516", "pmid:37628685", "orphanet:481", "pmid:37578398", "pmid:2062380", "pmid:15313856", "mondo:0010735"], + "additional_literature": ["pmid:42196324", "pmid:42138244", "pmid:42070078", "pmid:42067676", "pmid:41762523", "pmid:41564929", "pmid:41552385", "pmid:41513898", "pmid:41361869", "pmid:41246945", "pmid:40912964", "pmid:40614362", "pmid:40585427", "pmid:40488202", "pmid:40450087", "pmid:40371721", "pmid:40366765", "pmid:40031964", "pmid:39755011", "pmid:39729861", "pmid:39694906", "pmid:39570490", "pmid:39189540", "pmid:39140081", "pmid:38976730", "pmid:38860410", "pmid:38737445", "pmid:38701087", "pmid:38585669", "pmid:38284836", "pmid:38171945", "pmid:37936145", "pmid:37718889", "pmid:37715620", "pmid:37422780", "pmid:37269008", "pmid:37045687", "pmid:36988133", "pmid:36717478", "pmid:36701310", "pmid:36622568", "pmid:36599645", "pmid:36585400", "pmid:36142533", "pmid:36137740", "pmid:35982373", "pmid:35876459", "pmid:35872088", "pmid:35867854", "pmid:35661131", "pmid:35599735", "pmid:35571498", "pmid:35237894", "pmid:35230239", "pmid:35189449", "pmid:35182509", "pmid:35165376", "pmid:34914563", "pmid:34744823", "pmid:34723064", "pmid:34407295", "pmid:34390226", "pmid:34372915", "pmid:34006154", "pmid:33865179", "pmid:33738134", "pmid:33714752", "pmid:33261594", "pmid:33191626", "pmid:32989102", "pmid:32856855", "pmid:32468478", "pmid:32216057", "pmid:32166698", "pmid:32152060", "pmid:32070397", "pmid:31901908", "pmid:31522753", "pmid:31446215", "pmid:31303548", "pmid:31179189", "pmid:31040020", "pmid:31030566", "pmid:31019916", "pmid:30940675", "pmid:30886222", "pmid:30838350", "pmid:30837566", "pmid:30615214", "pmid:30612224", "pmid:30415810", "pmid:30351503", "pmid:30314815", "pmid:30247609", "pmid:30206564", "pmid:30206283", "pmid:30156935", "pmid:30156032", "pmid:30139231", "pmid:30120431", "pmid:30043577", "pmid:30019487", "pmid:30019104", "pmid:29914823", "pmid:29886316", "pmid:29809168", "pmid:29714466", "pmid:29706560", "pmid:29571584", "pmid:29556396", "pmid:29464380", "pmid:29364557", "pmid:29299905", "pmid:29249939", "pmid:28963363", "pmid:28915409", "pmid:28780536", "pmid:28585930", "pmid:28511915", "pmid:28367605", "pmid:28295444", "pmid:27873769", "pmid:27807533", "pmid:27669432", "pmid:27634944", "pmid:27517091", "pmid:27251588", "pmid:27193223", "pmid:27066582", "pmid:26872663", "pmid:26772404", "pmid:26691666", "pmid:26541420", "pmid:26511871", "pmid:26499105", "pmid:26410037", "pmid:26406407", "pmid:26355245", "pmid:26345963", "pmid:26298608", "pmid:26266536", "pmid:26246877", "pmid:26221130", "pmid:26043854", "pmid:25979597", "pmid:25925349", "pmid:25889790", "pmid:25828775", "pmid:25746115", "pmid:25665908", "pmid:25637315", "pmid:25536734", "pmid:25520876", "pmid:25514102", "pmid:25455261", "pmid:25230321", "pmid:25217983", "pmid:25148265", "pmid:25122660", "pmid:25078280", "pmid:25047668", "pmid:25027083", "pmid:24974051", "pmid:24966714", "pmid:24925673", "pmid:24925468", "pmid:24872216", "pmid:24824408", "pmid:24793825", "pmid:24742458", "pmid:24711544", "pmid:24691874", "pmid:24581183", "pmid:24566949", "pmid:24391916", "pmid:24274329", "pmid:24256885", "pmid:24200287", "pmid:24120273", "pmid:23799424", "pmid:23789051", "pmid:23732677", "pmid:23679084", "pmid:23545426", "pmid:23515294", "pmid:23467468", "pmid:23441776", "pmid:23388696", "pmid:23377847", "pmid:23364790", "pmid:23359804", "pmid:23272232", "pmid:23184046", "pmid:23167717", "pmid:23136466", "pmid:23062703", "pmid:22941760", "pmid:22819977", "pmid:22792352", "pmid:22765868", "pmid:22736030", "pmid:22731640", "pmid:22653589", "pmid:22652498", "pmid:24052720", "pmid:22333840", "pmid:22233359", "pmid:22107839", "pmid:22068615", "pmid:22038041", "pmid:22025404", "pmid:21977989", "pmid:21664238", "pmid:21643744", "pmid:21642359", "pmid:21486420", "pmid:21445561", "pmid:21410629", "pmid:21270324", "pmid:21247881", "pmid:21089003", "pmid:20880698", "pmid:20689246", "pmid:20425835", "pmid:20353269", "pmid:20233785", "pmid:20127024", "pmid:20063560", "pmid:19956434", "pmid:19818997", "pmid:19692580", "pmid:19684044", "pmid:19497852", "pmid:19482445", "pmid:19237573", "pmid:19228953", "pmid:19218788", "pmid:19211034", "pmid:19207614", "pmid:19100835", "pmid:19095061", "pmid:19062046", "pmid:18962445", "pmid:18783352", "pmid:18762554", "pmid:18645714", "pmid:18642379", "pmid:18624843", "pmid:18610651", "pmid:18592136", "pmid:18446630", "pmid:18365230", "pmid:18323476", "pmid:18222439", "pmid:18217192", "pmid:18191848", "pmid:18181049", "pmid:18097504", "pmid:17997416", "pmid:17984450", "pmid:17984063", "pmid:17979523", "pmid:17854832", "pmid:17852020", "pmid:17825390", "pmid:17635942", "pmid:17556727", "pmid:17507624", "pmid:17507457", "pmid:17465263", "pmid:17440439", "pmid:17431729", "pmid:17372242", "pmid:17321486", "pmid:17230529", "pmid:17161354", "pmid:17137601", "pmid:17027356", "pmid:16859836", "pmid:16847812", "pmid:16817826", "pmid:16813680", "pmid:16804045", "pmid:16793958", "pmid:16772330", "pmid:16696857", "pmid:16621916", "pmid:16515589", "pmid:16493814", "pmid:16462497", "pmid:16448271", "pmid:16437189", "pmid:16425097", "pmid:16403814", "pmid:16377095", "pmid:16365010", "pmid:16358333", "pmid:16299230", "pmid:16187285", "pmid:16117826", "pmid:16008071", "pmid:15956082", "pmid:15954500", "pmid:15952987", "pmid:15950642", "pmid:15876692", "pmid:15824176", "pmid:15747808", "pmid:15725470", "pmid:15721279", "pmid:15659427", "pmid:15609126", "pmid:15599941", "pmid:15570555", "pmid:15545219", "pmid:15472213", "pmid:15366384", "pmid:15358199", "pmid:15341991", "pmid:15310009", "pmid:15198988", "pmid:15146455", "pmid:15120698", "pmid:15044606", "pmid:15003169", "pmid:14974917", "pmid:14973115", "pmid:14731580", "pmid:14698481", "pmid:14693242", "pmid:14691592", "pmid:14674723", "pmid:14605819", "pmid:14585317", "pmid:14511217", "pmid:14506156", "pmid:12898143", "pmid:12860943", "pmid:12767946", "pmid:12755998", "pmid:12714591", "pmid:12670590", "pmid:12634316", "pmid:12632109", "pmid:12602915", "pmid:12542725", "pmid:12534937", "pmid:12478141", "pmid:12404104", "pmid:12388541", "pmid:12385020", "pmid:12376473", "pmid:12220434", "pmid:12189490", "pmid:12189162", "pmid:12085360", "pmid:12042281", "pmid:12031042", "pmid:11956643", "pmid:11935317", "pmid:11927493", "pmid:11894978", "pmid:11875046", "pmid:11847524", "pmid:11810651", "pmid:11809726", "pmid:11788641", "pmid:11721964", "pmid:11720249", "pmid:11701709", "pmid:11600555", "pmid:11571732", "pmid:11571725", "pmid:11550169", "pmid:11494335", "pmid:11473958", "pmid:11443190", "pmid:11368874", "pmid:11331662", "pmid:11330644", "pmid:11266016", "pmid:11259089", "pmid:11167027", "pmid:11121465", "pmid:11016637", "pmid:10999852", "pmid:10958659", "pmid:10956560", "pmid:10852984", "pmid:10821498", "pmid:10817350", "pmid:10794490", "pmid:10732798", "pmid:10732754", "pmid:10717532", "pmid:10717003", "pmid:10656235", "pmid:10643885", "pmid:10637497", "pmid:10617922", "pmid:10574254", "pmid:10564878", "pmid:10544298", "pmid:10486315", "pmid:10419869", "pmid:10400640", "pmid:10323251", "pmid:10234512", "pmid:9925917", "pmid:9886069", "pmid:9880240", "pmid:9815849", "pmid:9813160", "pmid:9761394", "pmid:9732460", "pmid:9731888", "pmid:9692387", "pmid:9677254", "pmid:9580659", "pmid:9499423", "pmid:9382110", "pmid:9270598", "pmid:9094973", "pmid:9020849", "pmid:8960833", "pmid:8954049", "pmid:8878435", "pmid:8737374", "pmid:8926495", "pmid:8807333", "pmid:8645957", "pmid:7772520", "pmid:7757084", "pmid:7719348", "pmid:8065934", "pmid:7951325", "pmid:7515106", "pmid:8232348", "pmid:1461383", "pmid:1734865"] +}, +{ + "id": "EIEE1_ARX", + "disease_id": "EIEE1", + "gene": "ARX", + "evidence": ["Definitive"], + "chrom": "chrX", + "start_hg38": 25013649, + "stop_hg38": 25013697, + "start_hg19": 25031766, + "stop_hg19": 25031814, + "start_t2t": 24597886, + "stop_t2t": 24597934, + "disease": "Early-infantile epileptic encephalopathy", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "Developmental and epileptic encephalopathy-1 (DEE1) is a severe form of epilepsy characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, characterized by high-voltage bursts alternating with almost flat suppression phases [@omim:308350].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in individuals of multiple ethnicities, including European and Asian ancestry [@pmid:12874418].", + "age_onset": "Typical: 0 [@pmid:21204215; @pmid:9307258]; Range: 0-4; 70% of cases involve infantile spasms, leading to seizures by 3 or 4 years [@pmid:19587282].", + "age_onset_min": 0.0, + "age_onset_max": 4.0, + "typ_age_onset_min": 0.0, + "typ_age_onset_max": 0.0, + "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", + "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:17668384].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", + "year": "2002 [@pmid:11889467]", + "location_in_gene": "Coding Exon 2, aa 110-115", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 16, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 17, + "pathogenic_max": 27, + "motif_len": 3, + "ref_copies": 14.7, + "novel": "ref", + "gard": ["15298"], + "genereviews": ["NBK535148"], + "malacard": ["ERL057"], + "medgen": ["483052"], + "mondo": ["0010632"], + "omim": ["308350", "300419", "300215"], + "orphanet": ["182079"], + "gnomad": ["ARX_1"], + "stripy": ["ARX_1"], + "tr_atlas": ["TR167317"], + "webstr_hg38": ["843651"], + "webstr_hg19": ["STR_1542607"], + "locus_tags": ["length_affects_phenotype"], + "disease_tags": ["phenotypic_spectrum"], + "references": ["pmid:21204215", "pmid:9307258", "pmid:19587282", "pmid:36169768", "pmid:38467784", "genereviews:NBK51932", "genereviews:NBK535148", "omim:309510", "omim:308350", "omim:300004", "omim:300215", "pmid:26029707", "pmid:20506206", "pmid:12874418", "pmid:11889467"], + "additional_literature": ["pmid:40608247", "pmid:39933386", "pmid:39123069", "pmid:36571524", "pmid:33847015", "pmid:32033960", "pmid:28627419", "pmid:28602636", "pmid:27798109", "pmid:26571108", "pmid:25171319", "pmid:24236044", "pmid:23968833", "pmid:23246292", "pmid:22628459", "pmid:22108177", "pmid:20376468", "pmid:19018235", "pmid:18823727", "pmid:18462864", "pmid:17668384", "pmid:17664401", "pmid:17480217", "pmid:15533998"] +}, +{ + "id": "PRTS_ARX", + "disease_id": "PRTS", + "gene": "ARX", + "evidence": ["Definitive"], + "chrom": "chrX", + "start_hg38": 25013529, + "stop_hg38": 25013565, + "start_hg19": 25031646, + "stop_hg19": 25031682, + "start_t2t": 24597766, + "stop_t2t": 24597802, + "disease": "Partington syndrome", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "A rare neurological condition that is primarily characterized by mild to moderate intellectual disability and dystonia of the hands. Other signs and symptoms may include dysarthria, behavioral abnormalities, recurrent seizures and/or an unusual gait (style of walking). Partington syndrome usually occurs in males; when it occurs in females, the signs and symptoms are often less severe. It is caused by changes (mutations) in the ARX gene and is inherited in an X-linked recessive manner. Treatment is based on the signs and symptoms present in each person [@mondo:0010654].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Limited clinical cases of predominantly European ancestry, such as Welsh/Belgian [@omim:309510].", + "age_onset": "Typical: 1-3; Range: 0-4. Mild phenotypes can make diagnosis difficult (expansions are particularly mild/absent in females) [@omim:309510].", + "age_onset_min": 0.0, + "age_onset_max": 4.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", + "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:11889467].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", + "year": "2002 [@pmid:11889467]", + "location_in_gene": "Coding Exon 2, aa 144-155", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 12, + "benign_max": 12, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 20, + "pathogenic_max": 20, + "motif_len": 3, + "ref_copies": 12.0, + "novel": "ref", + "gard": ["4235"], + "genereviews": ["NBK535148"], + "malacard": ["PRT003"], + "medgen": ["163237"], + "mondo": ["0010654"], + "omim": ["309510"], + "orphanet": ["94083"], + "gnomad": ["ARX_2"], + "stripy": ["ARX_2"], + "tr_atlas": ["TR167316"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": ["length_affects_phenotype"], + "disease_tags": ["phenotypic_spectrum"], + "references": ["omim:309510", "pmid:36169768", "pmid:38467784", "genereviews:NBK51932", "genereviews:NBK535148", "omim:308350", "omim:300004", "omim:300215", "pmid:26029707", "pmid:20506206", "pmid:11889467", "mondo:0010654"], + "additional_literature": ["pmid:40608247", "pmid:39933386", "pmid:39123069", "pmid:36571524", "pmid:33847015", "pmid:32033960", "pmid:28627419", "pmid:28602636", "pmid:27798109", "pmid:26571108", "pmid:25171319", "pmid:24236044", "pmid:23968833", "pmid:23246292", "pmid:22628459", "pmid:22108177", "pmid:21204215", "pmid:20376468", "pmid:19587282", "pmid:19018235", "pmid:18823727", "pmid:18462864", "pmid:17668384", "pmid:17664401", "pmid:17480217", "pmid:15533998", "pmid:12874418"] +}, +{ + "id": "DRPLA_ATN1", + "disease_id": "DRPLA", + "gene": "ATN1", + "evidence": ["Definitive"], + "chrom": "chr12", + "start_hg38": 6936716, + "stop_hg38": 6936775, + "start_hg19": 7045879, + "stop_hg19": 7045938, + "start_t2t": 6947903, + "stop_t2t": 6947941, + "disease": "Dentatorubral-Pallidoluysian Atrophy", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Dentatorubral pallidoluysian atrophy (DRPLA) is a rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by involuntary movements, ataxia, epilepsy, mental disorders, cognitive decline and prominent anticipation [@mondo:0007435]. Epilepsy is common in earlier onset cases [@pmid:41147955].", + "hpo_terms": null, + "prevalence": "4.5/1000000", + "prevalence_details": "2-7/1,000,000. More prevalent in Japanese populations; also reported in North America, South America, Europe, and Australia [@genereviews:NBK1491].", + "age_onset": "Typical: 20-40 [@pmid:6808417; @genereviews:NBK1491]. Range: 0 [@pmid:11160976] - 72 [@genereviews:NBK1491].", + "age_onset_min": 0.0, + "age_onset_max": 72.0, + "typ_age_onset_min": 20.0, + "typ_age_onset_max": 40.0, + "details": "Pathogenic expansions (48-93) are fully penetrant with the exception of one documented case of 51 repeats; intermediate alleles (36-47) are associated with a milder phenotype and can expand upon transmission [@genereviews:NBK1491]. CAA interruptions have been observed without known clinical association [@pmid:35245110]. Length of the repeat is inversely associated with age of onset and severe epilepsy phenotype [@pmid:41147955].", + "detection": "PCR fragment analysis has detected most moderate alleles, but Southern blotting or RP-PCR have been used in cases of large expansions or when PCR shows an apparently homozygous small allele, to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1491].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansions leading to gain of function [@genereviews:NBK1491].", + "year": "1994 [@pmid:7842016]", + "location_in_gene": "Coding Exon 5", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 35, + "intermediate_min": 36, + "intermediate_max": 47, + "pathogenic_min": 48, + "pathogenic_max": 93, + "motif_len": 3, + "ref_copies": 19.0, + "novel": "ref", + "gard": ["5643"], + "genereviews": ["NBK1491"], + "malacard": ["DNT005"], + "medgen": ["155630"], + "mondo": ["0007435"], + "omim": ["125370"], + "orphanet": ["101"], + "gnomad": ["ATN1"], + "stripy": ["ATN1"], + "tr_atlas": ["TR114246"], + "webstr_hg38": ["5050156"], + "webstr_hg19": ["Expansion_ATN1/DRPLA"], + "locus_tags": ["anticipation", "somatic_instability", "paternal_expansion", "length_affects_onset", "length_affects_severity", "length_affects_phenotype"], + "disease_tags": ["ataxia", "epilepsy"], + "references": ["pmid:6808417", "genereviews:NBK1491", "pmid:11160976", "pmid:35245110", "pmid:41147955", "pmid:7842016", "mondo:0007435"], + "additional_literature": ["pmid:42196324", "pmid:41624332", "pmid:41355374", "pmid:41254939", "pmid:41082794", "pmid:40832356", "pmid:40488180", "pmid:40450087", "pmid:40340521", "pmid:40298952", "pmid:40263757", "pmid:40237283", "pmid:39820777", "pmid:39812846", "pmid:39742457", "pmid:39224955", "pmid:38961870", "pmid:38227102", "pmid:38152578", "pmid:37243799", "pmid:36599645", "pmid:36530930", "pmid:35182509", "pmid:34968706", "pmid:34022586", "pmid:33106889", "pmid:32711193", "pmid:32675418", "pmid:32129252", "pmid:31493762", "pmid:30891880", "pmid:30827498", "pmid:30615214", "pmid:30314815", "pmid:30120431", "pmid:29801887", "pmid:29715545", "pmid:29249939", "pmid:28782341", "pmid:28585930", "pmid:27896316", "pmid:27400454", "pmid:26374734", "pmid:26077168", "pmid:25842919", "pmid:25466696", "pmid:24972706", "pmid:24534762", "pmid:23933208", "pmid:23364790", "pmid:23263592", "pmid:23026538", "pmid:22527233", "pmid:22520093", "pmid:22342974", "pmid:22297462", "pmid:21108634", "pmid:20589872", "pmid:19429075", "pmid:19370769", "pmid:19259763", "pmid:19039037", "pmid:18182848", "pmid:17965145", "pmid:17961920", "pmid:17420317", "pmid:16967484", "pmid:16858508", "pmid:16251216", "pmid:16199124", "pmid:15553088", "pmid:15223312", "pmid:15148151", "pmid:15133824", "pmid:14756671", "pmid:12925365", "pmid:12805114", "pmid:12764052", "pmid:12614315", "pmid:12235319", "pmid:12042281", "pmid:11939898", "pmid:11807410", "pmid:11711886", "pmid:11709002", "pmid:11689158", "pmid:11574112", "pmid:11198291", "pmid:10942107", "pmid:10894992", "pmid:10814707", "pmid:10768629", "pmid:10766906", "pmid:10677044", "pmid:10564878", "pmid:10515170", "pmid:10486315", "pmid:10453742", "pmid:10332026", "pmid:10085113", "pmid:10084125", "pmid:9949204", "pmid:9887337", "pmid:9758625", "pmid:9705838", "pmid:9696528", "pmid:9647693", "pmid:9613852", "pmid:9507387", "pmid:9462738", "pmid:9385362", "pmid:9361003", "pmid:9187480", "pmid:9124808", "pmid:9109905", "pmid:9106530", "pmid:9050922", "pmid:9020849", "pmid:8962095", "pmid:9001798", "pmid:8651298", "pmid:8655136", "pmid:8780110", "pmid:8644735", "pmid:8852663", "pmid:8926495", "pmid:8559378", "pmid:8557266", "pmid:7633415", "pmid:7868125", "pmid:7824105", "pmid:7885531", "pmid:8136840", "pmid:8136826", "pmid:7734112"] +}, +{ + "id": "SCA1_ATXN1", + "disease_id": "SCA1", + "gene": "ATXN1", + "evidence": ["Definitive"], + "chrom": "chr6", + "start_hg38": 16327633, + "stop_hg38": 16327724, + "start_hg19": 16327864, + "stop_hg19": 16327955, + "start_t2t": 16200188, + "stop_t2t": 16200282, + "disease": "Spinocerebellar ataxia type 1", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 1 (SCA1) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by dysarthria, writing difficulties, limb ataxia, and commonly nystagmus and saccadic abnormalities [@mondo:0008119].", + "hpo_terms": null, + "prevalence": "1.5/100000", + "prevalence_details": "1-2/100,000. Cases have been reported worldwide, although prevalence varies by ancestry/ethnicity [@genereviews:NBK1184].", + "age_onset": "Typical: 20-39 [@url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias]; Range: 6 [@pmid:3165612] - 63 [@pmid:8825276].", + "age_onset_min": 6.0, + "age_onset_max": 63.0, + "typ_age_onset_min": 20.0, + "typ_age_onset_max": 39.0, + "details": "Penetrance is dependent on sequence purity in addition to expansion length: pure repeats are pathogenic at 39 repeats [@pmid:37906407], while CAT interruptions [@pmid:35245110] can lead to reduced penetrance at comparable lengths [@genereviews:NBK1184]. Regardless, intermediate alleles are considered premutations which may lead to disease upon transmission [@genereviews:NBK1184]. CAA interruptions have also been reported, but not linked to any phenotypic consequences [@pmid:23935513].", + "detection": "PCR fragment analysis is commonly used for sizing [@genereviews:NBK1184]. Standard fragment analysis does not resolve CAT interruptions, which require targeted analysis like RP-PCR or Sanger sequencing [@pmid:34635619; @genereviews:NBK1184].", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyglutamine expansion leading to toxic gain of function with eventual misregulation-based loss of function/dominant negative [@genereviews:NBK1184; @pmid:35573049].", + "year": "1993 [@pmid:8358429]", + "location_in_gene": "Coding Exon 8", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CTG"], + "pathogenic_motif_reference_orientation": ["CTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["ATG", "TTG"], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["ATC", "AAC"], + "locus_structure": [], + "benign_min": 6, + "benign_max": 35, + "intermediate_min": 36, + "intermediate_max": 38, + "pathogenic_min": 39, + "pathogenic_max": 91, + "motif_len": 3, + "ref_copies": 30.3, + "novel": "ref", + "gard": ["4071"], + "genereviews": ["NBK1184"], + "malacard": ["SPN294"], + "medgen": ["155703"], + "mondo": ["0008119"], + "omim": ["164400"], + "orphanet": ["98755"], + "gnomad": ["ATXN1"], + "stripy": ["ATXN1"], + "tr_atlas": ["TR63118"], + "webstr_hg38": ["5767842"], + "webstr_hg19": ["Expansion_SCA1/ATXN1"], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_severity", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance", "motif_affects_severity"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias", "pmid:3165612", "pmid:8825276", "genereviews:NBK1184", "pmid:35573049", "pmid:37906407", "pmid:35245110", "pmid:23935513", "pmid:8358429", "mondo:0008119"], + "additional_literature": ["pmid:42196324", "pmid:41727128", "pmid:41435767", "pmid:41426430", "pmid:41254939", "pmid:41149812", "pmid:40900235", "pmid:40488180", "pmid:40450087", "pmid:39820777", "pmid:39456985", "pmid:39289638", "pmid:39211226", "pmid:38961870", "pmid:38626762", "pmid:38585669", "pmid:38308084", "pmid:38125008", "pmid:37827155", "pmid:37776516", "pmid:37397792", "pmid:37146135", "pmid:37043475", "pmid:36599645", "pmid:36549973", "pmid:36291186", "pmid:35869263", "pmid:35525134", "pmid:35182509", "pmid:34830553", "pmid:34635619", "pmid:34600502", "pmid:34372915", "pmid:34179866", "pmid:33502644", "pmid:33276461", "pmid:33159825", "pmid:32954321", "pmid:32761094", "pmid:32580238", "pmid:32339968", "pmid:31940111", "pmid:31810584", "pmid:31645175", "pmid:30891880", "pmid:30729852", "pmid:30615214", "pmid:30324307", "pmid:30314815", "pmid:30120431", "pmid:30108484", "pmid:29845242", "pmid:29656178", "pmid:29497168", "pmid:29274668", "pmid:29249939", "pmid:29057148", "pmid:28585930", "pmid:28444220", "pmid:26077168", "pmid:25595967", "pmid:25344417", "pmid:25255716", "pmid:24972706", "pmid:24594842", "pmid:24534762", "pmid:23197749", "pmid:22884877", "pmid:18337722", "pmid:18301861", "pmid:17961920", "pmid:17420317", "pmid:17116127", "pmid:15300851"] +}, +{ + "id": "SCA10_ATXN10", + "disease_id": "SCA10", + "gene": "ATXN10", + "evidence": ["Definitive"], + "chrom": "chr22", + "start_hg38": 45795354, + "stop_hg38": 45795424, + "start_hg19": 46191234, + "stop_hg19": 46191304, + "start_t2t": 46280059, + "stop_t2t": 46280134, + "disease": "Spinocerebellar ataxia type 10", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 10 (SCA10) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by slowly progressive cerebellar syndrome and epilepsy, sometimes mild pyramidal signs, peripheral neuropathy and neuropsychological disturbances [@mondo:0011330].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Unknown prevalence, >300 individuals. Cases have been identified in Mexico, Brazil, China, and Japan [@genereviews:NBK1175].", + "age_onset": "Typical: 12-48; Range: 11-83 [@genereviews:NBK1175].", + "age_onset_min": 11.0, + "age_onset_max": 83.0, + "typ_age_onset_min": 12.0, + "typ_age_onset_max": 48.0, + "details": "Unaffected individuals are usually (82%) compound heterozygotes in the benign range [@genereviews:NBK1175]. Intermediate alleles show reduced penetrance, and exact distinction between intermediate and the lower end of the pathogenic range is unclear [@genereviews:NBK1175]. Expansions are frequently interrupted by ATCCT, ATCCC, ATTCC, ATTTCT, ATATTCT, or ATTCTTCT; interruptions of ATTGT, TTTCT, ATTTTCT, ATTCTCT, GTTTCT, CTTCT, and ATTCTAT have been noted [@pmid:36199580] as has the interruption ATGCT [@pmid:19234597]. The ATCCT interruption motif is associated with a higher prevalence of epileptic seizures [@pmid:24318420]. Different motif patterns and mixed motif ratios may influence age of onset and anticipation [@pmid:41229449]. One study suggests that alleles with completely pure ATTCT expansions are non-pathogenic, and that repeat interruptions such as ATTCC, are necessary to cause SCA10 [@pmid:36092952].", + "detection": "RP-PCR with fragment analysis is commonly used for detection. Pathogenicity depends heavily on interruptions, so long-read sequencing approaches have been used for full structure resolution [@pmid:26295943; @pmid:32160188].", + "mechanism": "GoF", + "mechanism_detail": "Transdominant mechanism theorized [@pmid:38467784].", + "year": "2000 [@pmid:11017075]", + "location_in_gene": "Intron 9", + "gene_strand": "+", + "reference_motif_reference_orientation": ["ATTCT"], + "pathogenic_motif_reference_orientation": ["ATTCT"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["ATCCT", "ATCCC", "ATTCC", "ATTTCT", "ATATTCT", "ATTCTTCT", "ATTGT", "TTTCT", "ATTTTCT", "ATTCTCT", "GTTTCT", "CTTCT", "ATGCT"], + "pathogenic_motif_gene_orientation": ["ATTCT"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["ATCCT", "ATCCC", "ATTCC", "ATTTCT", "ATATTCT", "ATTCTTCT", "ATTGT", "CTTTT", "ATTTTCT", "ATTCTCT", "CTGTTT", "CTCTT", "ATGCT"], + "locus_structure": [], + "benign_min": 10, + "benign_max": 32, + "intermediate_min": 33, + "intermediate_max": 850, + "pathogenic_min": 800, + "pathogenic_max": 4500, + "motif_len": 5, + "ref_copies": 14.0, + "novel": "ref", + "gard": ["10474"], + "genereviews": ["NBK1175"], + "malacard": ["SPN314"], + "medgen": ["369786"], + "mondo": ["0011330"], + "omim": ["603516"], + "orphanet": ["98761"], + "gnomad": ["ATXN10"], + "stripy": ["ATXN10"], + "tr_atlas": ["TR165509"], + "webstr_hg38": ["1027359", "4921433"], + "webstr_hg19": ["STR_909210"], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "motif_affects_instability", "motif_affects_penetrance", "motif_affects_phenotype"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK1175", "pmid:38467784", "pmid:36199580", "pmid:19234597", "pmid:24318420", "pmid:41229449", "pmid:36092952", "pmid:11017075", "mondo:0011330"], + "additional_literature": ["pmid:41229449", "pmid:41074692", "pmid:40900235", "pmid:40898875", "pmid:40488180", "pmid:40067487", "pmid:39820777", "pmid:38961870", "pmid:38832639", "pmid:35103298", "pmid:34970537", "pmid:33502644", "pmid:32520333", "pmid:32160188", "pmid:31737797", "pmid:31445906", "pmid:31342269", "pmid:29922950", "pmid:29316893", "pmid:28890930", "pmid:28423040", "pmid:27248057", "pmid:26374734", "pmid:26295943", "pmid:26077168", "pmid:26039897", "pmid:25466696", "pmid:24278426", "pmid:24269018", "pmid:23443018", "pmid:23083689", "pmid:23026538", "pmid:22065565", "pmid:22053702", "pmid:21282659", "pmid:20065034", "pmid:19651850", "pmid:19306311", "pmid:19171184", "pmid:19147916", "pmid:17961920", "pmid:17846122", "pmid:16924013", "pmid:16498633", "pmid:16385455", "pmid:15505178", "pmid:15201271", "pmid:15148151", "pmid:15096564", "pmid:12764052", "pmid:12589756", "pmid:11839840", "pmid:11160961", "pmid:9973298"] +}, +{ + "id": "SCA2_ATXN2", + "disease_id": "SCA2", + "gene": "ATXN2", + "evidence": ["Definitive"], + "chrom": "chr12", + "start_hg38": 111598949, + "stop_hg38": 111599019, + "start_hg19": 112036753, + "stop_hg19": 112036823, + "start_t2t": 111575873, + "stop_t2t": 111575940, + "disease": "Spinocerebellar ataxia type 2", + "inheritance": ["AD", "AR"], + "association_type": ["Mendelian", "Risk", "Modifier"], + "disease_description": "A subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by truncal ataxia, dysarthria, slowed saccades and less commonly ophthalmoparesis and chorea [@mondo:0008458].", + "hpo_terms": null, + "prevalence": "1.5/100000", + "prevalence_details": "1-2/100,000 (population-dependent) [@pmid:29100084]. Cases have been found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1275].", + "age_onset": "Typical: 30-39 [@genereviews:NBK1275]; Range: 2-86 [@omim:183090].", + "age_onset_min": 2.0, + "age_onset_max": 86.0, + "typ_age_onset_min": 30.0, + "typ_age_onset_max": 39.0, + "details": "Full penetrance of single alleles occurs at ~35 repeats [@genereviews:NBK1275; @pmid:37906407] and pathogenic expansions have been documented as large as 500 repeats [@pmid:12116207]. 33-34 length repeats are associated with reduced penetrance and later onset (age >50 years) [@genereviews:NBK1275]. Homozygous 31 repeat alleles may lead to recessive disease [@pmid:30533529], while a single 29-32 repeat is associated with increased ALS risk [@genereviews:NBK1275; @pmid:25285812; @pmid:32954321]. There is some evidence that all CAG-repeat expansions in ATXN2 may be a risk factor for ALS, regardless of length and interruptions [@pmid:39956874]. CAA interruptions have been observed which appear to stabilize the allele in transmission [@genereviews:NBK1275].", + "detection": "RP-PCR with fragment analysis is commonly used for detection, while Southern blotting is required to estimate size over 100 repeats [@genereviews:NBK1275].", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyglutamine cytoplasmic aggregates leading to cellular apoptosis; RAN translation implicated [@genereviews:NBK1275].", + "year": "1996 [@pmid:8896556]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CTG"], + "pathogenic_motif_reference_orientation": ["CTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["TTG"], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AAC"], + "locus_structure": [], + "benign_min": 14, + "benign_max": 28, + "intermediate_min": 29, + "intermediate_max": 34, + "pathogenic_min": 35, + "pathogenic_max": 500, + "motif_len": 3, + "ref_copies": 23.3, + "novel": "ref", + "gard": ["4072"], + "genereviews": ["NBK1275"], + "malacard": ["SPN301"], + "medgen": ["155704"], + "mondo": ["0008458"], + "omim": ["183090"], + "orphanet": ["98756"], + "gnomad": ["ATXN2"], + "stripy": ["ATXN2"], + "tr_atlas": ["TR120465"], + "webstr_hg38": ["598560", "5117050"], + "webstr_hg19": ["Expansion_SCA2/ATXN2"], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "maternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability", "motif_affects_phenotype", "proposed_modifier"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK1275", "omim:183090", "pmid:37906407", "pmid:12116207", "pmid:30533529", "pmid:25285812", "pmid:32954321", "pmid:39956874", "pmid:29100084", "pmid:8896556", "mondo:0008458"], + "additional_literature": ["pmid:42204920", "pmid:42196324", "pmid:42096001", "pmid:42087256", "pmid:42019185", "pmid:41912844", "pmid:41876820", "pmid:41771688", "pmid:41728197", "pmid:41693683", "pmid:41683965", "pmid:41630926", "pmid:41435767", "pmid:41426430", "pmid:41373690", "pmid:41359433", "pmid:41310328", "pmid:41298695", "pmid:41196070", "pmid:41149812", "pmid:41082794", "pmid:41077586", "pmid:41071260", "pmid:41009775", "pmid:41001200", "pmid:40908144", "pmid:40906330", "pmid:40900235", "pmid:40746751", "pmid:40684213", "pmid:40556342", "pmid:40488180", "pmid:40346885", "pmid:40220918", "pmid:40004498", "pmid:39940702", "pmid:39820777", "pmid:39812846", "pmid:39804470", "pmid:39571249", "pmid:39521966", "pmid:39512795", "pmid:39457708", "pmid:39420034", "pmid:39317855", "pmid:39209824", "pmid:39200113", "pmid:39048885", "pmid:39004246", "pmid:38961870", "pmid:38715656", "pmid:38667292", "pmid:38642323", "pmid:38626762", "pmid:38585669", "pmid:38419144", "pmid:38397958", "pmid:38340219", "pmid:38239855", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37848721", "pmid:37821389", "pmid:37397792", "pmid:37379724", "pmid:37202167", "pmid:37146135", "pmid:37070044", "pmid:37043475", "pmid:37003406", "pmid:36894829", "pmid:36823368", "pmid:36618024", "pmid:36530930", "pmid:36209056", "pmid:36008116", "pmid:35989899", "pmid:35962273", "pmid:35869263", "pmid:35787375", "pmid:35599735", "pmid:35525134", "pmid:35521889", "pmid:35297556", "pmid:35188716", "pmid:35182509", "pmid:35052497", "pmid:34565721", "pmid:34430069", "pmid:34390268", "pmid:34372915", "pmid:34350994", "pmid:34298214", "pmid:34284285", "pmid:34179866", "pmid:34168085", "pmid:34159894", "pmid:34077532", "pmid:33688396", "pmid:33625581", "pmid:33548146", "pmid:33502644", "pmid:33414559", "pmid:33377399", "pmid:33284045", "pmid:33159825", "pmid:33115537", "pmid:33070405", "pmid:33058338", "pmid:33029780", "pmid:32989102", "pmid:32932600", "pmid:32870233", "pmid:32822634", "pmid:32340607", "pmid:32307524", "pmid:32124191", "pmid:32082115", "pmid:31940111", "pmid:31898278", "pmid:31812845", "pmid:31810584", "pmid:31766565", "pmid:31619481", "pmid:31522753", "pmid:31432357", "pmid:31343735", "pmid:30920184", "pmid:30891880", "pmid:30847648", "pmid:30615214", "pmid:30611021", "pmid:30591349", "pmid:30417124", "pmid:30342765", "pmid:30342763", "pmid:30314815", "pmid:30196130", "pmid:30123518", "pmid:30120431", "pmid:29959555", "pmid:29934271", "pmid:29895397", "pmid:29848387", "pmid:29801887", "pmid:29801076", "pmid:29756284", "pmid:29715545", "pmid:29666341", "pmid:29665996", "pmid:29553382", "pmid:29497168", "pmid:29468174", "pmid:29462666", "pmid:29249939", "pmid:29080331", "pmid:29057148", "pmid:29046994", "pmid:28923333", "pmid:28782341", "pmid:28642336", "pmid:28585930", "pmid:28534046", "pmid:30363439", "pmid:28527524", "pmid:28525545", "pmid:28444220", "pmid:28263872", "pmid:28124431", "pmid:28017238", "pmid:27896316", "pmid:27848087", "pmid:27774050", "pmid:27531668", "pmid:27333979", "pmid:27245636", "pmid:26846400", "pmid:26777436", "pmid:26733254", "pmid:26599997", "pmid:26551617", "pmid:26377379", "pmid:26374734", "pmid:26362908", "pmid:26354989", "pmid:26095883", "pmid:26086378", "pmid:26077168", "pmid:26054379", "pmid:25893506", "pmid:25790475", "pmid:25721894", "pmid:25634432", "pmid:25527265", "pmid:25466696", "pmid:25189938", "pmid:25189117", "pmid:25111021", "pmid:25098532", "pmid:24972706", "pmid:24908169", "pmid:24866401", "pmid:24780882", "pmid:24780439", "pmid:24718895", "pmid:24534762", "pmid:24269018", "pmid:24209901", "pmid:23959108", "pmid:23844332", "pmid:23635656", "pmid:23634774", "pmid:23368522", "pmid:23197749", "pmid:23047744", "pmid:23026538", "pmid:22868089", "pmid:22831947", "pmid:22650353", "pmid:22520093", "pmid:22507827", "pmid:22425256", "pmid:22297462", "pmid:22053702", "pmid:22035589", "pmid:21889984", "pmid:21880993", "pmid:21832228", "pmid:21741123", "pmid:21610160", "pmid:21600833", "pmid:21562247", "pmid:21537950", "pmid:21479228", "pmid:21329459", "pmid:20960485", "pmid:20740007", "pmid:20095980", "pmid:20070987", "pmid:20069235", "pmid:22353486", "pmid:19676102", "pmid:19672991", "pmid:19473475", "pmid:19429075", "pmid:19049837", "pmid:18990604", "pmid:18759344", "pmid:18685131", "pmid:18418678", "pmid:18297329", "pmid:18182848", "pmid:18028243", "pmid:17961920", "pmid:17923635", "pmid:17712857", "pmid:17620498", "pmid:17568014", "pmid:17440947", "pmid:17420317", "pmid:16687213", "pmid:16436644", "pmid:16389595", "pmid:16000334", "pmid:15911147", "pmid:15747371", "pmid:22473187", "pmid:15553088", "pmid:15533937", "pmid:15504570", "pmid:15300851", "pmid:15265035", "pmid:15148151", "pmid:15133829", "pmid:15080863", "pmid:14967767", "pmid:14966163", "pmid:14756671", "pmid:14732617", "pmid:12853230", "pmid:12812977", "pmid:12810491", "pmid:12764052", "pmid:12682323", "pmid:12671950", "pmid:12614315", "pmid:12490063", "pmid:12235319", "pmid:12039668", "pmid:11939898", "pmid:11889231", "pmid:11839840", "pmid:11804332", "pmid:11719273", "pmid:11689490", "pmid:11591855", "pmid:11502947", "pmid:11448300", "pmid:11374096", "pmid:11160961", "pmid:10369884", "pmid:11030803", "pmid:11030410", "pmid:10953195", "pmid:10942107", "pmid:10915763", "pmid:10894992", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10642945", "pmid:10573020", "pmid:10525984", "pmid:10525976", "pmid:10453742", "pmid:10219787", "pmid:10210910", "pmid:10050970", "pmid:9973298", "pmid:9855520", "pmid:9779806", "pmid:9776463", "pmid:9762957", "pmid:9758625", "pmid:9748675", "pmid:9741408", "pmid:9710044", "pmid:9696528", "pmid:9674805", "pmid:9613852", "pmid:9588855", "pmid:9577387", "pmid:9549522", "pmid:9507387", "pmid:9436730", "pmid:9385362", "pmid:9403486", "pmid:9403480", "pmid:9339711", "pmid:9339681", "pmid:9259275", "pmid:9225982", "pmid:10735276", "pmid:9106530", "pmid:9020849", "pmid:10464657", "pmid:8968739", "pmid:8896557", "pmid:8896555", "pmid:8559378", "pmid:7477379", "pmid:7762567"] +}, +{ + "id": "SCA3_ATXN3", + "disease_id": "SCA3, MJD", + "gene": "ATXN3", + "evidence": ["Definitive"], + "chrom": "chr14", + "start_hg38": 92071010, + "stop_hg38": 92071052, + "start_hg19": 92537354, + "stop_hg19": 92537396, + "start_t2t": 86300519, + "stop_t2t": 86300603, + "disease": "Spinocerebellar ataxia type 3/Machado-Joseph disease", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease, is the most common subtype of type 1 autosomal dominant cerebellar ataxia (ADCA type 1), a neurodegenerative disorder, and is characterized by ataxia, external progressive ophthalmoplegia, and other neurological manifestations [@mondo:0007182]. Research suggests that length of ATXN2 expansions may affect the phenotype of SCA3 [@pmid:40684213].", + "hpo_terms": null, + "prevalence": "2.1/100000", + "prevalence_details": "1-5/100,000 [@pmid:29100084]. Most prevalent SCA subtype [@genereviews:NBK557816]. Found worldwide across ancestries/ethnicities [@genereviews:NBK1196].", + "age_onset": "Typical: 10-49 [@genereviews:NBK1196]; 3 [@pmid:40004498] - 73 [@genereviews:NBK1196; @pmid:30414314].", + "age_onset_min": 3.0, + "age_onset_max": 73.0, + "typ_age_onset_min": 10.0, + "typ_age_onset_max": 49.0, + "details": "Benign alleles range from 11-44 repeats [@pmid:37906407], with intermediate alleles (45-59) associated with incomplete penetrance and non-classic phenotypes [@genereviews:NBK1196]. The threshold between incomplete and full penetrance is unclear, but presumed to occur at ~60 repeats [@genereviews:NBK1196; @pmid:37906407]. The interruption CAA has been observed [@pmid:35245110]; AAG is present in hg38 reference sequence. The APOE ε4 allele appears to act as a disease modifier [@pmid:39731318]; GLS expansions may also function as disease modifiers [@pmid:39699045].", + "detection": "PCR fragment analysis or RP-PCR typically detect expansions, but homozygous PCR results may require Southern blotting to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1196]. Long-read sequencing can characterize full structure [@pmid:40890629].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to gain of function; aggregated and mislocalized proteins in neurons [@pmid:36169768; @genereviews:NBK1196].", + "year": "1994 [@pmid:7874163]", + "location_in_gene": "Coding Exon 10", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CTG"], + "pathogenic_motif_reference_orientation": ["CTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["TTG", "AGG"], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AAC", "CCT"], + "locus_structure": [], + "benign_min": 11, + "benign_max": 44, + "intermediate_min": 45, + "intermediate_max": 59, + "pathogenic_min": 60, + "pathogenic_max": 87, + "motif_len": 3, + "ref_copies": 14.0, + "novel": "ref", + "gard": ["6801"], + "genereviews": ["NBK1196"], + "malacard": ["MCH002"], + "medgen": ["9841"], + "mondo": ["0007182"], + "omim": ["109150"], + "orphanet": ["98757"], + "gnomad": ["ATXN3"], + "stripy": ["ATXN3"], + "tr_atlas": ["TR132758"], + "webstr_hg38": ["5316666", "1481402"], + "webstr_hg19": ["Expansion_SCA3_MJD/ATXN3"], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "maternal_expansion", "length_affects_onset", "length_affects_phenotype", "length_affects_severity"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK1196", "pmid:40004498", "pmid:30414314", "pmid:36169768", "pmid:37906407", "pmid:35245110", "pmid:39731318", "pmid:39699045", "pmid:29100084", "genereviews:NBK557816", "pmid:7874163", "mondo:0007182", "pmid:40684213"], + "additional_literature": ["pmid:42191105", "pmid:42105168", "pmid:42096001", "pmid:41854058", "pmid:41853947", "pmid:41818480", "pmid:41771688", "pmid:41736717", "pmid:41713739", "pmid:41701293", "pmid:41613623", "pmid:41612618", "pmid:41552385", "pmid:41435767", "pmid:41358280", "pmid:41082794", "pmid:41058593", "pmid:41009775", "pmid:41001200", "pmid:40906330", "pmid:40900235", "pmid:40890629", "pmid:40880681", "pmid:40797466", "pmid:40754098", "pmid:40738252", "pmid:40692435", "pmid:40635703", "pmid:40488202", "pmid:40488180", "pmid:40450087", "pmid:40204795", "pmid:40178277", "pmid:40152810", "pmid:39987589", "pmid:39921113", "pmid:39820777", "pmid:39571249", "pmid:39516744", "pmid:39456985", "pmid:39375222", "pmid:39317855", "pmid:39298485", "pmid:39229124", "pmid:39125643", "pmid:39088078", "pmid:39048885", "pmid:38961870", "pmid:38900277", "pmid:38626762", "pmid:38513302", "pmid:38449714", "pmid:38443995", "pmid:38429929", "pmid:38291334", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37961108", "pmid:37866221", "pmid:37848721", "pmid:37830620", "pmid:37830611", "pmid:37735371", "pmid:37397792", "pmid:37379724", "pmid:37333326", "pmid:37215811", "pmid:37122622", "pmid:37003406", "pmid:36907537", "pmid:36891289", "pmid:36875652", "pmid:36733922", "pmid:36618024", "pmid:36530930", "pmid:36482247", "pmid:36250694", "pmid:35997830", "pmid:35962273", "pmid:35952620", "pmid:35851059", "pmid:35847233", "pmid:35426475", "pmid:35421843", "pmid:35406787", "pmid:35188716", "pmid:35182509", "pmid:35052497", "pmid:35042771", "pmid:34783886", "pmid:34716557", "pmid:34706018", "pmid:34565721", "pmid:34473252", "pmid:34430069", "pmid:34284285", "pmid:34191270", "pmid:34167352", "pmid:34160773", "pmid:34159894", "pmid:34087977", "pmid:33893204", "pmid:33782863", "pmid:33743045", "pmid:33502644", "pmid:33468086", "pmid:33413375", "pmid:33371889", "pmid:33159825", "pmid:33157084", "pmid:33087504", "pmid:33058338", "pmid:32978817", "pmid:32822634", "pmid:32729243", "pmid:32205441", "pmid:31934455", "pmid:31920494", "pmid:31783119", "pmid:31687087", "pmid:31616370", "pmid:31565539", "pmid:31394429", "pmid:31374463", "pmid:31310802", "pmid:31230722", "pmid:30920184", "pmid:30891880", "pmid:30833927", "pmid:30804982", "pmid:30685895", "pmid:30615214", "pmid:30591349", "pmid:30554804", "pmid:30314815", "pmid:30231063", "pmid:30125433", "pmid:30120431", "pmid:30008965", "pmid:29959555", "pmid:29936336", "pmid:29922950", "pmid:29881950", "pmid:29852360", "pmid:29801869", "pmid:29737427", "pmid:29666341", "pmid:29553382", "pmid:29497168", "pmid:29444500", "pmid:29249939", "pmid:29057148", "pmid:28854700", "pmid:28782341", "pmid:28624196", "pmid:28585930", "pmid:28444220", "pmid:28158474", "pmid:28065793", "pmid:27942452", "pmid:27896316", "pmid:27848087", "pmid:27847820", "pmid:27596958", "pmid:27774050", "pmid:27731380", "pmid:27600091", "pmid:27333979", "pmid:26615955", "pmid:26601773", "pmid:26505994", "pmid:26467707", "pmid:26377379", "pmid:26374734", "pmid:26362908", "pmid:26354989", "pmid:26336829", "pmid:26266536", "pmid:26083476", "pmid:26077168", "pmid:26067219", "pmid:26054379", "pmid:30363545", "pmid:25700012", "pmid:25634432", "pmid:25633985", "pmid:25590633", "pmid:25466696", "pmid:25320121", "pmid:25144244", "pmid:25143392", "pmid:25068645", "pmid:25026993", "pmid:24972706", "pmid:24780882", "pmid:24746364", "pmid:24675225", "pmid:24534762", "pmid:24525517", "pmid:24242192", "pmid:23844332", "pmid:23775343", "pmid:23659897", "pmid:23423669", "pmid:23413156", "pmid:23382971", "pmid:23368522", "pmid:23026538", "pmid:22520093", "pmid:22351852", "pmid:22297462", "pmid:22090366", "pmid:22023810", "pmid:21975858", "pmid:21889984", "pmid:21832228", "pmid:21795378", "pmid:21780213", "pmid:21625753", "pmid:21600833", "pmid:21506152", "pmid:20726892", "pmid:20503052", "pmid:20484674", "pmid:20467850", "pmid:20334689", "pmid:20069235", "pmid:22353486", "pmid:19802879", "pmid:19699305", "pmid:19672991", "pmid:19631275", "pmid:19608203", "pmid:19597981", "pmid:19503814", "pmid:19412185", "pmid:19049837", "pmid:18990604", "pmid:18759344", "pmid:18685131", "pmid:18506570", "pmid:18449188", "pmid:18418678", "pmid:18413477", "pmid:18385100", "pmid:18261802", "pmid:18182848", "pmid:18071041", "pmid:18028243", "pmid:17961920", "pmid:17948873", "pmid:17712857", "pmid:17594286", "pmid:17440947", "pmid:17420317", "pmid:17116127", "pmid:17027034", "pmid:16967484", "pmid:16791428", "pmid:16724006", "pmid:16687213", "pmid:16389595", "pmid:16340213", "pmid:16241973", "pmid:15911147", "pmid:15747371", "pmid:22473187", "pmid:15553088", "pmid:15534186", "pmid:15504352", "pmid:15265035", "pmid:15223312", "pmid:15201448", "pmid:15167689", "pmid:15148151", "pmid:15080863", "pmid:15026782", "pmid:14966163", "pmid:14756671", "pmid:14679302", "pmid:14616293", "pmid:12938149", "pmid:12853230", "pmid:12832059", "pmid:12810491", "pmid:12764052", "pmid:12614315", "pmid:12486728", "pmid:12433269", "pmid:12235319", "pmid:12042281", "pmid:12007862", "pmid:11978767", "pmid:11889231", "pmid:11839840", "pmid:11807410", "pmid:11804332", "pmid:11559318", "pmid:11448300", "pmid:11466410", "pmid:11409435", "pmid:11405804", "pmid:11374096", "pmid:11160961", "pmid:10369884", "pmid:11030803", "pmid:11030410", "pmid:10942107", "pmid:10915763", "pmid:10894992", "pmid:10855623", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10732811", "pmid:10717003", "pmid:10575843", "pmid:10525976", "pmid:10453742", "pmid:10433966", "pmid:10072437", "pmid:10071104", "pmid:9973298", "pmid:9855520", "pmid:9762957", "pmid:9758625", "pmid:9696528", "pmid:9674805", "pmid:9635424", "pmid:9613852", "pmid:9536097", "pmid:9588850", "pmid:9577387", "pmid:9562258", "pmid:9549522", "pmid:9532283", "pmid:9469848", "pmid:9507387", "pmid:9506544", "pmid:9415538", "pmid:9450899", "pmid:9436730", "pmid:9385362", "pmid:9371900", "pmid:9403486", "pmid:9403480", "pmid:9339702", "pmid:9339681", "pmid:9292723", "pmid:9259275", "pmid:9254842", "pmid:9225982", "pmid:9215676", "pmid:10735276", "pmid:9124808", "pmid:9106530", "pmid:9132496", "pmid:9020849", "pmid:10464657", "pmid:9401013", "pmid:8962095", "pmid:9088110", "pmid:8968739", "pmid:8931692", "pmid:8937340", "pmid:8836972", "pmid:8659514", "pmid:8609925", "pmid:8655136", "pmid:8780110", "pmid:8644735", "pmid:8815156", "pmid:8824876", "pmid:8926495", "pmid:8900536", "pmid:8800925", "pmid:8559378", "pmid:8559377", "pmid:8583215", "pmid:7574470", "pmid:7573040", "pmid:7496771", "pmid:8523034", "pmid:7668288", "pmid:7611296", "pmid:7762567", "pmid:7655453", "pmid:7633439"] +}, +{ + "id": "SCA7_ATXN7", + "disease_id": "SCA7", + "gene": "ATXN7", + "evidence": ["Definitive"], + "chrom": "chr3", + "start_hg38": 63912684, + "stop_hg38": 63912715, + "start_hg19": 63898360, + "stop_hg19": 63898391, + "start_t2t": 63956302, + "stop_t2t": 63956333, + "disease": "Spinocerebellar ataxia type 7", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia-7 (SCA7) is an autosomal dominant neurodegenerative disorder characterized by adult onset of progressive cerebellar ataxia associated with pigmental macular dystrophy [@omim:164500].", + "hpo_terms": null, + "prevalence": "0.999/300000", + "prevalence_details": "<1/300,000: predominantly found in those with North European and African ancestry [@genereviews:NBK1256].", + "age_onset": "Typical: 4-48 [@pmid:20739808]; Range: 0-90 [@genereviews:NBK1256; @pmid:14571264].", + "age_onset_min": 0.0, + "age_onset_max": 65.0, + "typ_age_onset_min": 4.0, + "typ_age_onset_max": 48.0, + "details": "Benign alleles range from 4-27 [@pmid:37906407], with intermediate alleles ranging from premutations (28-33) to reduced penetrance (34-36) [@genereviews:NBK1256]. Interruptions observed include CAA [@pmid:35245110].", + "detection": "Short-read WGS cannot accurately detect repeat expansions at this locus. PCR fragment analysis or RP-PCR has detected expansions and sized most normal or moderate pathogenic alleles, while very large expansions have been detected with Southern blotting or long-read sequencing [@genereviews:NBK1256].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to gain of function; toxic misfolded intermediated suspected [@genereviews:NBK1256; @pmid:18418675].", + "year": "1996 [@pmid:8908515]", + "location_in_gene": "Coding Exon 1, 2, or 3 (depending on isoform)", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "OPDM5_ABCD3", - "disease_id": "OPDM5", - "gene": "ABCD3", - "evidence": [ - "Moderate" - ], - "chrom": "chr1", - "start_hg38": 94418421, - "stop_hg38": 94418444, - "start_hg19": 94883977, - "stop_hg19": 94884000, - "start_t2t": 94266544, - "stop_t2t": 94266567, - "disease": "Oculopharyngodistal myopathy type 5", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in individuals of European, Japanese, and Chinese ancestry [@pmid:38876750; @pmid:34047774].", - "age_onset": "Typical: 24-30; Range: 10-50 [@pmid:39068203]. Age of onset data is limited to 8 families.", - "age_onset_min": 10, - "age_onset_max": 50, - "typ_age_onset_min": 24, - "typ_age_onset_max": 30, - "details": "Characterized in eight unrelated families which were used to establish benign (3-44) and pathogenic (118-694) ranges [@pmid:39068203].", - "detection": "RP-PCR has been used for detection [@pmid:39068203]. Short-read sequencing has significantly underestimated repeat count, while long-read sequencing has accurately resolved size [@pmid:39068203].", - "mechanism": null, - "mechanism_detail": "Potentially over-expression of transcripts [@pmid:39068203].", - "year": "2023 [@pmid:39068203]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 3, - "benign_max": 44, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 118, - "pathogenic_max": 694, - "motif_len": 3, - "ref_copies": 7.7, - "novel": "ref", - "gard": [ - "12592" - ], - "genereviews": [], - "malacard": [], - "medgen": [ - "320250" - ], - "mondo": [ - "0025193" - ], - "omim": [], - "orphanet": [ - "98897" - ], - "gnomad": [ - "ABCD3" - ], - "stripy": [], - "tr_atlas": [ - "TR5671" - ], - "webstr_hg38": [ - "1164141", - "6329150" - ], - "webstr_hg19": [ - "STR_58687" - ], - "locus_tags": [], - "disease_tags": [ - "oculopharyngodistal_myopathy" - ], - "references": [ - "pmid:39068203", - "pmid:38876750", - "pmid:34047774", - "mondo:0025193" - ], - "additional_literature": [ - "pmid:41959811", - "pmid:41792844", - "pmid:40645757" - ] + "motif": "CAG", + "count": null, + "type": "pathogenic_repeat" }, { - "id": "FRAXE_AFF2", - "disease_id": "FRAXE", - "gene": "AFF2", - "evidence": [ - "Definitive" - ], - "chrom": "chrX", - "start_hg38": 148500604, - "stop_hg38": 148500753, - "start_hg19": 147582124, - "stop_hg19": 147582273, - "start_t2t": 146765190, - "stop_t2t": 146765342, - "disease": "Intellectual developmental disorder, Fragile X intellectual disability", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659].", - "hpo_terms": [ - "HP:0000718 Aggressive behavior", - "HP:0000713 Agitation", - "HP:0000729 Autistic behavior", - "HP:0002312 Clumsiness", - "HP:0000722 Compulsive behaviors", - "HP:0000750 Delayed speech and language development", - "HP:0001249 Intellectual disability" - ], - "prevalence": "2/50000", - "prevalence_details": "1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464].", - "age_onset": "Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548].", - "age_onset_min": 1, - "age_onset_max": 10, - "typ_age_onset_min": 2, - "typ_age_onset_max": 10, - "details": "Allele ranges (benign:4-39; pathogenic: >200) inferred from The Human Gene Mutation Database [@genereviews:NBK535148]. Intermediate alleles correspond to a premutation [@pmid:23914978]. Non-canonical motifs include: CGG/CCT/GTG/CAG/CTG3 [@pmid:35245110; @pmid:34111553].", - "detection": "RP-PCR has been used to detect expansions and size alleles to ~80 repeats, while Southern blotting has sized full expansions and detected methylation using Notl, a methylation-sensitive restriction enzyme [@pmid:34282157].", - "mechanism": "LoF", - "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", - "year": "1993 [@pmid:8334699]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 39, - "intermediate_min": 40, - "intermediate_max": 200, - "pathogenic_min": 201, - "pathogenic_max": 2000, - "motif_len": 3, - "ref_copies": 50.3, - "novel": "ref", - "gard": [ - "2378" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "INT399" - ], - "medgen": [ - "155512" - ], - "mondo": [ - "0010659" - ], - "omim": [ - "309548" - ], - "orphanet": [ - "100973" - ], - "gnomad": [ - "AFF2" - ], - "stripy": [ - "AFF2" - ], - "tr_atlas": [ - "TR173976" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [ - "somatic_instability", - "anticipation", - "maternal_expansion", - "length_affects_penetrance", - "length_affects_severity" - ], - "disease_tags": [], - "references": [ - "pmid:11246464", - "omim:309548", - "pmid:16205714", - "pmid:36169768", - "genereviews:NBK535148", - "pmid:23914978", - "pmid:35245110", - "pmid:34111553", - "url:medlineplus.gov/genetics/condition/fragile-xe-syndrome", - "pmid:8334699", - "mondo:0010659" - ], - "additional_literature": [ - "pmid:41074692", - "pmid:40708890", - "pmid:35431806", - "pmid:28812997", - "pmid:25171808", - "pmid:24763282", - "pmid:22718980", - "pmid:21739600", - "pmid:21254876", - "pmid:21051337", - "pmid:17635840", - "pmid:17516099", - "pmid:16469443", - "pmid:11119302", - "pmid:10780779", - "pmid:10674158", - "pmid:10424820", - "pmid:9630071", - "pmid:9415475", - "pmid:9415473", - "pmid:9341861", - "pmid:8808600", - "pmid:8844091", - "pmid:8755928", - "pmid:8673086", - "pmid:7541938", - "pmid:7783163", - "pmid:7881407", - "pmid:7977354", - "pmid:8023854", - "pmid:8162055", - "pmid:8118462" - ] - }, - { - "id": "FRA2A_AFF3", - "disease_id": "FRA2A", - "gene": "AFF3", - "evidence": [ - "Definitive" - ], - "chrom": "chr2", - "start_hg38": 100104798, - "stop_hg38": 100104824, - "start_hg19": 100721260, - "stop_hg19": 100721286, - "start_t2t": 100563685, - "stop_t2t": 100563738, - "disease": "Intellectual disability associated with fragile site FRA2A", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian", - "Risk" - ], - "disease_description": "These expansions are associated with intellectual disability and clinical phenotypes such as delayed motor development or delays in speech/language [@pmid:24763282].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "1/862 (1/654-1266) population prevalence of methylated AFF3 expansions (mild cognitive disability) [@pmid:39313615]. Disease cases observed in South Australia [@pmid:24763282].", - "age_onset": "Early childhood (small sample size) [@pmid:24763282].", - "age_onset_min": 1, - "age_onset_max": 7, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Allele ranges established in study of 3 families; intermediate alleles likely premutations [@pmid:24763282]. Pathogenic threshold may be higher than 300 as this was the largest allele that could be accurately sized by the assay.", - "detection": "Standard PCR has detected small alleles, while RP-PCR and Southern blotting have detected large expansions. Short-read sequencing may underestimate the size of large expansions and exact sizing usually uses long-read sequencing [@pmid:24763282; @pmid:39313615].", - "mechanism": "LoF/methylation", - "mechanism_detail": "Silencing of the FMR2 gene as a consequence of a CCG expansion located upstream of this gene [@malacard:KNS007].", - "year": "2014 [@pmid:24763282]", - "location_in_gene": "Intron 3", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 3, - "benign_max": 20, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 300, - "pathogenic_max": 300, - "motif_len": 3, - "ref_copies": 8.7, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": [ - "KNS007" - ], - "medgen": [], - "mondo": [], - "omim": [ - "601464" - ], - "orphanet": [], - "gnomad": [ - "AFF3" - ], - "stripy": [], - "tr_atlas": [ - "TR252468" - ], - "webstr_hg38": [ - "288936" - ], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:24763282", - "malacard:KNS007", - "pmid:39313615" - ], - "additional_literature": [ - "pmid:40417743", - "pmid:37205357" - ] - }, - { - "id": "SBMA_AR", - "disease_id": "SBMA", - "gene": "AR", - "evidence": [ - "Definitive" - ], - "chrom": "chrX", - "start_hg38": 67545316, - "stop_hg38": 67545419, - "start_hg19": 66765158, - "stop_hg19": 66765261, - "start_t2t": 65975147, - "stop_t2t": 65975250, - "disease": "Spinal and bulbar muscular atrophy, Kennedy Disease", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting [@mondo:0010735].", - "hpo_terms": null, - "prevalence": "1/30000", - "prevalence_details": "1-2/100,000 (population-specific, higher in Finnish population, Canadian population) [@pmid:37628685]; 1/30,000 [@orphanet:481]; mutation frequency of 1:3182 10x more frequent than reported disease prevalence of 1 in 30,000 [@pmid:36797998]. Only documented in patients with European/Asian ancestry, including Scandinavian, English, Belgian, French, Italian, German, Polish, Spanish, Swiss, Moroccan, Turkish, Chinese, Japanese (more common because of a founder effect), East Indian (potentially related to Japanese founder mutation) [@pmid:37578398], Korean, and Vietnamese populations [@genereviews:NBK1333].", - "age_onset": "Typical: 20-49 [@pmid:11436124], Range: 8 [@pmid:15851746] - 83 [@doi:10.17161/2tmg0f25].", - "age_onset_min": 8, - "age_onset_max": 83, - "typ_age_onset_min": 20, - "typ_age_onset_max": 49, - "details": "Intermediate alleles indicate reduced penetrance [@genereviews:NBK1333]. Expansions larger than the pathogenic threshold in the AR gene should be evaluated carefully. Interruptions have not been observed in patient cases; it has been proposed that longer alleles with interruptions may not be pathogenic [@pmid:24041967]. Non-canonical motif CAA observed [@pmid:35245110]. Expansions are also detected ten-fold more often in a general population than would be expected by disease prevalence [@pmid:36797998]. Clinical evaluation and phenotypic matching may be necessary to determine diagnosis even in the presence of a pure expanded allele. It has been proposed that contractions may play a role in disease [@pmid:10398229]. Disease may be subclinical in females [@pmid:34922802], and can be clinically heterogeneous even within the same family [@pmid:20184516].", - "detection": "Although short-read sequencing screens have been used to detect this expansion [@pmid:36797998], sizing is generally validated with standard PCR fragment analysis or RP-PCR [@genereviews:NBK1333].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine alters protein conformation leading to gain-of-function neurodegeneration [@pmid:29398703; @pmid:36169768]. Transcriptional dysregulation, axonal transport disruption, and mitochondrial dysfunction also play causative roles in the neurodegeneration [@pmid:22609045].", - "year": "1991 [@pmid:2062380]; the first triplet disease to be discovered [@pmid:15313856]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCA" - ], - "pathogenic_motif_reference_orientation": [ - "GCA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 9, - "benign_max": 34, - "intermediate_min": 36, - "intermediate_max": 37, - "pathogenic_min": 38, - "pathogenic_max": 68, - "motif_len": 3, - "ref_copies": 34, - "novel": "ref", - "gard": [ - "6818" - ], - "genereviews": [ - "NBK1333" - ], - "malacard": [ - "SPN404" - ], - "medgen": [ - "333282" - ], - "mondo": [ - "0010735" - ], - "omim": [ - "313200" - ], - "orphanet": [ - "481" - ], - "gnomad": [ - "AR" - ], - "stripy": [ - "AR" - ], - "tr_atlas": [ - "TR169377" - ], - "webstr_hg38": [ - "859199" - ], - "webstr_hg19": [], - "locus_tags": [ - "contraction", - "somatic_instability", - "anticipation", - "paternal_expansion", - "length_affects_severity", - "length_affects_penetrance", - "length_affects_onset" - ], - "disease_tags": [], - "references": [ - "pmid:11436124", - "pmid:15851746", - "doi:10.17161/2tmg0f25", - "pmid:29398703", - "pmid:36169768", - "pmid:22609045", - "genereviews:NBK1333", - "pmid:24041967", - "pmid:35245110", - "pmid:36797998", - "pmid:10398229", - "pmid:34922802", - "pmid:20184516", - "pmid:37628685", - "orphanet:481", - "pmid:37578398", - "pmid:2062380", - "pmid:15313856", - "mondo:0010735" - ], - "additional_literature": [ - "pmid:42196324", - "pmid:42138244", - "pmid:42070078", - "pmid:42067676", - "pmid:41762523", - "pmid:41564929", - "pmid:41552385", - "pmid:41513898", - "pmid:41361869", - "pmid:41246945", - "pmid:40912964", - "pmid:40614362", - "pmid:40585427", - "pmid:40488202", - "pmid:40450087", - "pmid:40371721", - "pmid:40366765", - "pmid:40031964", - "pmid:39755011", - "pmid:39729861", - "pmid:39694906", - "pmid:39570490", - "pmid:39189540", - "pmid:39140081", - "pmid:38976730", - "pmid:38860410", - "pmid:38737445", - "pmid:38701087", - "pmid:38585669", - "pmid:38284836", - "pmid:38171945", - "pmid:37936145", - "pmid:37718889", - "pmid:37715620", - "pmid:37422780", - "pmid:37269008", - "pmid:37045687", - "pmid:36988133", - "pmid:36717478", - "pmid:36701310", - "pmid:36622568", - "pmid:36599645", - "pmid:36585400", - "pmid:36142533", - "pmid:36137740", - "pmid:35982373", - "pmid:35876459", - "pmid:35872088", - "pmid:35867854", - "pmid:35661131", - "pmid:35599735", - "pmid:35571498", - "pmid:35237894", - "pmid:35230239", - "pmid:35189449", - "pmid:35182509", - "pmid:35165376", - "pmid:34914563", - "pmid:34744823", - "pmid:34723064", - "pmid:34407295", - "pmid:34390226", - "pmid:34372915", - "pmid:34006154", - "pmid:33865179", - "pmid:33738134", - "pmid:33714752", - "pmid:33261594", - "pmid:33191626", - "pmid:32989102", - "pmid:32856855", - "pmid:32468478", - "pmid:32216057", - "pmid:32166698", - "pmid:32152060", - "pmid:32070397", - "pmid:31901908", - "pmid:31522753", - "pmid:31446215", - "pmid:31303548", - "pmid:31179189", - "pmid:31040020", - "pmid:31030566", - "pmid:31019916", - "pmid:30940675", - "pmid:30886222", - "pmid:30838350", - "pmid:30837566", - "pmid:30615214", - "pmid:30612224", - "pmid:30415810", - "pmid:30351503", - "pmid:30314815", - "pmid:30247609", - "pmid:30206564", - "pmid:30206283", - "pmid:30156935", - "pmid:30156032", - "pmid:30139231", - "pmid:30120431", - "pmid:30043577", - "pmid:30019487", - "pmid:30019104", - "pmid:29914823", - "pmid:29886316", - "pmid:29809168", - "pmid:29714466", - "pmid:29706560", - "pmid:29571584", - "pmid:29556396", - "pmid:29464380", - "pmid:29364557", - "pmid:29299905", - "pmid:29249939", - "pmid:28963363", - "pmid:28915409", - "pmid:28780536", - "pmid:28585930", - "pmid:28511915", - "pmid:28367605", - "pmid:28295444", - "pmid:27873769", - "pmid:27807533", - "pmid:27669432", - "pmid:27634944", - "pmid:27517091", - "pmid:27251588", - "pmid:27193223", - "pmid:27066582", - "pmid:26872663", - "pmid:26772404", - "pmid:26691666", - "pmid:26541420", - "pmid:26511871", - "pmid:26499105", - "pmid:26410037", - "pmid:26406407", - "pmid:26355245", - "pmid:26345963", - "pmid:26298608", - "pmid:26266536", - "pmid:26246877", - "pmid:26221130", - "pmid:26043854", - "pmid:25979597", - "pmid:25925349", - "pmid:25889790", - "pmid:25828775", - "pmid:25746115", - "pmid:25665908", - "pmid:25637315", - "pmid:25536734", - "pmid:25520876", - "pmid:25514102", - "pmid:25455261", - "pmid:25230321", - "pmid:25217983", - "pmid:25148265", - "pmid:25122660", - "pmid:25078280", - "pmid:25047668", - "pmid:25027083", - "pmid:24974051", - "pmid:24966714", - "pmid:24925673", - "pmid:24925468", - "pmid:24872216", - "pmid:24824408", - "pmid:24793825", - "pmid:24742458", - "pmid:24711544", - "pmid:24691874", - "pmid:24581183", - "pmid:24566949", - "pmid:24391916", - "pmid:24274329", - "pmid:24256885", - "pmid:24200287", - "pmid:24120273", - "pmid:23799424", - "pmid:23789051", - "pmid:23732677", - "pmid:23679084", - "pmid:23545426", - "pmid:23515294", - "pmid:23467468", - "pmid:23441776", - "pmid:23388696", - "pmid:23377847", - "pmid:23364790", - "pmid:23359804", - "pmid:23272232", - "pmid:23184046", - "pmid:23167717", - "pmid:23136466", - "pmid:23062703", - "pmid:22941760", - "pmid:22819977", - "pmid:22792352", - "pmid:22765868", - "pmid:22736030", - "pmid:22731640", - "pmid:22653589", - "pmid:22652498", - "pmid:24052720", - "pmid:22333840", - "pmid:22233359", - "pmid:22107839", - "pmid:22068615", - "pmid:22038041", - "pmid:22025404", - "pmid:21977989", - "pmid:21664238", - "pmid:21643744", - "pmid:21642359", - "pmid:21486420", - "pmid:21445561", - "pmid:21410629", - "pmid:21270324", - "pmid:21247881", - "pmid:21089003", - "pmid:20880698", - "pmid:20689246", - "pmid:20425835", - "pmid:20353269", - "pmid:20233785", - "pmid:20127024", - "pmid:20063560", - "pmid:19956434", - "pmid:19818997", - "pmid:19692580", - "pmid:19684044", - "pmid:19497852", - "pmid:19482445", - "pmid:19237573", - "pmid:19228953", - "pmid:19218788", - "pmid:19211034", - "pmid:19207614", - "pmid:19100835", - "pmid:19095061", - "pmid:19062046", - "pmid:18962445", - "pmid:18783352", - "pmid:18762554", - "pmid:18645714", - "pmid:18642379", - "pmid:18624843", - "pmid:18610651", - "pmid:18592136", - "pmid:18446630", - "pmid:18365230", - "pmid:18323476", - "pmid:18222439", - "pmid:18217192", - "pmid:18191848", - "pmid:18181049", - "pmid:18097504", - "pmid:17997416", - "pmid:17984450", - "pmid:17984063", - "pmid:17979523", - "pmid:17854832", - "pmid:17852020", - "pmid:17825390", - "pmid:17635942", - "pmid:17556727", - "pmid:17507624", - "pmid:17507457", - "pmid:17465263", - "pmid:17440439", - "pmid:17431729", - "pmid:17372242", - "pmid:17321486", - "pmid:17230529", - "pmid:17161354", - "pmid:17137601", - "pmid:17027356", - "pmid:16859836", - "pmid:16847812", - "pmid:16817826", - "pmid:16813680", - "pmid:16804045", - "pmid:16793958", - "pmid:16772330", - "pmid:16696857", - "pmid:16621916", - "pmid:16515589", - "pmid:16493814", - "pmid:16462497", - "pmid:16448271", - "pmid:16437189", - "pmid:16425097", - "pmid:16403814", - "pmid:16377095", - "pmid:16365010", - "pmid:16358333", - "pmid:16299230", - "pmid:16187285", - "pmid:16117826", - "pmid:16008071", - "pmid:15956082", - "pmid:15954500", - "pmid:15952987", - "pmid:15950642", - "pmid:15876692", - "pmid:15824176", - "pmid:15747808", - "pmid:15725470", - "pmid:15721279", - "pmid:15659427", - "pmid:15609126", - "pmid:15599941", - "pmid:15570555", - "pmid:15545219", - "pmid:15472213", - "pmid:15366384", - "pmid:15358199", - "pmid:15341991", - "pmid:15310009", - "pmid:15198988", - "pmid:15146455", - "pmid:15120698", - "pmid:15044606", - "pmid:15003169", - "pmid:14974917", - "pmid:14973115", - "pmid:14731580", - "pmid:14698481", - "pmid:14693242", - "pmid:14691592", - "pmid:14674723", - "pmid:14605819", - "pmid:14585317", - "pmid:14511217", - "pmid:14506156", - "pmid:12898143", - "pmid:12860943", - "pmid:12767946", - "pmid:12755998", - "pmid:12714591", - "pmid:12670590", - "pmid:12634316", - "pmid:12632109", - "pmid:12602915", - "pmid:12542725", - "pmid:12534937", - "pmid:12478141", - "pmid:12404104", - "pmid:12388541", - "pmid:12385020", - "pmid:12376473", - "pmid:12220434", - "pmid:12189490", - "pmid:12189162", - "pmid:12085360", - "pmid:12042281", - "pmid:12031042", - "pmid:11956643", - "pmid:11935317", - "pmid:11927493", - "pmid:11894978", - "pmid:11875046", - "pmid:11847524", - "pmid:11810651", - "pmid:11809726", - "pmid:11788641", - "pmid:11721964", - "pmid:11720249", - "pmid:11701709", - "pmid:11600555", - "pmid:11571732", - "pmid:11571725", - "pmid:11550169", - "pmid:11494335", - "pmid:11473958", - "pmid:11443190", - "pmid:11368874", - "pmid:11331662", - "pmid:11330644", - "pmid:11266016", - "pmid:11259089", - "pmid:11167027", - "pmid:11121465", - "pmid:11016637", - "pmid:10999852", - "pmid:10958659", - "pmid:10956560", - "pmid:10852984", - "pmid:10821498", - "pmid:10817350", - "pmid:10794490", - "pmid:10732798", - "pmid:10732754", - "pmid:10717532", - "pmid:10717003", - "pmid:10656235", - "pmid:10643885", - "pmid:10637497", - "pmid:10617922", - "pmid:10574254", - "pmid:10564878", - "pmid:10544298", - "pmid:10486315", - "pmid:10419869", - "pmid:10400640", - "pmid:10323251", - "pmid:10234512", - "pmid:9925917", - "pmid:9886069", - "pmid:9880240", - "pmid:9815849", - "pmid:9813160", - "pmid:9761394", - "pmid:9732460", - "pmid:9731888", - "pmid:9692387", - "pmid:9677254", - "pmid:9580659", - "pmid:9499423", - "pmid:9382110", - "pmid:9270598", - "pmid:9094973", - "pmid:9020849", - "pmid:8960833", - "pmid:8954049", - "pmid:8878435", - "pmid:8737374", - "pmid:8926495", - "pmid:8807333", - "pmid:8645957", - "pmid:7772520", - "pmid:7757084", - "pmid:7719348", - "pmid:8065934", - "pmid:7951325", - "pmid:7515106", - "pmid:8232348", - "pmid:1461383", - "pmid:1734865" - ] - }, - { - "id": "EIEE1_ARX", - "disease_id": "EIEE1", - "gene": "ARX", - "evidence": [ - "Definitive" - ], - "chrom": "chrX", - "start_hg38": 25013649, - "stop_hg38": 25013697, - "start_hg19": 25031766, - "stop_hg19": 25031814, - "start_t2t": 24597886, - "stop_t2t": 24597934, - "disease": "Early-infantile epileptic encephalopathy", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Developmental and epileptic encephalopathy-1 (DEE1) is a severe form of epilepsy characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, characterized by high-voltage bursts alternating with almost flat suppression phases [@omim:308350].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in individuals of multiple ethnicities, including European and Asian ancestry [@pmid:12874418].", - "age_onset": "Typical: 0 [@pmid:21204215; @pmid:9307258]; Range: 0-4; 70% of cases involve infantile spasms, leading to seizures by 3 or 4 years [@pmid:19587282].", - "age_onset_min": 0, - "age_onset_max": 4, - "typ_age_onset_min": 0, - "typ_age_onset_max": 0, - "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", - "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:17668384].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", - "year": "2002 [@pmid:11889467]", - "location_in_gene": "Coding Exon 2, aa 110-115", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 16, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 17, - "pathogenic_max": 27, - "motif_len": 3, - "ref_copies": 14.7, - "novel": "ref", - "gard": [ - "15298" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "ERL057" - ], - "medgen": [ - "483052" - ], - "mondo": [ - "0010632" - ], - "omim": [ - "308350", - "300419", - "300215" - ], - "orphanet": [ - "182079" - ], - "gnomad": [ - "ARX_1" - ], - "stripy": [ - "ARX_1" - ], - "tr_atlas": [ - "TR167317" - ], - "webstr_hg38": [ - "843651" - ], - "webstr_hg19": [ - "STR_1542607" - ], - "locus_tags": [ - "length_affects_phenotype" - ], - "disease_tags": [ - "phenotypic_spectrum" - ], - "references": [ - "pmid:21204215", - "pmid:9307258", - "pmid:19587282", - "pmid:36169768", - "pmid:38467784", - "genereviews:NBK51932", - "genereviews:NBK535148", - "omim:309510", - "omim:308350", - "omim:300004", - "omim:300215", - "pmid:26029707", - "pmid:20506206", - "pmid:12874418", - "pmid:11889467" - ], - "additional_literature": [ - "pmid:40608247", - "pmid:39933386", - "pmid:39123069", - "pmid:36571524", - "pmid:33847015", - "pmid:32033960", - "pmid:28627419", - "pmid:28602636", - "pmid:27798109", - "pmid:26571108", - "pmid:25171319", - "pmid:24236044", - "pmid:23968833", - "pmid:23246292", - "pmid:22628459", - "pmid:22108177", - "pmid:20376468", - "pmid:19018235", - "pmid:18823727", - "pmid:18462864", - "pmid:17668384", - "pmid:17664401", - "pmid:17480217", - "pmid:15533998" - ] - }, - { - "id": "PRTS_ARX", - "disease_id": "PRTS", - "gene": "ARX", - "evidence": [ - "Definitive" - ], - "chrom": "chrX", - "start_hg38": 25013529, - "stop_hg38": 25013565, - "start_hg19": 25031646, - "stop_hg19": 25031682, - "start_t2t": 24597766, - "stop_t2t": 24597802, - "disease": "Partington syndrome", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A rare neurological condition that is primarily characterized by mild to moderate intellectual disability and dystonia of the hands. Other signs and symptoms may include dysarthria, behavioral abnormalities, recurrent seizures and/or an unusual gait (style of walking). Partington syndrome usually occurs in males; when it occurs in females, the signs and symptoms are often less severe. It is caused by changes (mutations) in the ARX gene and is inherited in an X-linked recessive manner. Treatment is based on the signs and symptoms present in each person [@mondo:0010654].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Limited clinical cases of predominantly European ancestry, such as Welsh/Belgian [@omim:309510].", - "age_onset": "Typical: 1-3; Range: 0-4. Mild phenotypes can make diagnosis difficult (expansions are particularly mild/absent in females) [@omim:309510].", - "age_onset_min": 0, - "age_onset_max": 4, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:300215], described in the literature [@pmid:26029707; @pmid:20506206].", - "detection": "Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:11889467].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mis-localisation of mutant protein, increased with expansion length [@genereviews:NBK51932].", - "year": "2002 [@pmid:11889467]", - "location_in_gene": "Coding Exon 2, aa 144-155", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 12, - "benign_max": 12, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 20, - "pathogenic_max": 20, - "motif_len": 3, - "ref_copies": 12, - "novel": "ref", - "gard": [ - "4235" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "PRT003" - ], - "medgen": [ - "163237" - ], - "mondo": [ - "0010654" - ], - "omim": [ - "309510" - ], - "orphanet": [ - "94083" - ], - "gnomad": [ - "ARX_2" - ], - "stripy": [ - "ARX_2" - ], - "tr_atlas": [ - "TR167316" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [ - "length_affects_phenotype" - ], - "disease_tags": [ - "phenotypic_spectrum" - ], - "references": [ - "omim:309510", - "pmid:36169768", - "pmid:38467784", - "genereviews:NBK51932", - "genereviews:NBK535148", - "omim:308350", - "omim:300004", - "omim:300215", - "pmid:26029707", - "pmid:20506206", - "pmid:11889467", - "mondo:0010654" - ], - "additional_literature": [ - "pmid:40608247", - "pmid:39933386", - "pmid:39123069", - "pmid:36571524", - "pmid:33847015", - "pmid:32033960", - "pmid:28627419", - "pmid:28602636", - "pmid:27798109", - "pmid:26571108", - "pmid:25171319", - "pmid:24236044", - "pmid:23968833", - "pmid:23246292", - "pmid:22628459", - "pmid:22108177", - "pmid:21204215", - "pmid:20376468", - "pmid:19587282", - "pmid:19018235", - "pmid:18823727", - "pmid:18462864", - "pmid:17668384", - "pmid:17664401", - "pmid:17480217", - "pmid:15533998", - "pmid:12874418" - ] - }, - { - "id": "DRPLA_ATN1", - "disease_id": "DRPLA", - "gene": "ATN1", - "evidence": [ - "Definitive" - ], - "chrom": "chr12", - "start_hg38": 6936716, - "stop_hg38": 6936775, - "start_hg19": 7045879, - "stop_hg19": 7045938, - "start_t2t": 6947903, - "stop_t2t": 6947941, - "disease": "Dentatorubral-Pallidoluysian Atrophy", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Dentatorubral pallidoluysian atrophy (DRPLA) is a rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by involuntary movements, ataxia, epilepsy, mental disorders, cognitive decline and prominent anticipation [@mondo:0007435]. Epilepsy is common in earlier onset cases [@pmid:41147955].", - "hpo_terms": null, - "prevalence": "4.5/1000000", - "prevalence_details": "2-7/1,000,000. More prevalent in Japanese populations; also reported in North America, South America, Europe, and Australia [@genereviews:NBK1491].", - "age_onset": "Typical: 20-40 [@pmid:6808417; @genereviews:NBK1491]. Range: 0 [@pmid:11160976] - 72 [@genereviews:NBK1491].", - "age_onset_min": 0, - "age_onset_max": 72, - "typ_age_onset_min": 20, - "typ_age_onset_max": 40, - "details": "Pathogenic expansions (48-93) are fully penetrant with the exception of one documented case of 51 repeats; intermediate alleles (36-47) are associated with a milder phenotype and can expand upon transmission [@genereviews:NBK1491]. CAA interruptions have been observed without known clinical association [@pmid:35245110]. Length of the repeat is inversely associated with age of onset and severe epilepsy phenotype [@pmid:41147955].", - "detection": "PCR fragment analysis has detected most moderate alleles, but Southern blotting or RP-PCR have been used in cases of large expansions or when PCR shows an apparently homozygous small allele, to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1491].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansions leading to gain of function [@genereviews:NBK1491].", - "year": "1994 [@pmid:7842016]", - "location_in_gene": "Coding Exon 5", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 35, - "intermediate_min": 36, - "intermediate_max": 47, - "pathogenic_min": 48, - "pathogenic_max": 93, - "motif_len": 3, - "ref_copies": 19, - "novel": "ref", - "gard": [ - "5643" - ], - "genereviews": [ - "NBK1491" - ], - "malacard": [ - "DNT005" - ], - "medgen": [ - "155630" - ], - "mondo": [ - "0007435" - ], - "omim": [ - "125370" - ], - "orphanet": [ - "101" - ], - "gnomad": [ - "ATN1" - ], - "stripy": [ - "ATN1" - ], - "tr_atlas": [ - "TR114246" - ], - "webstr_hg38": [ - "5050156" - ], - "webstr_hg19": [ - "Expansion_ATN1/DRPLA" - ], - "locus_tags": [ - "anticipation", - "somatic_instability", - "paternal_expansion", - "length_affects_onset", - "length_affects_severity", - "length_affects_phenotype" - ], - "disease_tags": [ - "ataxia", - "epilepsy" - ], - "references": [ - "pmid:6808417", - "genereviews:NBK1491", - "pmid:11160976", - "pmid:35245110", - "pmid:41147955", - "pmid:7842016", - "mondo:0007435" - ], - "additional_literature": [ - "pmid:42196324", - "pmid:41624332", - "pmid:41355374", - "pmid:41254939", - "pmid:41082794", - "pmid:40832356", - "pmid:40488180", - "pmid:40450087", - "pmid:40340521", - "pmid:40298952", - "pmid:40263757", - "pmid:40237283", - "pmid:39820777", - "pmid:39812846", - "pmid:39742457", - "pmid:39224955", - "pmid:38961870", - "pmid:38227102", - "pmid:38152578", - "pmid:37243799", - "pmid:36599645", - "pmid:36530930", - "pmid:35182509", - "pmid:34968706", - "pmid:34022586", - "pmid:33106889", - "pmid:32711193", - "pmid:32675418", - "pmid:32129252", - "pmid:31493762", - "pmid:30891880", - "pmid:30827498", - "pmid:30615214", - "pmid:30314815", - "pmid:30120431", - "pmid:29801887", - "pmid:29715545", - "pmid:29249939", - "pmid:28782341", - "pmid:28585930", - "pmid:27896316", - "pmid:27400454", - "pmid:26374734", - "pmid:26077168", - "pmid:25842919", - "pmid:25466696", - "pmid:24972706", - "pmid:24534762", - "pmid:23933208", - "pmid:23364790", - "pmid:23263592", - "pmid:23026538", - "pmid:22527233", - "pmid:22520093", - "pmid:22342974", - "pmid:22297462", - "pmid:21108634", - "pmid:20589872", - "pmid:19429075", - "pmid:19370769", - "pmid:19259763", - "pmid:19039037", - "pmid:18182848", - "pmid:17965145", - "pmid:17961920", - "pmid:17420317", - "pmid:16967484", - "pmid:16858508", - "pmid:16251216", - "pmid:16199124", - "pmid:15553088", - "pmid:15223312", - "pmid:15148151", - "pmid:15133824", - "pmid:14756671", - "pmid:12925365", - "pmid:12805114", - "pmid:12764052", - "pmid:12614315", - "pmid:12235319", - "pmid:12042281", - "pmid:11939898", - "pmid:11807410", - "pmid:11711886", - "pmid:11709002", - "pmid:11689158", - "pmid:11574112", - "pmid:11198291", - "pmid:10942107", - "pmid:10894992", - "pmid:10814707", - "pmid:10768629", - "pmid:10766906", - "pmid:10677044", - "pmid:10564878", - "pmid:10515170", - "pmid:10486315", - "pmid:10453742", - "pmid:10332026", - "pmid:10085113", - "pmid:10084125", - "pmid:9949204", - "pmid:9887337", - "pmid:9758625", - "pmid:9705838", - "pmid:9696528", - "pmid:9647693", - "pmid:9613852", - "pmid:9507387", - "pmid:9462738", - "pmid:9385362", - "pmid:9361003", - "pmid:9187480", - "pmid:9124808", - "pmid:9109905", - "pmid:9106530", - "pmid:9050922", - "pmid:9020849", - "pmid:8962095", - "pmid:9001798", - "pmid:8651298", - "pmid:8655136", - "pmid:8780110", - "pmid:8644735", - "pmid:8852663", - "pmid:8926495", - "pmid:8559378", - "pmid:8557266", - "pmid:7633415", - "pmid:7868125", - "pmid:7824105", - "pmid:7885531", - "pmid:8136840", - "pmid:8136826", - "pmid:7734112" - ] - }, - { - "id": "SCA1_ATXN1", - "disease_id": "SCA1", - "gene": "ATXN1", - "evidence": [ - "Definitive" - ], - "chrom": "chr6", - "start_hg38": 16327633, - "stop_hg38": 16327724, - "start_hg19": 16327864, - "stop_hg19": 16327955, - "start_t2t": 16200188, - "stop_t2t": 16200282, - "disease": "Spinocerebellar ataxia type 1", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 1 (SCA1) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by dysarthria, writing difficulties, limb ataxia, and commonly nystagmus and saccadic abnormalities [@mondo:0008119].", - "hpo_terms": null, - "prevalence": "1.5/100000", - "prevalence_details": "1-2/100,000. Cases have been reported worldwide, although prevalence varies by ancestry/ethnicity [@genereviews:NBK1184].", - "age_onset": "Typical: 20-39 [@url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias]; Range: 6 [@pmid:3165612] - 63 [@pmid:8825276].", - "age_onset_min": 6, - "age_onset_max": 63, - "typ_age_onset_min": 20, - "typ_age_onset_max": 39, - "details": "Penetrance is dependent on sequence purity in addition to expansion length: pure repeats are pathogenic at 39 repeats [@pmid:37906407], while CAT interruptions [@pmid:35245110] can lead to reduced penetrance at comparable lengths [@genereviews:NBK1184]. Regardless, intermediate alleles are considered premutations which may lead to disease upon transmission [@genereviews:NBK1184]. CAA interruptions have also been reported, but not linked to any phenotypic consequences [@pmid:23935513].", - "detection": "PCR fragment analysis is commonly used for sizing [@genereviews:NBK1184]. Standard fragment analysis does not resolve CAT interruptions, which require targeted analysis like RP-PCR or Sanger sequencing [@pmid:34635619; @genereviews:NBK1184].", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyglutamine expansion leading to toxic gain of function with eventual misregulation-based loss of function/dominant negative [@genereviews:NBK1184; @pmid:35573049].", - "year": "1993 [@pmid:8358429]", - "location_in_gene": "Coding Exon 8", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CTG" - ], - "pathogenic_motif_reference_orientation": [ - "CTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "ATG", - "TTG" - ], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "ATC", - "AAC" - ], - "locus_structure": [], - "benign_min": 6, - "benign_max": 35, - "intermediate_min": 36, - "intermediate_max": 38, - "pathogenic_min": 39, - "pathogenic_max": 91, - "motif_len": 3, - "ref_copies": 30.3, - "novel": "ref", - "gard": [ - "4071" - ], - "genereviews": [ - "NBK1184" - ], - "malacard": [ - "SPN294" - ], - "medgen": [ - "155703" - ], - "mondo": [ - "0008119" - ], - "omim": [ - "164400" - ], - "orphanet": [ - "98755" - ], - "gnomad": [ - "ATXN1" - ], - "stripy": [ - "ATXN1" - ], - "tr_atlas": [ - "TR63118" - ], - "webstr_hg38": [ - "5767842" - ], - "webstr_hg19": [ - "Expansion_SCA1/ATXN1" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_severity", - "motif_affects_instability", - "motif_affects_onset", - "motif_affects_penetrance", - "motif_affects_severity" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias", - "pmid:3165612", - "pmid:8825276", - "genereviews:NBK1184", - "pmid:35573049", - "pmid:37906407", - "pmid:35245110", - "pmid:23935513", - "pmid:8358429", - "mondo:0008119" - ], - "additional_literature": [ - "pmid:42196324", - "pmid:41727128", - "pmid:41435767", - "pmid:41426430", - "pmid:41254939", - "pmid:41149812", - "pmid:40900235", - "pmid:40488180", - "pmid:40450087", - "pmid:39820777", - "pmid:39456985", - "pmid:39289638", - "pmid:39211226", - "pmid:38961870", - "pmid:38626762", - "pmid:38585669", - "pmid:38308084", - "pmid:38125008", - "pmid:37827155", - "pmid:37776516", - "pmid:37397792", - "pmid:37146135", - "pmid:37043475", - "pmid:36599645", - "pmid:36549973", - "pmid:36291186", - "pmid:35869263", - "pmid:35525134", - "pmid:35182509", - "pmid:34830553", - "pmid:34635619", - "pmid:34600502", - "pmid:34372915", - "pmid:34179866", - "pmid:33502644", - "pmid:33276461", - "pmid:33159825", - "pmid:32954321", - "pmid:32761094", - "pmid:32580238", - "pmid:32339968", - "pmid:31940111", - "pmid:31810584", - "pmid:31645175", - "pmid:30891880", - "pmid:30729852", - "pmid:30615214", - "pmid:30324307", - "pmid:30314815", - "pmid:30120431", - "pmid:30108484", - "pmid:29845242", - "pmid:29656178", - "pmid:29497168", - "pmid:29274668", - "pmid:29249939", - "pmid:29057148", - "pmid:28585930", - "pmid:28444220", - "pmid:26077168", - "pmid:25595967", - "pmid:25344417", - "pmid:25255716", - "pmid:24972706", - "pmid:24594842", - "pmid:24534762", - "pmid:23197749", - "pmid:22884877", - "pmid:18337722", - "pmid:18301861", - "pmid:17961920", - "pmid:17420317", - "pmid:17116127", - "pmid:15300851" - ] - }, - { - "id": "SCA10_ATXN10", - "disease_id": "SCA10", - "gene": "ATXN10", - "evidence": [ - "Definitive" - ], - "chrom": "chr22", - "start_hg38": 45795354, - "stop_hg38": 45795424, - "start_hg19": 46191234, - "stop_hg19": 46191304, - "start_t2t": 46280059, - "stop_t2t": 46280134, - "disease": "Spinocerebellar ataxia type 10", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 10 (SCA10) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by slowly progressive cerebellar syndrome and epilepsy, sometimes mild pyramidal signs, peripheral neuropathy and neuropsychological disturbances [@mondo:0011330].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Unknown prevalence, >300 individuals. Cases have been identified in Mexico, Brazil, China, and Japan [@genereviews:NBK1175].", - "age_onset": "Typical: 12-48; Range: 11-83 [@genereviews:NBK1175].", - "age_onset_min": 11, - "age_onset_max": 83, - "typ_age_onset_min": 12, - "typ_age_onset_max": 48, - "details": "Unaffected individuals are usually (82%) compound heterozygotes in the benign range [@genereviews:NBK1175]. Intermediate alleles show reduced penetrance, and exact distinction between intermediate and the lower end of the pathogenic range is unclear [@genereviews:NBK1175]. Expansions are frequently interrupted by ATCCT, ATCCC, ATTCC, ATTTCT, ATATTCT, or ATTCTTCT; interruptions of ATTGT, TTTCT, ATTTTCT, ATTCTCT, GTTTCT, CTTCT, and ATTCTAT have been noted [@pmid:36199580] as has the interruption ATGCT [@pmid:19234597]. The ATCCT interruption motif is associated with a higher prevalence of epileptic seizures [@pmid:24318420]. Different motif patterns and mixed motif ratios may influence age of onset and anticipation [@pmid:41229449]. One study suggests that alleles with completely pure ATTCT expansions are non-pathogenic, and that repeat interruptions such as ATTCC, are necessary to cause SCA10 [@pmid:36092952].", - "detection": "RP-PCR with fragment analysis is commonly used for detection. Pathogenicity depends heavily on interruptions, so long-read sequencing approaches have been used for full structure resolution [@pmid:26295943; @pmid:32160188].", - "mechanism": "GoF", - "mechanism_detail": "Transdominant mechanism theorized [@pmid:38467784].", - "year": "2000 [@pmid:11017075]", - "location_in_gene": "Intron 9", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "ATTCT" - ], - "pathogenic_motif_reference_orientation": [ - "ATTCT" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "ATCCT", - "ATCCC", - "ATTCC", - "ATTTCT", - "ATATTCT", - "ATTCTTCT", - "ATTGT", - "TTTCT", - "ATTTTCT", - "ATTCTCT", - "GTTTCT", - "CTTCT", - "ATGCT" - ], - "pathogenic_motif_gene_orientation": [ - "ATTCT" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "ATCCT", - "ATCCC", - "ATTCC", - "ATTTCT", - "ATATTCT", - "ATTCTTCT", - "ATTGT", - "CTTTT", - "ATTTTCT", - "ATTCTCT", - "CTGTTT", - "CTCTT", - "ATGCT" - ], - "locus_structure": [], - "benign_min": 10, - "benign_max": 32, - "intermediate_min": 33, - "intermediate_max": 850, - "pathogenic_min": 800, - "pathogenic_max": 4500, - "motif_len": 5, - "ref_copies": 14, - "novel": "ref", - "gard": [ - "10474" - ], - "genereviews": [ - "NBK1175" - ], - "malacard": [ - "SPN314" - ], - "medgen": [ - "369786" - ], - "mondo": [ - "0011330" - ], - "omim": [ - "603516" - ], - "orphanet": [ - "98761" - ], - "gnomad": [ - "ATXN10" - ], - "stripy": [ - "ATXN10" - ], - "tr_atlas": [ - "TR165509" - ], - "webstr_hg38": [ - "1027359", - "4921433" - ], - "webstr_hg19": [ - "STR_909210" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_phenotype", - "motif_affects_instability", - "motif_affects_penetrance", - "motif_affects_phenotype" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK1175", - "pmid:38467784", - "pmid:36199580", - "pmid:19234597", - "pmid:24318420", - "pmid:41229449", - "pmid:36092952", - "pmid:11017075", - "mondo:0011330" - ], - "additional_literature": [ - "pmid:41229449", - "pmid:41074692", - "pmid:40900235", - "pmid:40898875", - "pmid:40488180", - "pmid:40067487", - "pmid:39820777", - "pmid:38961870", - "pmid:38832639", - "pmid:35103298", - "pmid:34970537", - "pmid:33502644", - "pmid:32520333", - "pmid:32160188", - "pmid:31737797", - "pmid:31445906", - "pmid:31342269", - "pmid:29922950", - "pmid:29316893", - "pmid:28890930", - "pmid:28423040", - "pmid:27248057", - "pmid:26374734", - "pmid:26295943", - "pmid:26077168", - "pmid:26039897", - "pmid:25466696", - "pmid:24278426", - "pmid:24269018", - "pmid:23443018", - "pmid:23083689", - "pmid:23026538", - "pmid:22065565", - "pmid:22053702", - "pmid:21282659", - "pmid:20065034", - "pmid:19651850", - "pmid:19306311", - "pmid:19171184", - "pmid:19147916", - "pmid:17961920", - "pmid:17846122", - "pmid:16924013", - "pmid:16498633", - "pmid:16385455", - "pmid:15505178", - "pmid:15201271", - "pmid:15148151", - "pmid:15096564", - "pmid:12764052", - "pmid:12589756", - "pmid:11839840", - "pmid:11160961", - "pmid:9973298" - ] - }, - { - "id": "SCA2_ATXN2", - "disease_id": "SCA2", - "gene": "ATXN2", - "evidence": [ - "Definitive" - ], - "chrom": "chr12", - "start_hg38": 111598949, - "stop_hg38": 111599019, - "start_hg19": 112036753, - "stop_hg19": 112036823, - "start_t2t": 111575873, - "stop_t2t": 111575940, - "disease": "Spinocerebellar ataxia type 2", - "inheritance": [ - "AD", - "AR" - ], - "association_type": [ - "Mendelian", - "Risk", - "Modifier" - ], - "disease_description": "A subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by truncal ataxia, dysarthria, slowed saccades and less commonly ophthalmoparesis and chorea [@mondo:0008458].", - "hpo_terms": null, - "prevalence": "1.5/100000", - "prevalence_details": "1-2/100,000 (population-dependent) [@pmid:29100084]. Cases have been found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1275].", - "age_onset": "Typical: 30-39 [@genereviews:NBK1275]; Range: 2-86 [@omim:183090].", - "age_onset_min": 2, - "age_onset_max": 86, - "typ_age_onset_min": 30, - "typ_age_onset_max": 39, - "details": "Full penetrance of single alleles occurs at ~35 repeats [@genereviews:NBK1275; @pmid:37906407] and pathogenic expansions have been documented as large as 500 repeats [@pmid:12116207]. 33-34 length repeats are associated with reduced penetrance and later onset (age >50 years) [@genereviews:NBK1275]. Homozygous 31 repeat alleles may lead to recessive disease [@pmid:30533529], while a single 29-32 repeat is associated with increased ALS risk [@genereviews:NBK1275; @pmid:25285812; @pmid:32954321]. There is some evidence that all CAG-repeat expansions in ATXN2 may be a risk factor for ALS, regardless of length and interruptions [@pmid:39956874]. CAA interruptions have been observed which appear to stabilize the allele in transmission [@genereviews:NBK1275].", - "detection": "RP-PCR with fragment analysis is commonly used for detection, while Southern blotting is required to estimate size over 100 repeats [@genereviews:NBK1275].", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyglutamine cytoplasmic aggregates leading to cellular apoptosis; RAN translation implicated [@genereviews:NBK1275].", - "year": "1996 [@pmid:8896556]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CTG" - ], - "pathogenic_motif_reference_orientation": [ - "CTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "TTG" - ], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AAC" - ], - "locus_structure": [], - "benign_min": 14, - "benign_max": 28, - "intermediate_min": 29, - "intermediate_max": 34, - "pathogenic_min": 35, - "pathogenic_max": 500, - "motif_len": 3, - "ref_copies": 23.3, - "novel": "ref", - "gard": [ - "4072" - ], - "genereviews": [ - "NBK1275" - ], - "malacard": [ - "SPN301" - ], - "medgen": [ - "155704" - ], - "mondo": [ - "0008458" - ], - "omim": [ - "183090" - ], - "orphanet": [ - "98756" - ], - "gnomad": [ - "ATXN2" - ], - "stripy": [ - "ATXN2" - ], - "tr_atlas": [ - "TR120465" - ], - "webstr_hg38": [ - "598560", - "5117050" - ], - "webstr_hg19": [ - "Expansion_SCA2/ATXN2" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "maternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_phenotype", - "length_affects_severity", - "motif_affects_instability", - "motif_affects_phenotype", - "proposed_modifier" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK1275", - "omim:183090", - "pmid:37906407", - "pmid:12116207", - "pmid:30533529", - "pmid:25285812", - "pmid:32954321", - "pmid:39956874", - "pmid:29100084", - "pmid:8896556", - "mondo:0008458" - ], - "additional_literature": [ - "pmid:42204920", - "pmid:42196324", - "pmid:42096001", - "pmid:42087256", - "pmid:42019185", - "pmid:41912844", - "pmid:41876820", - "pmid:41771688", - "pmid:41728197", - "pmid:41693683", - "pmid:41683965", - "pmid:41630926", - "pmid:41435767", - "pmid:41426430", - "pmid:41373690", - "pmid:41359433", - "pmid:41310328", - "pmid:41298695", - "pmid:41196070", - "pmid:41149812", - "pmid:41082794", - "pmid:41077586", - "pmid:41071260", - "pmid:41009775", - "pmid:41001200", - "pmid:40908144", - "pmid:40906330", - "pmid:40900235", - "pmid:40746751", - "pmid:40684213", - "pmid:40556342", - "pmid:40488180", - "pmid:40346885", - "pmid:40220918", - "pmid:40004498", - "pmid:39940702", - "pmid:39820777", - "pmid:39812846", - "pmid:39804470", - "pmid:39571249", - "pmid:39521966", - "pmid:39512795", - "pmid:39457708", - "pmid:39420034", - "pmid:39317855", - "pmid:39209824", - "pmid:39200113", - "pmid:39048885", - "pmid:39004246", - "pmid:38961870", - "pmid:38715656", - "pmid:38667292", - "pmid:38642323", - "pmid:38626762", - "pmid:38585669", - "pmid:38419144", - "pmid:38397958", - "pmid:38340219", - "pmid:38239855", - "pmid:38227102", - "pmid:38165578", - "pmid:38152578", - "pmid:37848721", - "pmid:37821389", - "pmid:37397792", - "pmid:37379724", - "pmid:37202167", - "pmid:37146135", - "pmid:37070044", - "pmid:37043475", - "pmid:37003406", - "pmid:36894829", - "pmid:36823368", - "pmid:36618024", - "pmid:36530930", - "pmid:36209056", - "pmid:36008116", - "pmid:35989899", - "pmid:35962273", - "pmid:35869263", - "pmid:35787375", - "pmid:35599735", - "pmid:35525134", - "pmid:35521889", - "pmid:35297556", - "pmid:35188716", - "pmid:35182509", - "pmid:35052497", - "pmid:34565721", - "pmid:34430069", - "pmid:34390268", - "pmid:34372915", - "pmid:34350994", - "pmid:34298214", - "pmid:34284285", - "pmid:34179866", - "pmid:34168085", - "pmid:34159894", - "pmid:34077532", - "pmid:33688396", - "pmid:33625581", - "pmid:33548146", - "pmid:33502644", - "pmid:33414559", - "pmid:33377399", - "pmid:33284045", - "pmid:33159825", - "pmid:33115537", - "pmid:33070405", - "pmid:33058338", - "pmid:33029780", - "pmid:32989102", - "pmid:32932600", - "pmid:32870233", - "pmid:32822634", - "pmid:32340607", - "pmid:32307524", - "pmid:32124191", - "pmid:32082115", - "pmid:31940111", - "pmid:31898278", - "pmid:31812845", - "pmid:31810584", - "pmid:31766565", - "pmid:31619481", - "pmid:31522753", - "pmid:31432357", - "pmid:31343735", - "pmid:30920184", - "pmid:30891880", - "pmid:30847648", - "pmid:30615214", - "pmid:30611021", - "pmid:30591349", - "pmid:30417124", - "pmid:30342765", - "pmid:30342763", - "pmid:30314815", - "pmid:30196130", - "pmid:30123518", - "pmid:30120431", - "pmid:29959555", - "pmid:29934271", - "pmid:29895397", - "pmid:29848387", - "pmid:29801887", - "pmid:29801076", - "pmid:29756284", - "pmid:29715545", - "pmid:29666341", - "pmid:29665996", - "pmid:29553382", - "pmid:29497168", - "pmid:29468174", - "pmid:29462666", - "pmid:29249939", - "pmid:29080331", - "pmid:29057148", - "pmid:29046994", - "pmid:28923333", - "pmid:28782341", - "pmid:28642336", - "pmid:28585930", - "pmid:28534046", - "pmid:30363439", - "pmid:28527524", - "pmid:28525545", - "pmid:28444220", - "pmid:28263872", - "pmid:28124431", - "pmid:28017238", - "pmid:27896316", - "pmid:27848087", - "pmid:27774050", - "pmid:27531668", - "pmid:27333979", - "pmid:27245636", - "pmid:26846400", - "pmid:26777436", - "pmid:26733254", - "pmid:26599997", - "pmid:26551617", - "pmid:26377379", - "pmid:26374734", - "pmid:26362908", - "pmid:26354989", - "pmid:26095883", - "pmid:26086378", - "pmid:26077168", - "pmid:26054379", - "pmid:25893506", - "pmid:25790475", - "pmid:25721894", - "pmid:25634432", - "pmid:25527265", - "pmid:25466696", - "pmid:25189938", - "pmid:25189117", - "pmid:25111021", - "pmid:25098532", - "pmid:24972706", - "pmid:24908169", - "pmid:24866401", - "pmid:24780882", - "pmid:24780439", - "pmid:24718895", - "pmid:24534762", - "pmid:24269018", - "pmid:24209901", - "pmid:23959108", - "pmid:23844332", - "pmid:23635656", - "pmid:23634774", - "pmid:23368522", - "pmid:23197749", - "pmid:23047744", - "pmid:23026538", - "pmid:22868089", - "pmid:22831947", - "pmid:22650353", - "pmid:22520093", - "pmid:22507827", - "pmid:22425256", - "pmid:22297462", - "pmid:22053702", - "pmid:22035589", - "pmid:21889984", - "pmid:21880993", - "pmid:21832228", - "pmid:21741123", - "pmid:21610160", - "pmid:21600833", - "pmid:21562247", - "pmid:21537950", - "pmid:21479228", - "pmid:21329459", - "pmid:20960485", - "pmid:20740007", - "pmid:20095980", - "pmid:20070987", - "pmid:20069235", - "pmid:22353486", - "pmid:19676102", - "pmid:19672991", - "pmid:19473475", - "pmid:19429075", - "pmid:19049837", - "pmid:18990604", - "pmid:18759344", - "pmid:18685131", - "pmid:18418678", - "pmid:18297329", - "pmid:18182848", - "pmid:18028243", - "pmid:17961920", - "pmid:17923635", - "pmid:17712857", - "pmid:17620498", - "pmid:17568014", - "pmid:17440947", - "pmid:17420317", - "pmid:16687213", - "pmid:16436644", - "pmid:16389595", - "pmid:16000334", - "pmid:15911147", - "pmid:15747371", - "pmid:22473187", - "pmid:15553088", - "pmid:15533937", - "pmid:15504570", - "pmid:15300851", - "pmid:15265035", - "pmid:15148151", - "pmid:15133829", - "pmid:15080863", - "pmid:14967767", - "pmid:14966163", - "pmid:14756671", - "pmid:14732617", - "pmid:12853230", - "pmid:12812977", - "pmid:12810491", - "pmid:12764052", - "pmid:12682323", - "pmid:12671950", - "pmid:12614315", - "pmid:12490063", - "pmid:12235319", - "pmid:12039668", - "pmid:11939898", - "pmid:11889231", - "pmid:11839840", - "pmid:11804332", - "pmid:11719273", - "pmid:11689490", - "pmid:11591855", - "pmid:11502947", - "pmid:11448300", - "pmid:11374096", - "pmid:11160961", - "pmid:10369884", - "pmid:11030803", - "pmid:11030410", - "pmid:10953195", - "pmid:10942107", - "pmid:10915763", - "pmid:10894992", - "pmid:10785256", - "pmid:10768629", - "pmid:10766906", - "pmid:10642945", - "pmid:10573020", - "pmid:10525984", - "pmid:10525976", - "pmid:10453742", - "pmid:10219787", - "pmid:10210910", - "pmid:10050970", - "pmid:9973298", - "pmid:9855520", - "pmid:9779806", - "pmid:9776463", - "pmid:9762957", - "pmid:9758625", - "pmid:9748675", - "pmid:9741408", - "pmid:9710044", - "pmid:9696528", - "pmid:9674805", - "pmid:9613852", - "pmid:9588855", - "pmid:9577387", - "pmid:9549522", - "pmid:9507387", - "pmid:9436730", - "pmid:9385362", - "pmid:9403486", - "pmid:9403480", - "pmid:9339711", - "pmid:9339681", - "pmid:9259275", - "pmid:9225982", - "pmid:10735276", - "pmid:9106530", - "pmid:9020849", - "pmid:10464657", - "pmid:8968739", - "pmid:8896557", - "pmid:8896555", - "pmid:8559378", - "pmid:7477379", - "pmid:7762567" - ] - }, - { - "id": "SCA3_ATXN3", - "disease_id": "SCA3, MJD", - "gene": "ATXN3", - "evidence": [ - "Definitive" - ], - "chrom": "chr14", - "start_hg38": 92071010, - "stop_hg38": 92071052, - "start_hg19": 92537354, - "stop_hg19": 92537396, - "start_t2t": 86300519, - "stop_t2t": 86300603, - "disease": "Spinocerebellar ataxia type 3/Machado-Joseph disease", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease, is the most common subtype of type 1 autosomal dominant cerebellar ataxia (ADCA type 1), a neurodegenerative disorder, and is characterized by ataxia, external progressive ophthalmoplegia, and other neurological manifestations [@mondo:0007182]. Research suggests that length of ATXN2 expansions may affect the phenotype of SCA3 [@pmid:40684213].", - "hpo_terms": null, - "prevalence": "2.1/100000", - "prevalence_details": "1-5/100,000 [@pmid:29100084]. Most prevalent SCA subtype [@genereviews:NBK557816]. Found worldwide across ancestries/ethnicities [@genereviews:NBK1196].", - "age_onset": "Typical: 10-49 [@genereviews:NBK1196]; 3 [@pmid:40004498] - 73 [@genereviews:NBK1196; @pmid:30414314].", - "age_onset_min": 3, - "age_onset_max": 73, - "typ_age_onset_min": 10, - "typ_age_onset_max": 49, - "details": "Benign alleles range from 11-44 repeats [@pmid:37906407], with intermediate alleles (45-59) associated with incomplete penetrance and non-classic phenotypes [@genereviews:NBK1196]. The threshold between incomplete and full penetrance is unclear, but presumed to occur at ~60 repeats [@genereviews:NBK1196; @pmid:37906407]. The interruption CAA has been observed [@pmid:35245110]; AAG is present in hg38 reference sequence. The APOE ε4 allele appears to act as a disease modifier [@pmid:39731318]; GLS expansions may also function as disease modifiers [@pmid:39699045].", - "detection": "PCR fragment analysis or RP-PCR typically detect expansions, but homozygous PCR results may require Southern blotting to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1196]. Long-read sequencing can characterize full structure [@pmid:40890629].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to gain of function; aggregated and mislocalized proteins in neurons [@pmid:36169768; @genereviews:NBK1196].", - "year": "1994 [@pmid:7874163]", - "location_in_gene": "Coding Exon 10", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CTG" - ], - "pathogenic_motif_reference_orientation": [ - "CTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "TTG", - "AGG" - ], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AAC", - "CCT" - ], - "locus_structure": [], - "benign_min": 11, - "benign_max": 44, - "intermediate_min": 45, - "intermediate_max": 59, - "pathogenic_min": 60, - "pathogenic_max": 87, - "motif_len": 3, - "ref_copies": 14, - "novel": "ref", - "gard": [ - "6801" - ], - "genereviews": [ - "NBK1196" - ], - "malacard": [ - "MCH002" - ], - "medgen": [ - "9841" - ], - "mondo": [ - "0007182" - ], - "omim": [ - "109150" - ], - "orphanet": [ - "98757" - ], - "gnomad": [ - "ATXN3" - ], - "stripy": [ - "ATXN3" - ], - "tr_atlas": [ - "TR132758" - ], - "webstr_hg38": [ - "5316666", - "1481402" - ], - "webstr_hg19": [ - "Expansion_SCA3_MJD/ATXN3" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "maternal_expansion", - "length_affects_onset", - "length_affects_phenotype", - "length_affects_severity" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK1196", - "pmid:40004498", - "pmid:30414314", - "pmid:36169768", - "pmid:37906407", - "pmid:35245110", - "pmid:39731318", - "pmid:39699045", - "pmid:29100084", - "genereviews:NBK557816", - "pmid:7874163", - "mondo:0007182", - "pmid:40684213" - ], - "additional_literature": [ - "pmid:42191105", - "pmid:42105168", - "pmid:42096001", - "pmid:41854058", - "pmid:41853947", - "pmid:41818480", - "pmid:41771688", - "pmid:41736717", - "pmid:41713739", - "pmid:41701293", - "pmid:41613623", - "pmid:41612618", - "pmid:41552385", - "pmid:41435767", - "pmid:41358280", - "pmid:41082794", - "pmid:41058593", - "pmid:41009775", - "pmid:41001200", - "pmid:40906330", - "pmid:40900235", - "pmid:40890629", - "pmid:40880681", - "pmid:40797466", - "pmid:40754098", - "pmid:40738252", - "pmid:40692435", - "pmid:40635703", - "pmid:40488202", - "pmid:40488180", - "pmid:40450087", - "pmid:40204795", - "pmid:40178277", - "pmid:40152810", - "pmid:39987589", - "pmid:39921113", - "pmid:39820777", - "pmid:39571249", - "pmid:39516744", - "pmid:39456985", - "pmid:39375222", - "pmid:39317855", - "pmid:39298485", - "pmid:39229124", - "pmid:39125643", - "pmid:39088078", - "pmid:39048885", - "pmid:38961870", - "pmid:38900277", - "pmid:38626762", - "pmid:38513302", - "pmid:38449714", - "pmid:38443995", - "pmid:38429929", - "pmid:38291334", - "pmid:38227102", - "pmid:38165578", - "pmid:38152578", - "pmid:37961108", - "pmid:37866221", - "pmid:37848721", - "pmid:37830620", - "pmid:37830611", - "pmid:37735371", - "pmid:37397792", - "pmid:37379724", - "pmid:37333326", - "pmid:37215811", - "pmid:37122622", - "pmid:37003406", - "pmid:36907537", - "pmid:36891289", - "pmid:36875652", - "pmid:36733922", - "pmid:36618024", - "pmid:36530930", - "pmid:36482247", - "pmid:36250694", - "pmid:35997830", - "pmid:35962273", - "pmid:35952620", - "pmid:35851059", - "pmid:35847233", - "pmid:35426475", - "pmid:35421843", - "pmid:35406787", - "pmid:35188716", - "pmid:35182509", - "pmid:35052497", - "pmid:35042771", - "pmid:34783886", - "pmid:34716557", - "pmid:34706018", - "pmid:34565721", - "pmid:34473252", - "pmid:34430069", - "pmid:34284285", - "pmid:34191270", - "pmid:34167352", - "pmid:34160773", - "pmid:34159894", - "pmid:34087977", - "pmid:33893204", - "pmid:33782863", - "pmid:33743045", - "pmid:33502644", - "pmid:33468086", - "pmid:33413375", - "pmid:33371889", - "pmid:33159825", - "pmid:33157084", - "pmid:33087504", - "pmid:33058338", - "pmid:32978817", - "pmid:32822634", - "pmid:32729243", - "pmid:32205441", - "pmid:31934455", - "pmid:31920494", - "pmid:31783119", - "pmid:31687087", - "pmid:31616370", - "pmid:31565539", - "pmid:31394429", - "pmid:31374463", - "pmid:31310802", - "pmid:31230722", - "pmid:30920184", - "pmid:30891880", - "pmid:30833927", - "pmid:30804982", - "pmid:30685895", - "pmid:30615214", - "pmid:30591349", - "pmid:30554804", - "pmid:30314815", - "pmid:30231063", - "pmid:30125433", - "pmid:30120431", - "pmid:30008965", - "pmid:29959555", - "pmid:29936336", - "pmid:29922950", - "pmid:29881950", - "pmid:29852360", - "pmid:29801869", - "pmid:29737427", - "pmid:29666341", - "pmid:29553382", - "pmid:29497168", - "pmid:29444500", - "pmid:29249939", - "pmid:29057148", - "pmid:28854700", - "pmid:28782341", - "pmid:28624196", - "pmid:28585930", - "pmid:28444220", - "pmid:28158474", - "pmid:28065793", - "pmid:27942452", - "pmid:27896316", - "pmid:27848087", - "pmid:27847820", - "pmid:27596958", - "pmid:27774050", - "pmid:27731380", - "pmid:27600091", - "pmid:27333979", - "pmid:26615955", - "pmid:26601773", - "pmid:26505994", - "pmid:26467707", - "pmid:26377379", - "pmid:26374734", - "pmid:26362908", - "pmid:26354989", - "pmid:26336829", - "pmid:26266536", - "pmid:26083476", - "pmid:26077168", - "pmid:26067219", - "pmid:26054379", - "pmid:30363545", - "pmid:25700012", - "pmid:25634432", - "pmid:25633985", - "pmid:25590633", - "pmid:25466696", - "pmid:25320121", - "pmid:25144244", - "pmid:25143392", - "pmid:25068645", - "pmid:25026993", - "pmid:24972706", - "pmid:24780882", - "pmid:24746364", - "pmid:24675225", - "pmid:24534762", - "pmid:24525517", - "pmid:24242192", - "pmid:23844332", - "pmid:23775343", - "pmid:23659897", - "pmid:23423669", - "pmid:23413156", - "pmid:23382971", - "pmid:23368522", - "pmid:23026538", - "pmid:22520093", - "pmid:22351852", - "pmid:22297462", - "pmid:22090366", - "pmid:22023810", - "pmid:21975858", - "pmid:21889984", - "pmid:21832228", - "pmid:21795378", - "pmid:21780213", - "pmid:21625753", - "pmid:21600833", - "pmid:21506152", - "pmid:20726892", - "pmid:20503052", - "pmid:20484674", - "pmid:20467850", - "pmid:20334689", - "pmid:20069235", - "pmid:22353486", - "pmid:19802879", - "pmid:19699305", - "pmid:19672991", - "pmid:19631275", - "pmid:19608203", - "pmid:19597981", - "pmid:19503814", - "pmid:19412185", - "pmid:19049837", - "pmid:18990604", - "pmid:18759344", - "pmid:18685131", - "pmid:18506570", - "pmid:18449188", - "pmid:18418678", - "pmid:18413477", - "pmid:18385100", - "pmid:18261802", - "pmid:18182848", - "pmid:18071041", - "pmid:18028243", - "pmid:17961920", - "pmid:17948873", - "pmid:17712857", - "pmid:17594286", - "pmid:17440947", - "pmid:17420317", - "pmid:17116127", - "pmid:17027034", - "pmid:16967484", - "pmid:16791428", - "pmid:16724006", - "pmid:16687213", - "pmid:16389595", - "pmid:16340213", - "pmid:16241973", - "pmid:15911147", - "pmid:15747371", - "pmid:22473187", - "pmid:15553088", - "pmid:15534186", - "pmid:15504352", - "pmid:15265035", - "pmid:15223312", - "pmid:15201448", - "pmid:15167689", - "pmid:15148151", - "pmid:15080863", - "pmid:15026782", - "pmid:14966163", - "pmid:14756671", - "pmid:14679302", - "pmid:14616293", - "pmid:12938149", - "pmid:12853230", - "pmid:12832059", - "pmid:12810491", - "pmid:12764052", - "pmid:12614315", - "pmid:12486728", - "pmid:12433269", - "pmid:12235319", - "pmid:12042281", - "pmid:12007862", - "pmid:11978767", - "pmid:11889231", - "pmid:11839840", - "pmid:11807410", - "pmid:11804332", - "pmid:11559318", - "pmid:11448300", - "pmid:11466410", - "pmid:11409435", - "pmid:11405804", - "pmid:11374096", - "pmid:11160961", - "pmid:10369884", - "pmid:11030803", - "pmid:11030410", - "pmid:10942107", - "pmid:10915763", - "pmid:10894992", - "pmid:10855623", - "pmid:10785256", - "pmid:10768629", - "pmid:10766906", - "pmid:10732811", - "pmid:10717003", - "pmid:10575843", - "pmid:10525976", - "pmid:10453742", - "pmid:10433966", - "pmid:10072437", - "pmid:10071104", - "pmid:9973298", - "pmid:9855520", - "pmid:9762957", - "pmid:9758625", - "pmid:9696528", - "pmid:9674805", - "pmid:9635424", - "pmid:9613852", - "pmid:9536097", - "pmid:9588850", - "pmid:9577387", - "pmid:9562258", - "pmid:9549522", - "pmid:9532283", - "pmid:9469848", - "pmid:9507387", - "pmid:9506544", - "pmid:9415538", - "pmid:9450899", - "pmid:9436730", - "pmid:9385362", - "pmid:9371900", - "pmid:9403486", - "pmid:9403480", - "pmid:9339702", - "pmid:9339681", - "pmid:9292723", - "pmid:9259275", - "pmid:9254842", - "pmid:9225982", - "pmid:9215676", - "pmid:10735276", - "pmid:9124808", - "pmid:9106530", - "pmid:9132496", - "pmid:9020849", - "pmid:10464657", - "pmid:9401013", - "pmid:8962095", - "pmid:9088110", - "pmid:8968739", - "pmid:8931692", - "pmid:8937340", - "pmid:8836972", - "pmid:8659514", - "pmid:8609925", - "pmid:8655136", - "pmid:8780110", - "pmid:8644735", - "pmid:8815156", - "pmid:8824876", - "pmid:8926495", - "pmid:8900536", - "pmid:8800925", - "pmid:8559378", - "pmid:8559377", - "pmid:8583215", - "pmid:7574470", - "pmid:7573040", - "pmid:7496771", - "pmid:8523034", - "pmid:7668288", - "pmid:7611296", - "pmid:7762567", - "pmid:7655453", - "pmid:7633439" - ] - }, - { - "id": "SCA7_ATXN7", - "disease_id": "SCA7", - "gene": "ATXN7", - "evidence": [ - "Definitive" - ], - "chrom": "chr3", - "start_hg38": 63912684, - "stop_hg38": 63912715, - "start_hg19": 63898360, - "stop_hg19": 63898391, - "start_t2t": 63956302, - "stop_t2t": 63956333, - "disease": "Spinocerebellar ataxia type 7", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia-7 (SCA7) is an autosomal dominant neurodegenerative disorder characterized by adult onset of progressive cerebellar ataxia associated with pigmental macular dystrophy [@omim:164500].", - "hpo_terms": null, - "prevalence": "0.999/300000", - "prevalence_details": "<1/300,000: predominantly found in those with North European and African ancestry [@genereviews:NBK1256].", - "age_onset": "Typical: 4-48 [@pmid:20739808]; Range: 0-90 [@genereviews:NBK1256; @pmid:14571264].", - "age_onset_min": 0, - "age_onset_max": 65, - "typ_age_onset_min": 4, - "typ_age_onset_max": 48, - "details": "Benign alleles range from 4-27 [@pmid:37906407], with intermediate alleles ranging from premutations (28-33) to reduced penetrance (34-36) [@genereviews:NBK1256]. Interruptions observed include CAA [@pmid:35245110].", - "detection": "Short-read WGS cannot accurately detect repeat expansions at this locus. PCR fragment analysis or RP-PCR has detected expansions and sized most normal or moderate pathogenic alleles, while very large expansions have been detected with Southern blotting or long-read sequencing [@genereviews:NBK1256].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to gain of function; toxic misfolded intermediated suspected [@genereviews:NBK1256; @pmid:18418675].", - "year": "1996 [@pmid:8908515]", - "location_in_gene": "Coding Exon 1, 2, or 3 (depending on isoform)", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "CAG", - "count": null, - "type": "pathogenic_repeat" - }, - { - "motif": "CCG", - "count": 4, - "type": "flank_repeat" - } - ], - "benign_min": 4, - "benign_max": 27, - "intermediate_min": 28, - "intermediate_max": 35, - "pathogenic_min": 37, - "pathogenic_max": 460, - "motif_len": 3, - "ref_copies": 10.7, - "novel": "ref", - "gard": [ - "20405" - ], - "genereviews": [ - "NBK1256" - ], - "malacard": [ - "SPN291" - ], - "medgen": [ - "156006" - ], - "mondo": [ - "0016163" - ], - "omim": [ - "164500" - ], - "orphanet": [ - "94147" - ], - "gnomad": [ - "ATXN7" - ], - "stripy": [ - "ATXN7" - ], - "tr_atlas": [ - "TR31879", - "TR31880" - ], - "webstr_hg38": [ - "4965588" - ], - "webstr_hg19": [ - "Expansion_SCA7/ATXN7" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_phenotype", - "length_affects_severity" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "pmid:20739808", - "genereviews:NBK1256", - "pmid:14571264", - "pmid:18418675", - "pmid:37906407", - "pmid:35245110", - "pmid:8908515", - "omim:164500" - ], - "additional_literature": [ - "pmid:41771688", - "pmid:41254939", - "pmid:40900235", - "pmid:40488180", - "pmid:40417743", - "pmid:39820777", - "pmid:39649105", - "pmid:39571249", - "pmid:39504355", - "pmid:39317855", - "pmid:39053472", - "pmid:38961870", - "pmid:38906973", - "pmid:38851031", - "pmid:38673939", - "pmid:38626762", - "pmid:38227102", - "pmid:38165578", - "pmid:38152578", - "pmid:38045332", - "pmid:37986914", - "pmid:37848721", - "pmid:37283503", - "pmid:37214832", - "pmid:36618024", - "pmid:36530930", - "pmid:35422034", - "pmid:35182509", - "pmid:35052497", - "pmid:34870541", - "pmid:34565721", - "pmid:34160002", - "pmid:34159894", - "pmid:33995769", - "pmid:33626063", - "pmid:32138195", - "pmid:31694722", - "pmid:31522753", - "pmid:31269856", - "pmid:30891880", - "pmid:30721448", - "pmid:30699348", - "pmid:30615214", - "pmid:30381411", - "pmid:30314815", - "pmid:30255962", - "pmid:30120431", - "pmid:29801887", - "pmid:29462666", - "pmid:29316893", - "pmid:29249939", - "pmid:29248324", - "pmid:28597910", - "pmid:28585930", - "pmid:28568901", - "pmid:28444220", - "pmid:27999335", - "pmid:27774050", - "pmid:27632585", - "pmid:27333979", - "pmid:27044733", - "pmid:26584329", - "pmid:26374734", - "pmid:26077168", - "pmid:25900954", - "pmid:25755283", - "pmid:25643591", - "pmid:25608122", - "pmid:25506882", - "pmid:25466696", - "pmid:25306109", - "pmid:24972706", - "pmid:24667781", - "pmid:24534762", - "pmid:24209901", - "pmid:23828024", - "pmid:23368522", - "pmid:23197655", - "pmid:23064575", - "pmid:23026538", - "pmid:22831947", - "pmid:22520093", - "pmid:22072678", - "pmid:22053702", - "pmid:21689595", - "pmid:21147232", - "pmid:20069235", - "pmid:19226466", - "pmid:19008940", - "pmid:18418678", - "pmid:18325672", - "pmid:18182848", - "pmid:17961920", - "pmid:17420317", - "pmid:17254003", - "pmid:16626296", - "pmid:16436644", - "pmid:16434483", - "pmid:16389941", - "pmid:16389595", - "pmid:16325416", - "pmid:15750685", - "pmid:15715978", - "pmid:22473187", - "pmid:15349877", - "pmid:15148151", - "pmid:15115762", - "pmid:15080863", - "pmid:14967767", - "pmid:14966163", - "pmid:12810491", - "pmid:12764052", - "pmid:12490531", - "pmid:11939898", - "pmid:11889231", - "pmid:11839840", - "pmid:11804332", - "pmid:11781712", - "pmid:11580893", - "pmid:11448300", - "pmid:11160961", - "pmid:10369884", - "pmid:11030825", - "pmid:11030806", - "pmid:11030410", - "pmid:10942107", - "pmid:10894992", - "pmid:10841760", - "pmid:10785256", - "pmid:10768629", - "pmid:10766906", - "pmid:10602364", - "pmid:10556295", - "pmid:9467013", - "pmid:10500272", - "pmid:10453742", - "pmid:10441328", - "pmid:9973298", - "pmid:9855520", - "pmid:9736784", - "pmid:9613852", - "pmid:9536097", - "pmid:9425224", - "pmid:9425223", - "pmid:9425222", - "pmid:9425905", - "pmid:9385362", - "pmid:9288099", - "pmid:10464657" - ] - }, - { - "id": "SCA8_ATXN8OS", - "disease_id": "SCA8", - "gene": "ATXN8OS", - "evidence": [ - "Definitive" - ], - "chrom": "chr13", - "start_hg38": 70139383, - "stop_hg38": 70139429, - "start_hg19": 70713515, - "stop_hg19": 70713561, - "start_t2t": 69361243, - "stop_t2t": 69361270, - "disease": "Spinocerebellar ataxia type 8", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 8 (SCA8) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by cerebellar ataxia and cognitive dysfunction in almost three quarters of patients and pyramidal and sensory signs in approximately a third of patients [@mondo:0012116].", - "hpo_terms": null, - "prevalence": "0.5/100000", - "prevalence_details": "<1/100,000 [@pmid:29100084]; expansion in 1:100-1200 chromosomes [@genereviews:NBK1268]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1268].", - "age_onset": "Typical: third to fifth decade (20-49); Range: 0 [@genereviews:NBK1268] - 76 [@pmid:40015980].", - "age_onset_min": 0, - "age_onset_max": 76, - "typ_age_onset_min": 20, - "typ_age_onset_max": 49, - "details": "Two genes span the CTG/CAG repeat and are expressed in opposite directions: ATXN8, a nearly pure polyglutamine repeat protein in the CAG direction, and ATXN8OS, which is transcribed to a noncoding CUG repeat RNA [@pmid:16804541]. Reduced penetrance is found in alleles of all sizes, although penetrance appears higher at 71+ repeats and repeats at 50-70 appear less likely to result in disease [@genereviews:NBK1268; @pmid:20373340]. Roda et al. suggested that the ATXN8 or ATXN8OS gene should not be evaluated in isolation as a candidate gene for spinocerebellar degenerative disease [@pmid:28451643]. CCG/CGG interruptions in high-penetrance SCA8 families increase RAN translation and protein toxicity [@pmid:34632710]; Interruptions in CTG/CAG expansion by 1 or more CCG/CGG, CTA/TAG, CTC/GAG, CCA/TGG, or CTT/AAG trinucleotides have been observed in full-penetrance repeats [@pmid:16804541; @genereviews:NBK1268].", - "detection": "Short-read genome sequencing has been reported to underestimate expansion size [@pmid:40015980; @genereviews:NBK1268]. RP-PCR has detected large expansions while long-read sequencing and Southern blotting estimated size more accurately [@genereviews:NBK1268].", - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine/toxic gain-of-function [@omim:608768; @genereviews:NBK1268].", - "year": "1999 [@pmid:10192387]", - "location_in_gene": "Coding Exon 1, or 3' UTR depending on transcript", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CTG" - ], - "pathogenic_motif_reference_orientation": [ - "CTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "CCG", - "CTA", - "CTC", - "CCA", - "CTT" - ], - "pathogenic_motif_gene_orientation": [ - "CTG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "CCG", - "ACT", - "CCT", - "ACC", - "CTT" - ], - "locus_structure": [ - { - "motif": "CTA", - "count": 10, - "type": "flank_repeat" - }, - { - "motif": "CTG", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 15, - "benign_max": 50, - "intermediate_min": 50, - "intermediate_max": 70, - "pathogenic_min": 71, - "pathogenic_max": 1300, - "motif_len": 3, - "ref_copies": 15.3, - "novel": "ref", - "gard": [ - "4956" - ], - "genereviews": [ - "NBK1268" - ], - "malacard": [ - "SPN304" - ], - "medgen": [ - "332457" - ], - "mondo": [ - "0012116" - ], - "omim": [ - "608768" - ], - "orphanet": [ - "98760" - ], - "gnomad": [ - "ATXN8OS" - ], - "stripy": [ - "ATXN8OS" - ], - "tr_atlas": [ - "TR125263", - "TR125264" - ], - "webstr_hg38": [ - "5356762" - ], - "webstr_hg19": [ - "Expansion_SCA8/ATXN8" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "maternal_expansion", - "motif_affects_onset", - "motif_affects_penetrance" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK1268", - "doi:10.1101/gr.279634.124", - "omim:608768", - "pmid:16804541", - "pmid:20373340", - "pmid:28451643", - "pmid:34632710", - "pmid:29100084", - "pmid:10192387", - "mondo:0012116" - ], - "additional_literature": [ - "pmid:41771688", - "pmid:41762523", - "pmid:41353794", - "pmid:41082794", - "pmid:41079917", - "pmid:41074692", - "pmid:41001200", - "pmid:40906330", - "pmid:40890648", - "pmid:40844737", - "pmid:40765612", - "pmid:40488180", - "pmid:40007153", - "pmid:38961870", - "pmid:38227102", - "pmid:38165578", - "pmid:38152578", - "pmid:37906407", - "pmid:37848721", - "pmid:37146135", - "pmid:37003406", - "pmid:36703300", - "pmid:36530930", - "pmid:34622207", - "pmid:34600502", - "pmid:34284285", - "pmid:33526774", - "pmid:33502644", - "pmid:31471687", - "pmid:30109267", - "pmid:29316893", - "pmid:29111027", - "pmid:28782341", - "pmid:28229454", - "pmid:27896316", - "pmid:26374734", - "pmid:26077168", - "pmid:25466696", - "pmid:23711133", - "pmid:23026538", - "pmid:22581592", - "pmid:22520093", - "pmid:22297462", - "pmid:22053702", - "pmid:21173221", - "pmid:20403608", - "pmid:19259763", - "pmid:19229559", - "pmid:18684474", - "pmid:18418692", - "pmid:17961920", - "pmid:17005861", - "pmid:16184604", - "pmid:16054804", - "pmid:15553088", - "pmid:15148151", - "pmid:15080863", - "pmid:14972680", - "pmid:14966163", - "pmid:14960773", - "pmid:14756671", - "pmid:12838526", - "pmid:12764052", - "pmid:12545428", - "pmid:12505613", - "pmid:12470185", - "pmid:12431257", - "pmid:12372061", - "pmid:12140678", - "pmid:12042281", - "pmid:11939898", - "pmid:11839840", - "pmid:11807410", - "pmid:11708995", - "pmid:11591855", - "pmid:11448300", - "pmid:11160961", - "pmid:11121196", - "pmid:11102643", - "pmid:11030410", - "pmid:10976642", - "pmid:10958651", - "pmid:10785256", - "pmid:10712198", - "pmid:10700168", - "pmid:10690991" - ] - }, + "motif": "CCG", + "count": 4, + "type": "flank_repeat" + }], + "benign_min": 4, + "benign_max": 27, + "intermediate_min": 28, + "intermediate_max": 35, + "pathogenic_min": 37, + "pathogenic_max": 460, + "motif_len": 3, + "ref_copies": 10.7, + "novel": "ref", + "gard": ["20405"], + "genereviews": ["NBK1256"], + "malacard": ["SPN291"], + "medgen": ["156006"], + "mondo": ["0016163"], + "omim": ["164500"], + "orphanet": ["94147"], + "gnomad": ["ATXN7"], + "stripy": ["ATXN7"], + "tr_atlas": ["TR31879", "TR31880"], + "webstr_hg38": ["4965588"], + "webstr_hg19": ["Expansion_SCA7/ATXN7"], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["pmid:20739808", "genereviews:NBK1256", "pmid:14571264", "pmid:18418675", "pmid:37906407", "pmid:35245110", "pmid:8908515", "omim:164500"], + "additional_literature": ["pmid:41771688", "pmid:41254939", "pmid:40900235", "pmid:40488180", "pmid:40417743", "pmid:39820777", "pmid:39649105", "pmid:39571249", "pmid:39504355", "pmid:39317855", "pmid:39053472", "pmid:38961870", "pmid:38906973", "pmid:38851031", "pmid:38673939", "pmid:38626762", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:38045332", "pmid:37986914", "pmid:37848721", "pmid:37283503", "pmid:37214832", "pmid:36618024", "pmid:36530930", "pmid:35422034", "pmid:35182509", "pmid:35052497", "pmid:34870541", "pmid:34565721", "pmid:34160002", "pmid:34159894", "pmid:33995769", "pmid:33626063", "pmid:32138195", "pmid:31694722", "pmid:31522753", "pmid:31269856", "pmid:30891880", "pmid:30721448", "pmid:30699348", "pmid:30615214", "pmid:30381411", "pmid:30314815", "pmid:30255962", "pmid:30120431", "pmid:29801887", "pmid:29462666", "pmid:29316893", "pmid:29249939", "pmid:29248324", "pmid:28597910", "pmid:28585930", "pmid:28568901", "pmid:28444220", "pmid:27999335", "pmid:27774050", "pmid:27632585", "pmid:27333979", "pmid:27044733", "pmid:26584329", "pmid:26374734", "pmid:26077168", "pmid:25900954", "pmid:25755283", "pmid:25643591", "pmid:25608122", "pmid:25506882", "pmid:25466696", "pmid:25306109", "pmid:24972706", "pmid:24667781", "pmid:24534762", "pmid:24209901", "pmid:23828024", "pmid:23368522", "pmid:23197655", "pmid:23064575", "pmid:23026538", "pmid:22831947", "pmid:22520093", "pmid:22072678", "pmid:22053702", "pmid:21689595", "pmid:21147232", "pmid:20069235", "pmid:19226466", "pmid:19008940", "pmid:18418678", "pmid:18325672", "pmid:18182848", "pmid:17961920", "pmid:17420317", "pmid:17254003", "pmid:16626296", "pmid:16436644", "pmid:16434483", "pmid:16389941", "pmid:16389595", "pmid:16325416", "pmid:15750685", "pmid:15715978", "pmid:22473187", "pmid:15349877", "pmid:15148151", "pmid:15115762", "pmid:15080863", "pmid:14967767", "pmid:14966163", "pmid:12810491", "pmid:12764052", "pmid:12490531", "pmid:11939898", "pmid:11889231", "pmid:11839840", "pmid:11804332", "pmid:11781712", "pmid:11580893", "pmid:11448300", "pmid:11160961", "pmid:10369884", "pmid:11030825", "pmid:11030806", "pmid:11030410", "pmid:10942107", "pmid:10894992", "pmid:10841760", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10602364", "pmid:10556295", "pmid:9467013", "pmid:10500272", "pmid:10453742", "pmid:10441328", "pmid:9973298", "pmid:9855520", "pmid:9736784", "pmid:9613852", "pmid:9536097", "pmid:9425224", "pmid:9425223", "pmid:9425222", "pmid:9425905", "pmid:9385362", "pmid:9288099", "pmid:10464657"] +}, +{ + "id": "SCA8_ATXN8OS", + "disease_id": "SCA8", + "gene": "ATXN8OS", + "evidence": ["Definitive"], + "chrom": "chr13", + "start_hg38": 70139383, + "stop_hg38": 70139429, + "start_hg19": 70713515, + "stop_hg19": 70713561, + "start_t2t": 69361243, + "stop_t2t": 69361270, + "disease": "Spinocerebellar ataxia type 8", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 8 (SCA8) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by cerebellar ataxia and cognitive dysfunction in almost three quarters of patients and pyramidal and sensory signs in approximately a third of patients [@mondo:0012116].", + "hpo_terms": null, + "prevalence": "0.5/100000", + "prevalence_details": "<1/100,000 [@pmid:29100084]; expansion in 1:100-1200 chromosomes [@genereviews:NBK1268]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1268].", + "age_onset": "Typical: third to fifth decade (20-49); Range: 0 [@genereviews:NBK1268] - 76 [@pmid:40015980].", + "age_onset_min": 0.0, + "age_onset_max": 76.0, + "typ_age_onset_min": 20.0, + "typ_age_onset_max": 49.0, + "details": "Two genes span the CTG/CAG repeat and are expressed in opposite directions: ATXN8, a nearly pure polyglutamine repeat protein in the CAG direction, and ATXN8OS, which is transcribed to a noncoding CUG repeat RNA [@pmid:16804541]. Reduced penetrance is found in alleles of all sizes, although penetrance appears higher at 71+ repeats and repeats at 50-70 appear less likely to result in disease [@genereviews:NBK1268; @pmid:20373340]. Roda et al. suggested that the ATXN8 or ATXN8OS gene should not be evaluated in isolation as a candidate gene for spinocerebellar degenerative disease [@pmid:28451643]. CCG/CGG interruptions in high-penetrance SCA8 families increase RAN translation and protein toxicity [@pmid:34632710]; Interruptions in CTG/CAG expansion by 1 or more CCG/CGG, CTA/TAG, CTC/GAG, CCA/TGG, or CTT/AAG trinucleotides have been observed in full-penetrance repeats [@pmid:16804541; @genereviews:NBK1268].", + "detection": "Short-read genome sequencing has been reported to underestimate expansion size [@pmid:40015980; @genereviews:NBK1268]. RP-PCR has detected large expansions while long-read sequencing and Southern blotting estimated size more accurately [@genereviews:NBK1268].", + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine/toxic gain-of-function [@omim:608768; @genereviews:NBK1268].", + "year": "1999 [@pmid:10192387]", + "location_in_gene": "Coding Exon 1, or 3' UTR depending on transcript", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CTG"], + "pathogenic_motif_reference_orientation": ["CTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["CCG", "CTA", "CTC", "CCA", "CTT"], + "pathogenic_motif_gene_orientation": ["CTG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["CCG", "ACT", "CCT", "ACC", "CTT"], + "locus_structure": [ { - "id": "SCA31_BEAN1", - "disease_id": "SCA31", - "gene": "BEAN1", - "evidence": [ - "Definitive" - ], - "chrom": "chr16", - "start_hg38": 66490396, - "stop_hg38": 66490466, - "start_hg19": 66524299, - "stop_hg19": 66524369, - "start_t2t": 72284666, - "stop_t2t": 72284761, - "disease": "Spinocerebellar ataxia type 31", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 31 (SCA31) is a very rare subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by the late-onset of cerebral ataxia, dysarthria and horizontal gaze nystagmus, and that is occasionally accompanied by pyramidal signs, tremor, decreased vibration sense and hearing difficulties [@mondo:0007296].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Has been found in Japanese populations [@omim:117210] and then once respectively in a Korean and a Chinese family [@pmid:36563608].", - "age_onset": "Typical: 56-62 [@pmid:36563608]; Range: 8-83 [@pmid:23331413].", - "age_onset_min": 8, - "age_onset_max": 83, - "typ_age_onset_min": 56, - "typ_age_onset_max": 62, - "details": "This locus is a novel STR-containing insertion, not present in reference genome; the pathogenic threshold (110-760) is based on the pure repeat of the pathogenic motif within the insertion [@pmid:19878914].", - "detection": "RP-PCR has accurately detected this insertion [@pmid:22992774], while long-read sequencing has resolved size and motif architecture [@pmid:36289212].", - "mechanism": "GoF", - "mechanism_detail": "RNA toxicity and gain of function leading to neurodegeneration [@pmid:36371266]. Role in heterochromatin or chromosomal structure theorized [@omim:117210].", - "year": "2009 [@pmid:19878914]", - "location_in_gene": "Intron 4/4", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "AATAA" - ], - "pathogenic_motif_reference_orientation": [ - "TGGAA", - "TAGAA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "AAAAA", - "AAAAC", - "AAATG", - "AGAAA", - "ATAAG", - "TAAAC", - "TAACA", - "TACAA", - "TCAAA", - "TGCAA" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AATGG", - "AATAG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "AAAAA", - "AAAAC", - "AAATG", - "AAAAG", - "AAGAT", - "AAACT", - "AACAT", - "AATAC", - "AAATC", - "AATGC" - ], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 110, - "pathogenic_max": 760, - "motif_len": 5, - "ref_copies": 14.4, - "novel": "novel", - "gard": [ - "9975" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "SPN103" - ], - "medgen": [ - "348439" - ], - "mondo": [ - "0007296" - ], - "omim": [ - "117210" - ], - "orphanet": [ - "217012" - ], - "gnomad": [ - "BEAN1" - ], - "stripy": [ - "BEAN1" - ], - "tr_atlas": [ - "TR141992" - ], - "webstr_hg38": [ - "812447", - "5971756" - ], - "webstr_hg19": [ - "STR_539736" - ], - "locus_tags": [ - "anticipation", - "motif_affects_onset", - "motif_affects_penetrance" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "pmid:36563608", - "pmid:23331413", - "pmid:36371266", - "omim:117210", - "pmid:19878914", - "mondo:0007296" - ], - "additional_literature": [ - "pmid:41841436", - "pmid:41426430", - "pmid:40765612", - "pmid:40488180", - "pmid:38961870", - "pmid:38152578", - "pmid:37848721", - "pmid:36970617", - "pmid:36092952", - "pmid:35084690", - "pmid:33785066", - "pmid:33431896", - "pmid:32066831", - "pmid:31737797", - "pmid:29111027", - "pmid:28343865", - "pmid:24215022", - "pmid:23607545" - ] + "motif": "CTA", + "count": 10, + "type": "flank_repeat" }, { - "id": "FTDALS1_C9orf72", - "disease_id": "FTDALS1", - "gene": "C9orf72", - "evidence": [ - "Definitive" - ], - "chrom": "chr9", - "start_hg38": 27573484, - "stop_hg38": 27573546, - "start_hg19": 27573482, - "stop_hg19": 27573544, - "start_t2t": 27584063, - "stop_t2t": 27584155, - "disease": "Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS)", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian", - "Risk" - ], - "disease_description": "Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:31315673]. Related individuals to patients with C9orf72-ALS appear at an increased risk of disease regardless of carrier status [@pmid:38149039; @pmid:39315390]. C9orf72-FTD is estimated to be 0.04-134:100,000 [@genereviews:NBK268647], and by our estimates 0.65-1.56/100,000 for C9orf72-ALS. The expansion has been found across ethnicities/ancestries, with population-dependent prevalence, highest in those with northern European ancestry [@genereviews:NBK268647].", - "age_onset": "Typical: 50-64; Range: 20-91 [@genereviews:NBK268647].", - "age_onset_min": 20, - "age_onset_max": 91, - "typ_age_onset_min": 50, - "typ_age_onset_max": 64, - "details": "FTD and ALS form a clinical spectrum [@pmid:37388914; @pmid:22406228]. The clinical ranges of the C9orf72 locus remain ambiguous [@stripy:C9ORF72][@pmid:41951733]: most healthy controls have alleles up to 24 repeats [@pmid:28319737] yet 24-30 repeats are associated with ALS [@pmid:31315673] and while 60 repeats is frequently used as a threshold for uncertain alleles, the exact threshold of pathogenicity remains unclear [@genereviews:NBK268647; @pmid:38099605]. Repeats of 80 motifs and lower appear to have delayed onset for any phenotype [@pmid:28319737]. >250 repeats are associated with a full FTD/ALS disease state [@pmid:31048495], but pathogenic alleles can range from 30 to more than 4000 repeats [@pmid:38099605; @pmid:39709476]. Somatic C9orf72 repeat expansions may emerge de novo in CNS tissue from alleles below the pathogenic range, potentially contributing to sporadic ALS/FTD [@pmid:41986690]. Penetrance appears to also be age-dependent, with environmental factors and specific phenotypes associated with sex and age at onset [@pmid:28522837]. Methylation appears to increase with expansion length and age [@pmid:39709476], and C9orf72 promoter hypermethylation has been observed in expansion carriers [@pmid:42222887]. ALS caused by repeat expansions in C9orf72 generally has an earlier disease onset and faster progression than other ALS presentations [@pmid:39226712]. C9orf72 expansions have been associated with reduced thalamic volume in undiagnosed carriers, and plasma neurofilament light chain has an approximately linear association with repeat count and motor neuron disease risk [@pmid:41951733; @pmid:42095061]. Pathogenic C9orf72 repeat expansions have also been identified in ambiguous late onset behavioral or psychiatric like presentations including executive deficits, apathy, and stereotyped behavior [@pmid:42158267].", - "detection": "Bidirectional RP-PCR is typically used for detection [@pmid:21944778]. Large pathogenic expansions are difficult to size exactly by PCR, so Southern blot is used to better estimate size [@pmid:23566336], while long-read sequencing provides direct sizing and sequence characterization [@pmid:30126445].", - "mechanism": "Ambiguous", - "mechanism_detail": "The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA/DNA hybrids (R-loops). The structural polymorphism causes a repeat length-dependent accumulation of transcripts aborted in the HRE region [@omim:105500]. Additional mechanisms theorized include protein loss-of-function and RNA gain-of-function [@pmid:37847372]. Multiple cell types in the prefrontal cortex, including oligodendrocytes, microglia, astrocytes, and neurons, appear impacted during pathogenesis [@pmid:39999167]. Drosophila model-system evidence suggests that RAN translated poly(GR) may contribute to toxicity by activating the integrated stress response through eIF2α phosphorylation and promoting stress granule accumulation [@pmid:42087256]. C9orf72 repeat expansions are associated with reduced C9orf72 expression in multiple ALS tissues and altered splicing of the exon 1a isoform [@pmid:42145639]. Reduced C9orf72 expression has also been observed in peripheral blood immune cells from C9orf72-associated ALS, with C9-ALS showing distinct monocyte activation signatures. In ALS spinal cord, activated myeloid cells expressing complement, lipid-processing, and phagocytic genes occur in regions with motor neuron loss and TDP-43 pathology [@pmid:42135512].", - "year": "2011 [@pmid:21944778]", - "location_in_gene": "Intron 1 or 5' UTR depending on transcript", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GGCCCC" - ], - "pathogenic_motif_reference_orientation": [ - "GGCCCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCGGGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 23, - "intermediate_min": 24, - "intermediate_max": 30, - "pathogenic_min": 31, - "pathogenic_max": 4088, - "motif_len": 6, - "ref_copies": 10.8, - "novel": "ref", - "gard": [ - "18396" - ], - "genereviews": [ - "NBK268647" - ], - "malacard": [ - "FRN044" - ], - "medgen": [ - "1830423" - ], - "mondo": [ - "0007105" - ], - "omim": [ - "105500" - ], - "orphanet": [ - "275872" - ], - "gnomad": [ - "C9ORF72" - ], - "stripy": [ - "C9ORF72" - ], - "tr_atlas": [ - "TR92417" - ], - "webstr_hg38": [ - "5877863", - "1502453" - ], - "webstr_hg19": [ - "STR_1475506" - ], - "locus_tags": [ - "length_affects_phenotype", - "length_affects_onset" - ], - "disease_tags": [ - "phenotypic_spectrum" - ], - "references": [ - "genereviews:NBK268647", - "omim:105500", - "pmid:37847372", - "pmid:39999167", - "pmid:37388914", - "pmid:22406228", - "stripy:C9ORF72", - "pmid:41951733", - "pmid:28319737", - "pmid:31315673", - "pmid:38099605", - "pmid:31048495", - "pmid:39709476", - "pmid:41986690", - "pmid:28522837", - "pmid:39226712", - "pmid:38149039", - "pmid:39315390", - "pmid:21944778", - "pmid:39349043", - "pmid:41074692", - "pmid:41957010" - ], - "additional_literature": [ - "pmid:42222887", - "pmid:42221822", - "pmid:42211284", - "pmid:42160515", - "pmid:42158267", - "pmid:42147445", - "pmid:42145639", - "pmid:42135512", - "pmid:42095061", - "pmid:42087256", - "pmid:42033225", - "pmid:41995858", - "pmid:41993388", - "pmid:41987036", - "pmid:41961863", - "pmid:41928938", - "pmid:41917466", - "pmid:41884597", - "pmid:41856038", - "pmid:41810938", - "pmid:41799019", - "pmid:41787388", - "pmid:41766077", - "pmid:41763422", - "pmid:41762523", - "pmid:41760955", - "pmid:41757350", - "pmid:41752089", - "pmid:41751955", - "pmid:41727102", - "pmid:41717003", - "pmid:41692171", - "pmid:41665027", - "pmid:41658940", - "pmid:41643661", - "pmid:41643021", - "pmid:41640102", - "pmid:41623487", - "pmid:41612618", - "pmid:41500252", - "pmid:41440030", - "pmid:41437053", - "pmid:41426430", - "pmid:41423553", - "pmid:41394713", - "pmid:41394638", - "pmid:41379346", - "pmid:41366786", - "pmid:41359433", - "pmid:41358323", - "pmid:41294820", - "pmid:41283823", - "pmid:41278665", - "pmid:41271630", - "pmid:41269363", - "pmid:41256634", - "pmid:41240362", - "pmid:41216140", - "pmid:41196070", - "pmid:41149812", - "pmid:41149783", - "pmid:41141812", - "pmid:41137727", - "pmid:41087751", - "pmid:41063344", - "pmid:41060790", - "pmid:41040221", - "pmid:41030957", - "pmid:41025901", - "pmid:41024438", - "pmid:41009775", - "pmid:41006764", - "pmid:41005474", - "pmid:41004400", - "pmid:40992079", - "pmid:40981770", - "pmid:40966720", - "pmid:40952044", - "pmid:40930530", - "pmid:40908789", - "pmid:40891053", - "pmid:40888599", - "pmid:40875372", - "pmid:40865525", - "pmid:40832293", - "pmid:40790269", - "pmid:40776416", - "pmid:40767591", - "pmid:40765612", - "pmid:40763713", - "pmid:40758885", - "pmid:40746751", - "pmid:40709577", - "pmid:40682810", - "pmid:40621734", - "pmid:40585812", - "pmid:40581653", - "pmid:40541176", - "pmid:40536530", - "pmid:40513650", - "pmid:40504117", - "pmid:40478310", - "pmid:40426848", - "pmid:40424855", - "pmid:40411682", - "pmid:40375307", - "pmid:40349639", - "pmid:40349338", - "pmid:40346885", - "pmid:40260680", - "pmid:40250093", - "pmid:40207633", - "pmid:40203833", - "pmid:40196659", - "pmid:40150989", - "pmid:40138021", - "pmid:40073860", - "pmid:40053600", - "pmid:40050010", - "pmid:40027671", - "pmid:40000803", - "pmid:39975241", - "pmid:39957101", - "pmid:39945490", - "pmid:39920674", - "pmid:39913612", - "pmid:39894561", - "pmid:39893487", - "pmid:39869842", - "pmid:39809899", - "pmid:39779704", - "pmid:39779681", - "pmid:39764003", - "pmid:39747573", - "pmid:39730482", - "pmid:39722074", - "pmid:39711523", - "pmid:39703094", - "pmid:39670345", - "pmid:39669124", - "pmid:39638345", - "pmid:39621905", - "pmid:39589881", - "pmid:39581338", - "pmid:39569145", - "pmid:39437787", - "pmid:39417137", - "pmid:39382125", - "pmid:39345637", - "pmid:39339364", - "pmid:39323877", - "pmid:39316747", - "pmid:39316038", - "pmid:39311028", - "pmid:39289761", - "pmid:39288267", - "pmid:39282230", - "pmid:39268612", - "pmid:39270726", - "pmid:39260140", - "pmid:39256877", - "pmid:39254359", - "pmid:39253499", - "pmid:39246336", - "pmid:39233852", - "pmid:39229486", - "pmid:39222049", - "pmid:39181135", - "pmid:39146722", - "pmid:39106320", - "pmid:39098187", - "pmid:39088455", - "pmid:39059407", - "pmid:39058450", - "pmid:39056697", - "pmid:39042693", - "pmid:39000564", - "pmid:38935506", - "pmid:38915937", - "pmid:38902980", - "pmid:38896262", - "pmid:38884646", - "pmid:38876108", - "pmid:38860430", - "pmid:38852112", - "pmid:38847891", - "pmid:38799643", - "pmid:38796984", - "pmid:38753768", - "pmid:38751620", - "pmid:38746326", - "pmid:38734896", - "pmid:38722513", - "pmid:38684907", - "pmid:38667292", - "pmid:38658168", - "pmid:38641715", - "pmid:38625400", - "pmid:38621131", - "pmid:38615685", - "pmid:38613988", - "pmid:38606777", - "pmid:38585915", - "pmid:38568044", - "pmid:38556190", - "pmid:38495583", - "pmid:38464738", - "pmid:38444607", - "pmid:38431841", - "pmid:38412259", - "pmid:38397958", - "pmid:38394210", - "pmid:38376483", - "pmid:38295729", - "pmid:38312023", - "pmid:38301895", - "pmid:38260655", - "pmid:38242117", - "pmid:38234062", - "pmid:38229533", - "pmid:38191789", - "pmid:38168370", - "pmid:38168171", - "pmid:38112783", - "pmid:38110419", - "pmid:38092738", - "pmid:38064514", - "pmid:38019311", - "pmid:38009843", - "pmid:37948524", - "pmid:37891975", - "pmid:37861203", - "pmid:37845749", - "pmid:37839080", - "pmid:37827570", - "pmid:37808871", - "pmid:37791472", - "pmid:37763163", - "pmid:37736756", - "pmid:37723585", - "pmid:37714849", - "pmid:37693322", - "pmid:37686239", - "pmid:37675986", - "pmid:37648532", - "pmid:37644512", - "pmid:37590144", - "pmid:37574738", - "pmid:37548032", - "pmid:37545231", - "pmid:37527465", - "pmid:37511014", - "pmid:37471224", - "pmid:37461319", - "pmid:37450566", - "pmid:37421883", - "pmid:37399804", - "pmid:37386798", - "pmid:37379724", - "pmid:37365312", - "pmid:37339631", - "pmid:37334257", - "pmid:37333274", - "pmid:37333144", - "pmid:37332610", - "pmid:37317656", - "pmid:37294668", - "pmid:37288312", - "pmid:37223130", - "pmid:37202167", - "pmid:37178170", - "pmid:37173134", - "pmid:37147520", - "pmid:37146135", - "pmid:37138766", - "pmid:37138765", - "pmid:37133535", - "pmid:37107688", - "pmid:37080969", - "pmid:37073950", - "pmid:37043475", - "pmid:37015082", - "pmid:37010807", - "pmid:37006326", - "pmid:36963214", - "pmid:36936421", - "pmid:36857431", - "pmid:36823368", - "pmid:36822200", - "pmid:36799407", - "pmid:36764521", - "pmid:36711601", - "pmid:36650645", - "pmid:36638803", - "pmid:36619668", - "pmid:36549973", - "pmid:36515702", - "pmid:36511680", - "pmid:36511398", - "pmid:36494425", - "pmid:36482247", - "pmid:36458975", - "pmid:36454749", - "pmid:36446586", - "pmid:36443488", - "pmid:36438488", - "pmid:36409902", - "pmid:36379394", - "pmid:36373318", - "pmid:36345033", - "pmid:36322143", - "pmid:36308529", - "pmid:36271076", - "pmid:36252286", - "pmid:36226890", - "pmid:36220889", - "pmid:36219176", - "pmid:36217158", - "pmid:36202819", - "pmid:36151083", - "pmid:36148898", - "pmid:36130523", - "pmid:36108486", - "pmid:36103513", - "pmid:38933387", - "pmid:36070099", - "pmid:36008116", - "pmid:35989899", - "pmid:35974122", - "pmid:35933239", - "pmid:35908282", - "pmid:35906014", - "pmid:35903771", - "pmid:35895140", - "pmid:35876881", - "pmid:35869263", - "pmid:35843530", - "pmid:35813024", - "pmid:35793625", - "pmid:35766328", - "pmid:35752680", - "pmid:35746899", - "pmid:35726380", - "pmid:35675776", - "pmid:35661131", - "pmid:35633169", - "pmid:35625816", - "pmid:35599735", - "pmid:35594156", - "pmid:35592494", - "pmid:35589711", - "pmid:35568435", - "pmid:35525134", - "pmid:35462091", - "pmid:35383205", - "pmid:35379876", - "pmid:35379698", - "pmid:35314728", - "pmid:35295181", - "pmid:35259014", - "pmid:35189395", - "pmid:35182509", - "pmid:35171477", - "pmid:35152451", - "pmid:35096836", - "pmid:35091648", - "pmid:35052416", - "pmid:35047667", - "pmid:35026048", - "pmid:35007998", - "pmid:34978044", - "pmid:34949835", - "pmid:34915153", - "pmid:34853325", - "pmid:34848561", - "pmid:34827542", - "pmid:34791698", - "pmid:34723963", - "pmid:34717271", - "pmid:34705518", - "pmid:34687211", - "pmid:34677935", - "pmid:34654821", - "pmid:34638725", - "pmid:34573259", - "pmid:34542927", - "pmid:34534264", - "pmid:34526954", - "pmid:34475377", - "pmid:34450161", - "pmid:34440384", - "pmid:34435379", - "pmid:34431456", - "pmid:34404558", - "pmid:34397416", - "pmid:34389718", - "pmid:34389711", - "pmid:34386583", - "pmid:34382491", - "pmid:34376242", - "pmid:34328616", - "pmid:34318620", - "pmid:34310040", - "pmid:34305575", - "pmid:34297726", - "pmid:34233951", - "pmid:34229542", - "pmid:34209673", - "pmid:34187866", - "pmid:34179866", - "pmid:34174288", - "pmid:34172817", - "pmid:34170347", - "pmid:34168085", - "pmid:34157654", - "pmid:34152475", - "pmid:34140881", - "pmid:34133945", - "pmid:34118929", - "pmid:34099711", - "pmid:34093394", - "pmid:34051439", - "pmid:34048588", - "pmid:33977144", - "pmid:33967699", - "pmid:33935096", - "pmid:33906932", - "pmid:33892814", - "pmid:33889947", - "pmid:33857770", - "pmid:33837088", - "pmid:33833668", - "pmid:33830997", - "pmid:33815737", - "pmid:33789100", - "pmid:33788382", - "pmid:33741069", - "pmid:33739284", - "pmid:33737586", - "pmid:33730968", - "pmid:33726839", - "pmid:33709219", - "pmid:33705846", - "pmid:33663561", - "pmid:33661518", - "pmid:33619157", - "pmid:33601107", - "pmid:33588953", - "pmid:33558503", - "pmid:33554115", - "pmid:33482083", - "pmid:33431483", - "pmid:33414559", - "pmid:33409820", - "pmid:33378537", - "pmid:33377399", - "pmid:33376800", - "pmid:33363944", - "pmid:33329355", - "pmid:33300868", - "pmid:33276461", - "pmid:33253636", - "pmid:33196168", - "pmid:33168090", - "pmid:33168078", - "pmid:33149115", - "pmid:33131137", - "pmid:33129345", - "pmid:33123074", - "pmid:33058338", - "pmid:33055142", - "pmid:33022226", - "pmid:32989102", - "pmid:32961393", - "pmid:32958650", - "pmid:32954321", - "pmid:32949047", - "pmid:32921502", - "pmid:32894207", - "pmid:32878979", - "pmid:32865792", - "pmid:32845284", - "pmid:32843153", - "pmid:32843152", - "pmid:32830871", - "pmid:32823188", - "pmid:32821252", - "pmid:32769055", - "pmid:32759310", - "pmid:32755582", - "pmid:32721467", - "pmid:32683569", - "pmid:32675418", - "pmid:32638105", - "pmid:32628322", - "pmid:32554322", - "pmid:32521185", - "pmid:32504093", - "pmid:32500377", - "pmid:32485711", - "pmid:32483373", - "pmid:32441885", - "pmid:32421156", - "pmid:32410933", - "pmid:32385536", - "pmid:32375063", - "pmid:32375043", - "pmid:32347002", - "pmid:32338076", - "pmid:32296747", - "pmid:32284607", - "pmid:32281118", - "pmid:32278549", - "pmid:32226938", - "pmid:32223927", - "pmid:32184029", - "pmid:32180125", - "pmid:32175624", - "pmid:32151952", - "pmid:32132225", - "pmid:32125773", - "pmid:32123048", - "pmid:32119645", - "pmid:32100453", - "pmid:32093728", - "pmid:32084385", - "pmid:32082115", - "pmid:32070418", - "pmid:32059759", - "pmid:32042907", - "pmid:32035967", - "pmid:32035847", - "pmid:32000838", - "pmid:31991801", - "pmid:31930538", - "pmid:31925813", - "pmid:31858749", - "pmid:31852251", - "pmid:31847700", - "pmid:31843021", - "pmid:31836585", - "pmid:31831332", - "pmid:31810584", - "pmid:31800202", - "pmid:31791419", - "pmid:31702465", - "pmid:31676125", - "pmid:31651360", - "pmid:31649034", - "pmid:31647549", - "pmid:31642962", - "pmid:31637556", - "pmid:31633109", - "pmid:31625563", - "pmid:31624333", - "pmid:31619481", - "pmid:31594549", - "pmid:31587919", - "pmid:31586943", - "pmid:31582231", - "pmid:31579943", - "pmid:31578297", - "pmid:31561355", - "pmid:31559531", - "pmid:31551693", - "pmid:31530427", - "pmid:31499409", - "pmid:31475037", - "pmid:31444357", - "pmid:31439573", - "pmid:31432691", - "pmid:31375896", - "pmid:31358992", - "pmid:31327044", - "pmid:31325016", - "pmid:31205123", - "pmid:31176718", - "pmid:31156370", - "pmid:31127772", - "pmid:31086314", - "pmid:31041398", - "pmid:31036086", - "pmid:31019099", - "pmid:31019093", - "pmid:31009932", - "pmid:31007077", - "pmid:30992335", - "pmid:30992141", - "pmid:30992063", - "pmid:30985904", - "pmid:30981631", - "pmid:30979436", - "pmid:30945056", - "pmid:30938419", - "pmid:30863279", - "pmid:30861516", - "pmid:30859373", - "pmid:30846540", - "pmid:30790403", - "pmid:30777654", - "pmid:30767771", - "pmid:30739198", - "pmid:30714955", - "pmid:30711674", - "pmid:30685122", - "pmid:30643298", - "pmid:30617627", - "pmid:30617154", - "pmid:30610877", - "pmid:30554355", - "pmid:30550541", - "pmid:30530974", - "pmid:30528349", - "pmid:30527999", - "pmid:30454072", - "pmid:30447080", - "pmid:30396881", - "pmid:30356970", - "pmid:30349864", - "pmid:30347338", - "pmid:30337192", - "pmid:30336474", - "pmid:30320585", - "pmid:30312838", - "pmid:30310141", - "pmid:30261505", - "pmid:30252044", - "pmid:30239641", - "pmid:30233460", - "pmid:30213863", - "pmid:30210275", - "pmid:30150298", - "pmid:30126445", - "pmid:30109267", - "pmid:30099204", - "pmid:30093141", - "pmid:30090657", - "pmid:30075745", - "pmid:30023173", - "pmid:30022074", - "pmid:29973287", - "pmid:29957385", - "pmid:29942091", - "pmid:29912891", - "pmid:29895397", - "pmid:29889265", - "pmid:29866399", - "pmid:29861044", - "pmid:29859640", - "pmid:29855382", - "pmid:29848387", - "pmid:29801887", - "pmid:29761121", - "pmid:29750243", - "pmid:29748150", - "pmid:29738460", - "pmid:29628143", - "pmid:29610297", - "pmid:29598923", - "pmid:29525180", - "pmid:29507424", - "pmid:29493298", - "pmid:29480190", - "pmid:29480183", - "pmid:29479499", - "pmid:29476165", - "pmid:29449030", - "pmid:29441485", - "pmid:29439323", - "pmid:29400714", - "pmid:29380049", - "pmid:29367641", - "pmid:29352617", - "pmid:29352102", - "pmid:29316893", - "pmid:29302060", - "pmid:29281254", - "pmid:29274668", - "pmid:29264395", - "pmid:29222490", - "pmid:29216908", - "pmid:29196813", - "pmid:29170628", - "pmid:29166782", - "pmid:29149615", - "pmid:29131108", - "pmid:29113975", - "pmid:29095328", - "pmid:29080331", - "pmid:29056323", - "pmid:29055436", - "pmid:29049464", - "pmid:29036691", - "pmid:28973350", - "pmid:28889094", - "pmid:28887402", - "pmid:28827593", - "pmid:28808785", - "pmid:28803727", - "pmid:28749476", - "pmid:28720882", - "pmid:28714954", - "pmid:28677678", - "pmid:28666709", - "pmid:28660252", - "pmid:28642336", - "pmid:28637276", - "pmid:28614712", - "pmid:28606110", - "pmid:28570551", - "pmid:28551275", - "pmid:28550099", - "pmid:28542233", - "pmid:28539470", - "pmid:28527524", - "pmid:28508101", - "pmid:28491898", - "pmid:28482638", - "pmid:28481984", - "pmid:28462717", - "pmid:28452351", - "pmid:28439722", - "pmid:28431575", - "pmid:28420437", - "pmid:28408402", - "pmid:28387671", - "pmid:28365006", - "pmid:28356511", - "pmid:28351931", - "pmid:28334866", - "pmid:28322003", - "pmid:28320191", - "pmid:28306503", - "pmid:28222900", - "pmid:28197542", - "pmid:28192553", - "pmid:28160950", - "pmid:28158451", - "pmid:28132891", - "pmid:28131227", - "pmid:28124431", - "pmid:28116236", - "pmid:28105640", - "pmid:28103472", - "pmid:28089114", - "pmid:28088213", - "pmid:28010125", - "pmid:28003435", - "pmid:27936955", - "pmid:27933757", - "pmid:27875531", - "pmid:27797809", - "pmid:27796305", - "pmid:27790088", - "pmid:27688759", - "pmid:27739539", - "pmid:27773700", - "pmid:27595458", - "pmid:27768896", - "pmid:27756805", - "pmid:27720481", - "pmid:27732842", - "pmid:27671483", - "pmid:27666590", - "pmid:27663272", - "pmid:27652840", - "pmid:27646412", - "pmid:27623008", - "pmid:27617292", - "pmid:27516603", - "pmid:27480424", - "pmid:27473499", - "pmid:27461252", - "pmid:27413586", - "pmid:27400454", - "pmid:27388677", - "pmid:27375918", - "pmid:27369896", - "pmid:27334615", - "pmid:27327087", - "pmid:27288208", - "pmid:27274540", - "pmid:27245636", - "pmid:27241037", - "pmid:27195002", - "pmid:27193190", - "pmid:27151634", - "pmid:27112497", - "pmid:27097283", - "pmid:27079381", - "pmid:26998601", - "pmid:26979938", - "pmid:26967212", - "pmid:26931465", - "pmid:26925510", - "pmid:26919046", - "pmid:26915990", - "pmid:26903389", - "pmid:26878348", - "pmid:26862832", - "pmid:26839080", - "pmid:26810537", - "pmid:26785370", - "pmid:26777436", - "pmid:26769963", - "pmid:26746986", - "pmid:26735706", - "pmid:26733254", - "pmid:26728149", - "pmid:26725464", - "pmid:26723138", - "pmid:28337409", - "pmid:26691640", - "pmid:26690922", - "pmid:26674655", - "pmid:26637797", - "pmid:26632347", - "pmid:26599997", - "pmid:26584779", - "pmid:26551617", - "pmid:26547294", - "pmid:26538301", - "pmid:26526532", - "pmid:26497991", - "pmid:26481318", - "pmid:26463209", - "pmid:26437865", - "pmid:29213991", - "pmid:26408000", - "pmid:26401819", - "pmid:26374446", - "pmid:26350237", - "pmid:26348842", - "pmid:26347457", - "pmid:26308983", - "pmid:26308899", - "pmid:26308891", - "pmid:26304661", - "pmid:26275564", - "pmid:26254955", - "pmid:26234378", - "pmid:26233805", - "pmid:26174152", - "pmid:26166205", - "pmid:26146826", - "pmid:26142124", - "pmid:26108573", - "pmid:26099177", - "pmid:26095883", - "pmid:26083476", - "pmid:26044557", - "pmid:26031661", - "pmid:26022924", - "pmid:26016851", - "pmid:25977373", - "pmid:25943890", - "pmid:25943887", - "pmid:25934183", - "pmid:25835037", - "pmid:25795648", - "pmid:25791939", - "pmid:25788698", - "pmid:25756586", - "pmid:25732802", - "pmid:25716178", - "pmid:25712133", - "pmid:25637145", - "pmid:25618255", - "pmid:25617006", - "pmid:25595499", - "pmid:25585530", - "pmid:25531686", - "pmid:25467142", - "pmid:25457023", - "pmid:25442110", - "pmid:25436637", - "pmid:25433797", - "pmid:25433461", - "pmid:25388784", - "pmid:25377888", - "pmid:25326098", - "pmid:25319030", - "pmid:25308964", - "pmid:25284081", - "pmid:25281017", - "pmid:25273996", - "pmid:25248608", - "pmid:25239657", - "pmid:25210488", - "pmid:25207541", - "pmid:25203513", - "pmid:25185840", - "pmid:25182743", - "pmid:25179228", - "pmid:25173361", - "pmid:25158292", - "pmid:25156163", - "pmid:25147206", - "pmid:25132468", - "pmid:25123918", - "pmid:25120191", - "pmid:25115936", - "pmid:25111021", - "pmid:25108559", - "pmid:25098532", - "pmid:25085782", - "pmid:25081482", - "pmid:25034271", - "pmid:24950788", - "pmid:24928930", - "pmid:24908669", - "pmid:24908169", - "pmid:24898647", - "pmid:24866401", - "pmid:24866055", - "pmid:24861139", - "pmid:24819148", - "pmid:24806409", - "pmid:24803912", - "pmid:24798095", - "pmid:24756204", - "pmid:24733620", - "pmid:24706941", - "pmid:24704492", - "pmid:24667415", - "pmid:24650794", - "pmid:24612676", - "pmid:24598541", - "pmid:24573903", - "pmid:24559645", - "pmid:24549040", - "pmid:24530272", - "pmid:24445987", - "pmid:24442578", - "pmid:24439166", - "pmid:24417314", - "pmid:24387986", - "pmid:24387985", - "pmid:24385136", - "pmid:24378086", - "pmid:24363131", - "pmid:24355526", - "pmid:24329881", - "pmid:24319645", - "pmid:24309270", - "pmid:24286341", - "pmid:24269022", - "pmid:24269018", - "pmid:24252571", - "pmid:24252525", - "pmid:24248382", - "pmid:24212388", - "pmid:24179835", - "pmid:24170096", - "pmid:24169076", - "pmid:24166615", - "pmid:24154603", - "pmid:24139042", - "pmid:24129584", - "pmid:24126854", - "pmid:24121957", - "pmid:24107864", - "pmid:24096617", - "pmid:24080172", - "pmid:24077574", - "pmid:24068985", - "pmid:24057670", - "pmid:24053774", - "pmid:24052799", - "pmid:24027057", - "pmid:24011653", - "pmid:23998997", - "pmid:23987827", - "pmid:23973441", - "pmid:23962495", - "pmid:23922030", - "pmid:23894576", - "pmid:23884045", - "pmid:23870417", - "pmid:23869403", - "pmid:23845100", - "pmid:23836460", - "pmid:23836290", - "pmid:23818065", - "pmid:23771489", - "pmid:23731538", - "pmid:23720273", - "pmid:23695224", - "pmid:23686809", - "pmid:23597494", - "pmid:23588498", - "pmid:23588422", - "pmid:23587638", - "pmid:23566336", - "pmid:23553481", - "pmid:23551834", - "pmid:23548882", - "pmid:23473366", - "pmid:23437264", - "pmid:23435409", - "pmid:23434116", - "pmid:23423380", - "pmid:23421625", - "pmid:23415312", - "pmid:23413259", - "pmid:23383383", - "pmid:23381195", - "pmid:23358603", - "pmid:23352322", - "pmid:23338750", - "pmid:23338682", - "pmid:23329412", - "pmid:23284068", - "pmid:23273600", - "pmid:23261768", - "pmid:23254636", - "pmid:23216213", - "pmid:23199140", - "pmid:23151261", - "pmid:23141412", - "pmid:23117491", - "pmid:23116878", - "pmid:23107433", - "pmid:23088937", - "pmid:23085936", - "pmid:23084342", - "pmid:23063644", - "pmid:23053136", - "pmid:23053135", - "pmid:23036583", - "pmid:23035801", - "pmid:23016833", - "pmid:23012445", - "pmid:23006986", - "pmid:22993125", - "pmid:22985429", - "pmid:22964911", - "pmid:22936364", - "pmid:22918453", - "pmid:22898310", - "pmid:22892647", - "pmid:22878164", - "pmid:22875087", - "pmid:22875086", - "pmid:22843265", - "pmid:22840558", - "pmid:22818528", - "pmid:22815561", - "pmid:22766732", - "pmid:22766072", - "pmid:22742426", - "pmid:22739338", - "pmid:22727276", - "pmid:22721568", - "pmid:22720079", - "pmid:22708871", - "pmid:22702520", - "pmid:22692064", - "pmid:22673113", - "pmid:22650353", - "pmid:22645277", - "pmid:22637471", - "pmid:22637429", - "pmid:22571983", - "pmid:22564974", - "pmid:22550220", - "pmid:22507827", - "pmid:22502998", - "pmid:22499346", - "pmid:22483864", - "pmid:22459598", - "pmid:22426854", - "pmid:22418734", - "pmid:22410647", - "pmid:22406229", - "pmid:22399793", - "pmid:22366794", - "pmid:22366793", - "pmid:22366792", - "pmid:22366791", - "pmid:22343411", - "pmid:22305801", - "pmid:22300876", - "pmid:22300873", - "pmid:22228244", - "pmid:22216764", - "pmid:22181065", - "pmid:22154785", - "pmid:22101323", - "pmid:22083254", - "pmid:21944779" - ] - }, + "motif": "CTG", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 15, + "benign_max": 50, + "intermediate_min": 50, + "intermediate_max": 70, + "pathogenic_min": 71, + "pathogenic_max": 1300, + "motif_len": 3, + "ref_copies": 15.3, + "novel": "ref", + "gard": ["4956"], + "genereviews": ["NBK1268"], + "malacard": ["SPN304"], + "medgen": ["332457"], + "mondo": ["0012116"], + "omim": ["608768"], + "orphanet": ["98760"], + "gnomad": ["ATXN8OS"], + "stripy": ["ATXN8OS"], + "tr_atlas": ["TR125263", "TR125264"], + "webstr_hg38": ["5356762"], + "webstr_hg19": ["Expansion_SCA8/ATXN8"], + "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "motif_affects_onset", "motif_affects_penetrance"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK1268", "doi:10.1101/gr.279634.124", "omim:608768", "pmid:16804541", "pmid:20373340", "pmid:28451643", "pmid:34632710", "pmid:29100084", "pmid:10192387", "mondo:0012116"], + "additional_literature": ["pmid:41771688", "pmid:41762523", "pmid:41353794", "pmid:41082794", "pmid:41079917", "pmid:41074692", "pmid:41001200", "pmid:40906330", "pmid:40890648", "pmid:40844737", "pmid:40765612", "pmid:40488180", "pmid:40007153", "pmid:38961870", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37906407", "pmid:37848721", "pmid:37146135", "pmid:37003406", "pmid:36703300", "pmid:36530930", "pmid:34622207", "pmid:34600502", "pmid:34284285", "pmid:33526774", "pmid:33502644", "pmid:31471687", "pmid:30109267", "pmid:29316893", "pmid:29111027", "pmid:28782341", "pmid:28229454", "pmid:27896316", "pmid:26374734", "pmid:26077168", "pmid:25466696", "pmid:23711133", "pmid:23026538", "pmid:22581592", "pmid:22520093", "pmid:22297462", "pmid:22053702", "pmid:21173221", "pmid:20403608", "pmid:19259763", "pmid:19229559", "pmid:18684474", "pmid:18418692", "pmid:17961920", "pmid:17005861", "pmid:16184604", "pmid:16054804", "pmid:15553088", "pmid:15148151", "pmid:15080863", "pmid:14972680", "pmid:14966163", "pmid:14960773", "pmid:14756671", "pmid:12838526", "pmid:12764052", "pmid:12545428", "pmid:12505613", "pmid:12470185", "pmid:12431257", "pmid:12372061", "pmid:12140678", "pmid:12042281", "pmid:11939898", "pmid:11839840", "pmid:11807410", "pmid:11708995", "pmid:11591855", "pmid:11448300", "pmid:11160961", "pmid:11121196", "pmid:11102643", "pmid:11030410", "pmid:10976642", "pmid:10958651", "pmid:10785256", "pmid:10712198", "pmid:10700168", "pmid:10690991"] +}, +{ + "id": "SCA31_BEAN1", + "disease_id": "SCA31", + "gene": "BEAN1", + "evidence": ["Definitive"], + "chrom": "chr16", + "start_hg38": 66490396, + "stop_hg38": 66490466, + "start_hg19": 66524299, + "stop_hg19": 66524369, + "start_t2t": 72284666, + "stop_t2t": 72284761, + "disease": "Spinocerebellar ataxia type 31", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 31 (SCA31) is a very rare subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by the late-onset of cerebral ataxia, dysarthria and horizontal gaze nystagmus, and that is occasionally accompanied by pyramidal signs, tremor, decreased vibration sense and hearing difficulties [@mondo:0007296].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Has been found in Japanese populations [@omim:117210] and then once respectively in a Korean and a Chinese family [@pmid:36563608].", + "age_onset": "Typical: 56-62 [@pmid:36563608]; Range: 8-83 [@pmid:23331413].", + "age_onset_min": 8.0, + "age_onset_max": 83.0, + "typ_age_onset_min": 56.0, + "typ_age_onset_max": 62.0, + "details": "This locus is a novel STR-containing insertion, not present in reference genome; the pathogenic threshold (110-760) is based on the pure repeat of the pathogenic motif within the insertion [@pmid:19878914].", + "detection": "RP-PCR has accurately detected this insertion [@pmid:22992774], while long-read sequencing has resolved size and motif architecture [@pmid:36289212].", + "mechanism": "GoF", + "mechanism_detail": "RNA toxicity and gain of function leading to neurodegeneration [@pmid:36371266]. Role in heterochromatin or chromosomal structure theorized [@omim:117210].", + "year": "2009 [@pmid:19878914]", + "location_in_gene": "Intron 4/4", + "gene_strand": "+", + "reference_motif_reference_orientation": ["AATAA"], + "pathogenic_motif_reference_orientation": ["TGGAA", "TAGAA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AAATG", "AGAAA", "ATAAG", "TAAAC", "TAACA", "TACAA", "TCAAA", "TGCAA"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AATGG", "AATAG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["AAAAA", "AAAAC", "AAATG", "AAAAG", "AAGAT", "AAACT", "AACAT", "AATAC", "AAATC", "AATGC"], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 110, + "pathogenic_max": 760, + "motif_len": 5, + "ref_copies": 14.4, + "novel": "novel", + "gard": ["9975"], + "genereviews": ["NBK535148"], + "malacard": ["SPN103"], + "medgen": ["348439"], + "mondo": ["0007296"], + "omim": ["117210"], + "orphanet": ["217012"], + "gnomad": ["BEAN1"], + "stripy": ["BEAN1"], + "tr_atlas": ["TR141992"], + "webstr_hg38": ["812447", "5971756"], + "webstr_hg19": ["STR_539736"], + "locus_tags": ["anticipation", "motif_affects_onset", "motif_affects_penetrance"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["pmid:36563608", "pmid:23331413", "pmid:36371266", "omim:117210", "pmid:19878914", "mondo:0007296"], + "additional_literature": ["pmid:41841436", "pmid:41426430", "pmid:40765612", "pmid:40488180", "pmid:38961870", "pmid:38152578", "pmid:37848721", "pmid:36970617", "pmid:36092952", "pmid:35084690", "pmid:33785066", "pmid:33431896", "pmid:32066831", "pmid:31737797", "pmid:29111027", "pmid:28343865", "pmid:24215022", "pmid:23607545"] +}, +{ + "id": "FTDALS1_C9orf72", + "disease_id": "FTDALS1", + "gene": "C9orf72", + "evidence": ["Definitive"], + "chrom": "chr9", + "start_hg38": 27573484, + "stop_hg38": 27573546, + "start_hg19": 27573482, + "stop_hg19": 27573544, + "start_t2t": 27584063, + "stop_t2t": 27584155, + "disease": "Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS)", + "inheritance": ["AD"], + "association_type": ["Mendelian", "Risk"], + "disease_description": "Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:31315673]. Related individuals to patients with C9orf72-ALS appear at an increased risk of disease regardless of carrier status [@pmid:38149039; @pmid:39315390]. C9orf72-FTD is estimated to be 0.04-134:100,000 [@genereviews:NBK268647], and by our estimates 0.65-1.56/100,000 for C9orf72-ALS. The expansion has been found across ethnicities/ancestries, with population-dependent prevalence, highest in those with northern European ancestry [@genereviews:NBK268647].", + "age_onset": "Typical: 50-64; Range: 20-91 [@genereviews:NBK268647].", + "age_onset_min": 20.0, + "age_onset_max": 91.0, + "typ_age_onset_min": 50.0, + "typ_age_onset_max": 64.0, + "details": "FTD and ALS form a clinical spectrum [@pmid:37388914; @pmid:22406228]. The clinical ranges of the C9orf72 locus remain ambiguous [@stripy:C9ORF72][@pmid:41951733]: most healthy controls have alleles up to 24 repeats [@pmid:28319737] yet 24-30 repeats are associated with ALS [@pmid:31315673] and while 60 repeats is frequently used as a threshold for uncertain alleles, the exact threshold of pathogenicity remains unclear [@genereviews:NBK268647; @pmid:38099605]. Repeats of 80 motifs and lower appear to have delayed onset for any phenotype [@pmid:28319737]. >250 repeats are associated with a full FTD/ALS disease state [@pmid:31048495], but pathogenic alleles can range from 30 to more than 4000 repeats [@pmid:38099605; @pmid:39709476]. Somatic C9orf72 repeat expansions may emerge de novo in CNS tissue from alleles below the pathogenic range, potentially contributing to sporadic ALS/FTD [@pmid:41986690]. Penetrance appears to also be age-dependent, with environmental factors and specific phenotypes associated with sex and age at onset [@pmid:28522837]. Methylation appears to increase with expansion length and age [@pmid:39709476], and C9orf72 promoter hypermethylation has been observed in expansion carriers [@pmid:42222887]. ALS caused by repeat expansions in C9orf72 generally has an earlier disease onset and faster progression than other ALS presentations [@pmid:39226712]. C9orf72 expansions have been associated with reduced thalamic volume in undiagnosed carriers, and plasma neurofilament light chain has an approximately linear association with repeat count and motor neuron disease risk [@pmid:41951733; @pmid:42095061]. Pathogenic C9orf72 repeat expansions have also been identified in ambiguous late onset behavioral or psychiatric like presentations including executive deficits, apathy, and stereotyped behavior [@pmid:42158267].", + "detection": "Bidirectional RP-PCR is typically used for detection [@pmid:21944778]. Large pathogenic expansions are difficult to size exactly by PCR, so Southern blot is used to better estimate size [@pmid:23566336], while long-read sequencing provides direct sizing and sequence characterization [@pmid:30126445].", + "mechanism": "Ambiguous", + "mechanism_detail": "The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA/DNA hybrids (R-loops). The structural polymorphism causes a repeat length-dependent accumulation of transcripts aborted in the HRE region [@omim:105500]. Additional mechanisms theorized include protein loss-of-function and RNA gain-of-function [@pmid:37847372]. Multiple cell types in the prefrontal cortex, including oligodendrocytes, microglia, astrocytes, and neurons, appear impacted during pathogenesis [@pmid:39999167]. Drosophila model-system evidence suggests that RAN translated poly(GR) may contribute to toxicity by activating the integrated stress response through eIF2α phosphorylation and promoting stress granule accumulation [@pmid:42087256]. C9orf72 repeat expansions are associated with reduced C9orf72 expression in multiple ALS tissues and altered splicing of the exon 1a isoform [@pmid:42145639]. Reduced C9orf72 expression has also been observed in peripheral blood immune cells from C9orf72-associated ALS, with C9-ALS showing distinct monocyte activation signatures. In ALS spinal cord, activated myeloid cells expressing complement, lipid-processing, and phagocytic genes occur in regions with motor neuron loss and TDP-43 pathology [@pmid:42135512].", + "year": "2011 [@pmid:21944778]", + "location_in_gene": "Intron 1 or 5' UTR depending on transcript", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GGCCCC"], + "pathogenic_motif_reference_orientation": ["GGCCCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCGGGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 23, + "intermediate_min": 24, + "intermediate_max": 30, + "pathogenic_min": 31, + "pathogenic_max": 4088, + "motif_len": 6, + "ref_copies": 10.8, + "novel": "ref", + "gard": ["18396"], + "genereviews": ["NBK268647"], + "malacard": ["FRN044"], + "medgen": ["1830423"], + "mondo": ["0007105"], + "omim": ["105500"], + "orphanet": ["275872"], + "gnomad": ["C9ORF72"], + "stripy": ["C9ORF72"], + "tr_atlas": ["TR92417"], + "webstr_hg38": ["5877863", "1502453"], + "webstr_hg19": ["STR_1475506"], + "locus_tags": ["length_affects_phenotype", "length_affects_onset"], + "disease_tags": ["phenotypic_spectrum"], + "references": ["genereviews:NBK268647", "omim:105500", "pmid:37847372", "pmid:39999167", "pmid:37388914", "pmid:22406228", "stripy:C9ORF72", "pmid:41951733", "pmid:28319737", "pmid:31315673", "pmid:38099605", "pmid:31048495", "pmid:39709476", "pmid:41986690", "pmid:28522837", "pmid:39226712", "pmid:38149039", "pmid:39315390", "pmid:21944778", "pmid:39349043", "pmid:41074692", "pmid:41957010"], + "additional_literature": ["pmid:42222887", "pmid:42221822", "pmid:42211284", "pmid:42160515", "pmid:42158267", "pmid:42147445", "pmid:42145639", "pmid:42135512", "pmid:42095061", "pmid:42087256", "pmid:42033225", "pmid:41995858", "pmid:41993388", "pmid:41987036", "pmid:41961863", "pmid:41928938", "pmid:41917466", "pmid:41884597", "pmid:41856038", "pmid:41810938", "pmid:41799019", "pmid:41787388", "pmid:41766077", "pmid:41763422", "pmid:41762523", "pmid:41760955", "pmid:41757350", "pmid:41752089", "pmid:41751955", "pmid:41727102", "pmid:41717003", "pmid:41692171", "pmid:41665027", "pmid:41658940", "pmid:41643661", "pmid:41643021", "pmid:41640102", "pmid:41623487", "pmid:41612618", "pmid:41500252", "pmid:41440030", "pmid:41437053", "pmid:41426430", "pmid:41423553", "pmid:41394713", "pmid:41394638", "pmid:41379346", "pmid:41366786", "pmid:41359433", "pmid:41358323", "pmid:41294820", "pmid:41283823", "pmid:41278665", "pmid:41271630", "pmid:41269363", "pmid:41256634", "pmid:41240362", "pmid:41216140", "pmid:41196070", "pmid:41149812", "pmid:41149783", "pmid:41141812", "pmid:41137727", "pmid:41087751", "pmid:41063344", "pmid:41060790", "pmid:41040221", "pmid:41030957", "pmid:41025901", "pmid:41024438", "pmid:41009775", "pmid:41006764", "pmid:41005474", "pmid:41004400", "pmid:40992079", "pmid:40981770", "pmid:40966720", "pmid:40952044", "pmid:40930530", "pmid:40908789", "pmid:40891053", "pmid:40888599", "pmid:40875372", "pmid:40865525", "pmid:40832293", "pmid:40790269", "pmid:40776416", "pmid:40767591", "pmid:40765612", "pmid:40763713", "pmid:40758885", "pmid:40746751", "pmid:40709577", "pmid:40682810", "pmid:40621734", "pmid:40585812", "pmid:40581653", "pmid:40541176", "pmid:40536530", "pmid:40513650", "pmid:40504117", "pmid:40478310", "pmid:40426848", "pmid:40424855", "pmid:40411682", "pmid:40375307", "pmid:40349639", "pmid:40349338", "pmid:40346885", "pmid:40260680", "pmid:40250093", "pmid:40207633", "pmid:40203833", "pmid:40196659", "pmid:40150989", "pmid:40138021", "pmid:40073860", "pmid:40053600", "pmid:40050010", "pmid:40027671", "pmid:40000803", "pmid:39975241", "pmid:39957101", "pmid:39945490", "pmid:39920674", "pmid:39913612", "pmid:39894561", "pmid:39893487", "pmid:39869842", "pmid:39809899", "pmid:39779704", "pmid:39779681", "pmid:39764003", "pmid:39747573", "pmid:39730482", "pmid:39722074", "pmid:39711523", "pmid:39703094", "pmid:39670345", "pmid:39669124", "pmid:39638345", "pmid:39621905", "pmid:39589881", "pmid:39581338", "pmid:39569145", "pmid:39437787", "pmid:39417137", "pmid:39382125", "pmid:39345637", "pmid:39339364", "pmid:39323877", "pmid:39316747", "pmid:39316038", "pmid:39311028", "pmid:39289761", "pmid:39288267", "pmid:39282230", "pmid:39268612", "pmid:39270726", "pmid:39260140", "pmid:39256877", "pmid:39254359", "pmid:39253499", "pmid:39246336", "pmid:39233852", "pmid:39229486", "pmid:39222049", "pmid:39181135", "pmid:39146722", "pmid:39106320", "pmid:39098187", "pmid:39088455", "pmid:39059407", "pmid:39058450", "pmid:39056697", "pmid:39042693", "pmid:39000564", "pmid:38935506", "pmid:38915937", "pmid:38902980", "pmid:38896262", "pmid:38884646", "pmid:38876108", "pmid:38860430", "pmid:38852112", "pmid:38847891", "pmid:38799643", "pmid:38796984", "pmid:38753768", "pmid:38751620", "pmid:38746326", "pmid:38734896", "pmid:38722513", "pmid:38684907", "pmid:38667292", "pmid:38658168", "pmid:38641715", "pmid:38625400", "pmid:38621131", "pmid:38615685", "pmid:38613988", "pmid:38606777", "pmid:38585915", "pmid:38568044", "pmid:38556190", "pmid:38495583", "pmid:38464738", "pmid:38444607", "pmid:38431841", "pmid:38412259", "pmid:38397958", "pmid:38394210", "pmid:38376483", "pmid:38295729", "pmid:38312023", "pmid:38301895", "pmid:38260655", "pmid:38242117", "pmid:38234062", "pmid:38229533", "pmid:38191789", "pmid:38168370", "pmid:38168171", "pmid:38112783", "pmid:38110419", "pmid:38092738", "pmid:38064514", "pmid:38019311", "pmid:38009843", "pmid:37948524", "pmid:37891975", "pmid:37861203", "pmid:37845749", "pmid:37839080", "pmid:37827570", "pmid:37808871", "pmid:37791472", "pmid:37763163", "pmid:37736756", "pmid:37723585", "pmid:37714849", "pmid:37693322", "pmid:37686239", "pmid:37675986", "pmid:37648532", "pmid:37644512", "pmid:37590144", "pmid:37574738", "pmid:37548032", "pmid:37545231", "pmid:37527465", "pmid:37511014", "pmid:37471224", "pmid:37461319", "pmid:37450566", "pmid:37421883", "pmid:37399804", "pmid:37386798", "pmid:37379724", "pmid:37365312", "pmid:37339631", "pmid:37334257", "pmid:37333274", "pmid:37333144", "pmid:37332610", "pmid:37317656", "pmid:37294668", "pmid:37288312", "pmid:37223130", "pmid:37202167", "pmid:37178170", "pmid:37173134", "pmid:37147520", "pmid:37146135", "pmid:37138766", "pmid:37138765", "pmid:37133535", "pmid:37107688", "pmid:37080969", "pmid:37073950", "pmid:37043475", "pmid:37015082", "pmid:37010807", "pmid:37006326", "pmid:36963214", "pmid:36936421", "pmid:36857431", "pmid:36823368", "pmid:36822200", "pmid:36799407", "pmid:36764521", "pmid:36711601", "pmid:36650645", "pmid:36638803", "pmid:36619668", "pmid:36549973", "pmid:36515702", "pmid:36511680", "pmid:36511398", "pmid:36494425", "pmid:36482247", "pmid:36458975", "pmid:36454749", "pmid:36446586", "pmid:36443488", "pmid:36438488", "pmid:36409902", "pmid:36379394", "pmid:36373318", "pmid:36345033", "pmid:36322143", "pmid:36308529", "pmid:36271076", "pmid:36252286", "pmid:36226890", "pmid:36220889", "pmid:36219176", "pmid:36217158", "pmid:36202819", "pmid:36151083", "pmid:36148898", "pmid:36130523", "pmid:36108486", "pmid:36103513", "pmid:38933387", "pmid:36070099", "pmid:36008116", "pmid:35989899", "pmid:35974122", "pmid:35933239", "pmid:35908282", "pmid:35906014", "pmid:35903771", "pmid:35895140", "pmid:35876881", "pmid:35869263", "pmid:35843530", "pmid:35813024", "pmid:35793625", "pmid:35766328", "pmid:35752680", "pmid:35746899", "pmid:35726380", "pmid:35675776", "pmid:35661131", "pmid:35633169", "pmid:35625816", "pmid:35599735", "pmid:35594156", "pmid:35592494", "pmid:35589711", "pmid:35568435", "pmid:35525134", "pmid:35462091", "pmid:35383205", "pmid:35379876", "pmid:35379698", "pmid:35314728", "pmid:35295181", "pmid:35259014", "pmid:35189395", "pmid:35182509", "pmid:35171477", "pmid:35152451", "pmid:35096836", "pmid:35091648", "pmid:35052416", "pmid:35047667", "pmid:35026048", "pmid:35007998", "pmid:34978044", "pmid:34949835", "pmid:34915153", "pmid:34853325", "pmid:34848561", "pmid:34827542", "pmid:34791698", "pmid:34723963", "pmid:34717271", "pmid:34705518", "pmid:34687211", "pmid:34677935", "pmid:34654821", "pmid:34638725", "pmid:34573259", "pmid:34542927", "pmid:34534264", "pmid:34526954", "pmid:34475377", "pmid:34450161", "pmid:34440384", "pmid:34435379", "pmid:34431456", "pmid:34404558", "pmid:34397416", "pmid:34389718", "pmid:34389711", "pmid:34386583", "pmid:34382491", "pmid:34376242", "pmid:34328616", "pmid:34318620", "pmid:34310040", "pmid:34305575", "pmid:34297726", "pmid:34233951", "pmid:34229542", "pmid:34209673", "pmid:34187866", "pmid:34179866", "pmid:34174288", "pmid:34172817", "pmid:34170347", "pmid:34168085", "pmid:34157654", "pmid:34152475", "pmid:34140881", "pmid:34133945", "pmid:34118929", "pmid:34099711", "pmid:34093394", "pmid:34051439", "pmid:34048588", "pmid:33977144", "pmid:33967699", "pmid:33935096", "pmid:33906932", "pmid:33892814", "pmid:33889947", "pmid:33857770", "pmid:33837088", "pmid:33833668", "pmid:33830997", "pmid:33815737", "pmid:33789100", "pmid:33788382", "pmid:33741069", "pmid:33739284", "pmid:33737586", "pmid:33730968", "pmid:33726839", "pmid:33709219", "pmid:33705846", "pmid:33663561", "pmid:33661518", "pmid:33619157", "pmid:33601107", "pmid:33588953", "pmid:33558503", "pmid:33554115", "pmid:33482083", "pmid:33431483", "pmid:33414559", "pmid:33409820", "pmid:33378537", "pmid:33377399", "pmid:33376800", "pmid:33363944", "pmid:33329355", "pmid:33300868", "pmid:33276461", "pmid:33253636", "pmid:33196168", "pmid:33168090", "pmid:33168078", "pmid:33149115", "pmid:33131137", "pmid:33129345", "pmid:33123074", "pmid:33058338", "pmid:33055142", "pmid:33022226", "pmid:32989102", "pmid:32961393", "pmid:32958650", "pmid:32954321", "pmid:32949047", "pmid:32921502", "pmid:32894207", "pmid:32878979", "pmid:32865792", "pmid:32845284", "pmid:32843153", "pmid:32843152", "pmid:32830871", "pmid:32823188", "pmid:32821252", "pmid:32769055", "pmid:32759310", "pmid:32755582", "pmid:32721467", "pmid:32683569", "pmid:32675418", "pmid:32638105", "pmid:32628322", "pmid:32554322", "pmid:32521185", "pmid:32504093", "pmid:32500377", "pmid:32485711", "pmid:32483373", "pmid:32441885", "pmid:32421156", "pmid:32410933", "pmid:32385536", "pmid:32375063", "pmid:32375043", "pmid:32347002", "pmid:32338076", "pmid:32296747", "pmid:32284607", "pmid:32281118", "pmid:32278549", "pmid:32226938", "pmid:32223927", "pmid:32184029", "pmid:32180125", "pmid:32175624", "pmid:32151952", "pmid:32132225", "pmid:32125773", "pmid:32123048", "pmid:32119645", "pmid:32100453", "pmid:32093728", "pmid:32084385", "pmid:32082115", "pmid:32070418", "pmid:32059759", "pmid:32042907", "pmid:32035967", "pmid:32035847", "pmid:32000838", "pmid:31991801", "pmid:31930538", "pmid:31925813", "pmid:31858749", "pmid:31852251", "pmid:31847700", "pmid:31843021", "pmid:31836585", "pmid:31831332", "pmid:31810584", "pmid:31800202", "pmid:31791419", "pmid:31702465", "pmid:31676125", "pmid:31651360", "pmid:31649034", "pmid:31647549", "pmid:31642962", "pmid:31637556", "pmid:31633109", "pmid:31625563", "pmid:31624333", "pmid:31619481", "pmid:31594549", "pmid:31587919", "pmid:31586943", "pmid:31582231", "pmid:31579943", "pmid:31578297", "pmid:31561355", "pmid:31559531", "pmid:31551693", "pmid:31530427", "pmid:31499409", "pmid:31475037", "pmid:31444357", "pmid:31439573", "pmid:31432691", "pmid:31375896", "pmid:31358992", "pmid:31327044", "pmid:31325016", "pmid:31205123", "pmid:31176718", "pmid:31156370", "pmid:31127772", "pmid:31086314", "pmid:31041398", "pmid:31036086", "pmid:31019099", "pmid:31019093", "pmid:31009932", "pmid:31007077", "pmid:30992335", "pmid:30992141", "pmid:30992063", "pmid:30985904", "pmid:30981631", "pmid:30979436", "pmid:30945056", "pmid:30938419", "pmid:30863279", "pmid:30861516", "pmid:30859373", "pmid:30846540", "pmid:30790403", "pmid:30777654", "pmid:30767771", "pmid:30739198", "pmid:30714955", "pmid:30711674", "pmid:30685122", "pmid:30643298", "pmid:30617627", "pmid:30617154", "pmid:30610877", "pmid:30554355", "pmid:30550541", "pmid:30530974", "pmid:30528349", "pmid:30527999", "pmid:30454072", "pmid:30447080", "pmid:30396881", "pmid:30356970", "pmid:30349864", "pmid:30347338", "pmid:30337192", "pmid:30336474", "pmid:30320585", "pmid:30312838", "pmid:30310141", "pmid:30261505", "pmid:30252044", "pmid:30239641", "pmid:30233460", "pmid:30213863", "pmid:30210275", "pmid:30150298", "pmid:30126445", "pmid:30109267", "pmid:30099204", "pmid:30093141", "pmid:30090657", "pmid:30075745", "pmid:30023173", "pmid:30022074", "pmid:29973287", "pmid:29957385", "pmid:29942091", "pmid:29912891", "pmid:29895397", "pmid:29889265", "pmid:29866399", "pmid:29861044", "pmid:29859640", "pmid:29855382", "pmid:29848387", "pmid:29801887", "pmid:29761121", "pmid:29750243", "pmid:29748150", "pmid:29738460", "pmid:29628143", "pmid:29610297", "pmid:29598923", "pmid:29525180", "pmid:29507424", "pmid:29493298", "pmid:29480190", "pmid:29480183", "pmid:29479499", "pmid:29476165", "pmid:29449030", "pmid:29441485", "pmid:29439323", "pmid:29400714", "pmid:29380049", "pmid:29367641", "pmid:29352617", "pmid:29352102", "pmid:29316893", "pmid:29302060", "pmid:29281254", "pmid:29274668", "pmid:29264395", "pmid:29222490", "pmid:29216908", "pmid:29196813", "pmid:29170628", "pmid:29166782", "pmid:29149615", "pmid:29131108", "pmid:29113975", "pmid:29095328", "pmid:29080331", "pmid:29056323", "pmid:29055436", "pmid:29049464", "pmid:29036691", "pmid:28973350", "pmid:28889094", "pmid:28887402", "pmid:28827593", "pmid:28808785", "pmid:28803727", "pmid:28749476", "pmid:28720882", "pmid:28714954", "pmid:28677678", "pmid:28666709", "pmid:28660252", "pmid:28642336", "pmid:28637276", "pmid:28614712", "pmid:28606110", "pmid:28570551", "pmid:28551275", "pmid:28550099", "pmid:28542233", "pmid:28539470", "pmid:28527524", "pmid:28508101", "pmid:28491898", "pmid:28482638", "pmid:28481984", "pmid:28462717", "pmid:28452351", "pmid:28439722", "pmid:28431575", "pmid:28420437", "pmid:28408402", "pmid:28387671", "pmid:28365006", "pmid:28356511", "pmid:28351931", "pmid:28334866", "pmid:28322003", "pmid:28320191", "pmid:28306503", "pmid:28222900", "pmid:28197542", "pmid:28192553", "pmid:28160950", "pmid:28158451", "pmid:28132891", "pmid:28131227", "pmid:28124431", "pmid:28116236", "pmid:28105640", "pmid:28103472", "pmid:28089114", "pmid:28088213", "pmid:28010125", "pmid:28003435", "pmid:27936955", "pmid:27933757", "pmid:27875531", "pmid:27797809", "pmid:27796305", "pmid:27790088", "pmid:27688759", "pmid:27739539", "pmid:27773700", "pmid:27595458", "pmid:27768896", "pmid:27756805", "pmid:27720481", "pmid:27732842", "pmid:27671483", "pmid:27666590", "pmid:27663272", "pmid:27652840", "pmid:27646412", "pmid:27623008", "pmid:27617292", "pmid:27516603", "pmid:27480424", "pmid:27473499", "pmid:27461252", "pmid:27413586", "pmid:27400454", "pmid:27388677", "pmid:27375918", "pmid:27369896", "pmid:27334615", "pmid:27327087", "pmid:27288208", "pmid:27274540", "pmid:27245636", "pmid:27241037", "pmid:27195002", "pmid:27193190", "pmid:27151634", "pmid:27112497", "pmid:27097283", "pmid:27079381", "pmid:26998601", "pmid:26979938", "pmid:26967212", "pmid:26931465", "pmid:26925510", "pmid:26919046", "pmid:26915990", "pmid:26903389", "pmid:26878348", "pmid:26862832", "pmid:26839080", "pmid:26810537", "pmid:26785370", "pmid:26777436", "pmid:26769963", "pmid:26746986", "pmid:26735706", "pmid:26733254", "pmid:26728149", "pmid:26725464", "pmid:26723138", "pmid:28337409", "pmid:26691640", "pmid:26690922", "pmid:26674655", "pmid:26637797", "pmid:26632347", "pmid:26599997", "pmid:26584779", "pmid:26551617", "pmid:26547294", "pmid:26538301", "pmid:26526532", "pmid:26497991", "pmid:26481318", "pmid:26463209", "pmid:26437865", "pmid:29213991", "pmid:26408000", "pmid:26401819", "pmid:26374446", "pmid:26350237", "pmid:26348842", "pmid:26347457", "pmid:26308983", "pmid:26308899", "pmid:26308891", "pmid:26304661", "pmid:26275564", "pmid:26254955", "pmid:26234378", "pmid:26233805", "pmid:26174152", "pmid:26166205", "pmid:26146826", "pmid:26142124", "pmid:26108573", "pmid:26099177", "pmid:26095883", "pmid:26083476", "pmid:26044557", "pmid:26031661", "pmid:26022924", "pmid:26016851", "pmid:25977373", "pmid:25943890", "pmid:25943887", "pmid:25934183", "pmid:25835037", "pmid:25795648", "pmid:25791939", "pmid:25788698", "pmid:25756586", "pmid:25732802", "pmid:25716178", "pmid:25712133", "pmid:25637145", "pmid:25618255", "pmid:25617006", "pmid:25595499", "pmid:25585530", "pmid:25531686", "pmid:25467142", "pmid:25457023", "pmid:25442110", "pmid:25436637", "pmid:25433797", "pmid:25433461", "pmid:25388784", "pmid:25377888", "pmid:25326098", "pmid:25319030", "pmid:25308964", "pmid:25284081", "pmid:25281017", "pmid:25273996", "pmid:25248608", "pmid:25239657", "pmid:25210488", "pmid:25207541", "pmid:25203513", "pmid:25185840", "pmid:25182743", "pmid:25179228", "pmid:25173361", "pmid:25158292", "pmid:25156163", "pmid:25147206", "pmid:25132468", "pmid:25123918", "pmid:25120191", "pmid:25115936", "pmid:25111021", "pmid:25108559", "pmid:25098532", "pmid:25085782", "pmid:25081482", "pmid:25034271", "pmid:24950788", "pmid:24928930", "pmid:24908669", "pmid:24908169", "pmid:24898647", "pmid:24866401", "pmid:24866055", "pmid:24861139", "pmid:24819148", "pmid:24806409", "pmid:24803912", "pmid:24798095", "pmid:24756204", "pmid:24733620", "pmid:24706941", "pmid:24704492", "pmid:24667415", "pmid:24650794", "pmid:24612676", "pmid:24598541", "pmid:24573903", "pmid:24559645", "pmid:24549040", "pmid:24530272", "pmid:24445987", "pmid:24442578", "pmid:24439166", "pmid:24417314", "pmid:24387986", "pmid:24387985", "pmid:24385136", "pmid:24378086", "pmid:24363131", "pmid:24355526", "pmid:24329881", "pmid:24319645", "pmid:24309270", "pmid:24286341", "pmid:24269022", "pmid:24269018", "pmid:24252571", "pmid:24252525", "pmid:24248382", "pmid:24212388", "pmid:24179835", "pmid:24170096", "pmid:24169076", "pmid:24166615", "pmid:24154603", "pmid:24139042", "pmid:24129584", "pmid:24126854", "pmid:24121957", "pmid:24107864", "pmid:24096617", "pmid:24080172", "pmid:24077574", "pmid:24068985", "pmid:24057670", "pmid:24053774", "pmid:24052799", "pmid:24027057", "pmid:24011653", "pmid:23998997", "pmid:23987827", "pmid:23973441", "pmid:23962495", "pmid:23922030", "pmid:23894576", "pmid:23884045", "pmid:23870417", "pmid:23869403", "pmid:23845100", "pmid:23836460", "pmid:23836290", "pmid:23818065", "pmid:23771489", "pmid:23731538", "pmid:23720273", "pmid:23695224", "pmid:23686809", "pmid:23597494", "pmid:23588498", "pmid:23588422", "pmid:23587638", "pmid:23566336", "pmid:23553481", "pmid:23551834", "pmid:23548882", "pmid:23473366", "pmid:23437264", "pmid:23435409", "pmid:23434116", "pmid:23423380", "pmid:23421625", "pmid:23415312", "pmid:23413259", "pmid:23383383", "pmid:23381195", "pmid:23358603", "pmid:23352322", "pmid:23338750", "pmid:23338682", "pmid:23329412", "pmid:23284068", "pmid:23273600", "pmid:23261768", "pmid:23254636", "pmid:23216213", "pmid:23199140", "pmid:23151261", "pmid:23141412", "pmid:23117491", "pmid:23116878", "pmid:23107433", "pmid:23088937", "pmid:23085936", "pmid:23084342", "pmid:23063644", "pmid:23053136", "pmid:23053135", "pmid:23036583", "pmid:23035801", "pmid:23016833", "pmid:23012445", "pmid:23006986", "pmid:22993125", "pmid:22985429", "pmid:22964911", "pmid:22936364", "pmid:22918453", "pmid:22898310", "pmid:22892647", "pmid:22878164", "pmid:22875087", "pmid:22875086", "pmid:22843265", "pmid:22840558", "pmid:22818528", "pmid:22815561", "pmid:22766732", "pmid:22766072", "pmid:22742426", "pmid:22739338", "pmid:22727276", "pmid:22721568", "pmid:22720079", "pmid:22708871", "pmid:22702520", "pmid:22692064", "pmid:22673113", "pmid:22650353", "pmid:22645277", "pmid:22637471", "pmid:22637429", "pmid:22571983", "pmid:22564974", "pmid:22550220", "pmid:22507827", "pmid:22502998", "pmid:22499346", "pmid:22483864", "pmid:22459598", "pmid:22426854", "pmid:22418734", "pmid:22410647", "pmid:22406229", "pmid:22399793", "pmid:22366794", "pmid:22366793", "pmid:22366792", "pmid:22366791", "pmid:22343411", "pmid:22305801", "pmid:22300876", "pmid:22300873", "pmid:22228244", "pmid:22216764", "pmid:22181065", "pmid:22154785", "pmid:22101323", "pmid:22083254", "pmid:21944779"] +}, +{ + "id": "SCA6_CACNA1A", + "disease_id": "SCA6", + "gene": "CACNA1A", + "evidence": ["Definitive"], + "chrom": "chr19", + "start_hg38": 13207858, + "stop_hg38": 13207898, + "start_hg19": 13318672, + "stop_hg19": 13318712, + "start_t2t": 13333136, + "stop_t2t": 13333176, + "disease": "Spinocerebellar ataxia type 6", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 6 (SCA6) is the most common subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by late-onset and slowly progressive gait ataxia and other cerebellar signs such as impaired muscle coordination and nystagmus [@mondo:0008457]. Ao et al. have proposed that this expansion may have effects on chronotype, differing by sex and menopausal status, as well as depression severity [@pmid:41358280].", + "hpo_terms": null, + "prevalence": "2.65/100000", + "prevalence_details": "13-15% of global SCA prevalence, estimated to be 0.02-31/100,000 [@genereviews:NBK1140; @pmid:29100084]: resultant estimate is 0.3-5/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1140].", + "age_onset": "Typical: 43-52 [@genereviews:NBK1140]; Range: 16 [@pmid:23331413] - 73 [@genereviews:NBK1140].", + "age_onset_min": 16.0, + "age_onset_max": 73.0, + "typ_age_onset_min": 43.0, + "typ_age_onset_max": 52.0, + "details": "The intermediate range (19-20 motifs) [@pmid:39996131; @genereviews:NBK1140] can be associated with a premutation, reduced penetrance, atypical phenotype, or a disease state when homozygous [@genereviews:NBK1140]. When the longer allele is > 22 motifs, the short allele does not play a role in pathogenicity/age of onset, but expansions of 21-22 motifs have age of onset influenced by the smaller allele [@pmid:39996131]. For individuals with a longest allele of 19-20, the presence of a second allele of 19-20 likely increases the risk of developing SCA6 [@pmid:39996131]. Undiagnosed carriers of pathogenic range repeats in CACNA1A exhibit significant cerebellar volume loss and elevated NEFL levels before clinical diagnosis, also seen in other loci [@pmid:41951733].", + "detection": "Expansions have been detected by PCR fragment analysis [@pmid:35573049].", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyglutamine expansions associated with increased expression of altered product leading to impaired gene binding and transcription factor function as well as cellular toxicity [@genereviews:NBK1140].", + "year": "1997 [@pmid:8988170]", + "location_in_gene": "Coding, Last Exon: 47 or 48", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CTG"], + "pathogenic_motif_reference_orientation": ["CTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 18, + "intermediate_min": 19, + "intermediate_max": 20, + "pathogenic_min": 21, + "pathogenic_max": 33, + "motif_len": 3, + "ref_copies": 13.3, + "novel": "ref", + "gard": ["10351"], + "genereviews": ["NBK1140"], + "malacard": ["SPN309"], + "medgen": ["148458"], + "mondo": ["0008457"], + "omim": ["183086"], + "orphanet": ["98758"], + "gnomad": ["CACNA1A"], + "stripy": ["CACNA1A"], + "tr_atlas": ["TR154515"], + "webstr_hg38": ["5624835"], + "webstr_hg19": ["Expansion_SCA6/CACNA1A"], + "locus_tags": ["length_affects_phenotype", "length_affects_penetrance", "length_affects_onset"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK1140", "pmid:23331413", "doi:10.1212/NXG.0000000000200245", "pmid:41951733", "pmid:29100084", "pmid:8988170", "mondo:0008457", "pmid:41358280"], + "additional_literature": ["pmid:42038259", "pmid:41951733", "pmid:41771688", "pmid:41762523", "pmid:41612618", "pmid:41082794", "pmid:41009775", "pmid:40906330", "pmid:40900235", "pmid:40879304", "pmid:40746751", "pmid:40488180", "pmid:40189664", "pmid:39812846", "pmid:39571249", "pmid:39152783", "pmid:39048885", "pmid:38961870", "pmid:38227102", "pmid:38165578", "pmid:38152578", "pmid:37848721", "pmid:37307504", "pmid:37301203", "pmid:36618024", "pmid:36599645", "pmid:36530930", "pmid:35962273", "pmid:35188716", "pmid:35182509", "pmid:35052497", "pmid:34647648", "pmid:34600502", "pmid:34565721", "pmid:34371182", "pmid:34159894", "pmid:33502644", "pmid:33121221", "pmid:32888184", "pmid:32822634", "pmid:31522753", "pmid:30891880", "pmid:30591349", "pmid:30342765", "pmid:30314815", "pmid:30120431", "pmid:30078120", "pmid:29959555", "pmid:29553382", "pmid:29367260", "pmid:29316893", "pmid:29249939", "pmid:29111027", "pmid:29057148", "pmid:28946818", "pmid:28782341", "pmid:28585930", "pmid:28444220", "pmid:28131213", "pmid:27979829", "pmid:27896316", "pmid:27848087", "pmid:27806289", "pmid:27412786", "pmid:27400454", "pmid:27333979", "pmid:26730403", "pmid:26377379", "pmid:26374734", "pmid:26354989", "pmid:26077168", "pmid:26054379", "pmid:25634432", "pmid:25624155", "pmid:25466696", "pmid:24780882", "pmid:24534762", "pmid:24486772", "pmid:24209901", "pmid:23423669", "pmid:23407676", "pmid:23368522", "pmid:23026538", "pmid:22520093", "pmid:26859398", "pmid:26676458", "pmid:21832228", "pmid:21550405", "pmid:20069235", "pmid:19631275", "pmid:19429075", "pmid:19259763", "pmid:19224313", "pmid:18949263", "pmid:18759344", "pmid:18687887", "pmid:18685131", "pmid:18684474", "pmid:18506570", "pmid:18418678", "pmid:18285829", "pmid:18074367", "pmid:17961920", "pmid:17682009", "pmid:17516099", "pmid:17420317", "pmid:16396623", "pmid:16389595", "pmid:16310805", "pmid:16000334", "pmid:15875905", "pmid:15747371", "pmid:15553088", "pmid:15148151", "pmid:15080863", "pmid:15026782", "pmid:14967767", "pmid:14966163", "pmid:14756671", "pmid:14534930", "pmid:12810491", "pmid:12764052", "pmid:12676347", "pmid:12614315", "pmid:12545428", "pmid:11939898", "pmid:11889231", "pmid:11839840", "pmid:11804332", "pmid:11717352", "pmid:11708993", "pmid:11448300", "pmid:11355155", "pmid:11341481", "pmid:11311290", "pmid:11176970", "pmid:11160961", "pmid:10369884", "pmid:11081813", "pmid:11030410", "pmid:10985694", "pmid:10964945", "pmid:10945665", "pmid:10942107", "pmid:10894992", "pmid:10785256", "pmid:10768629", "pmid:10766906", "pmid:10690991", "pmid:10674974", "pmid:10601803", "pmid:10453742", "pmid:10442462", "pmid:10369863", "pmid:10369828", "pmid:10366652", "pmid:10225349", "pmid:9973298", "pmid:9915947", "pmid:9879686", "pmid:9855520", "pmid:9779664", "pmid:9758625", "pmid:9741473", "pmid:9696528", "pmid:9674805", "pmid:9613852", "pmid:9600677", "pmid:9559993", "pmid:9507387", "pmid:9436730", "pmid:9385362", "pmid:9371901", "pmid:9371900", "pmid:9403486", "pmid:9403480", "pmid:9345107", "pmid:9339681", "pmid:9302278", "pmid:9311738", "pmid:9259275", "pmid:9259274", "pmid:10464657", "pmid:9043864"] +}, +{ + "id": "JBS_CBL", + "disease_id": "JBS", + "gene": "CBL", + "evidence": ["Definitive"], + "chrom": "chr11", + "start_hg38": 119206289, + "stop_hg38": 119206323, + "start_hg19": 119076999, + "stop_hg19": 119077033, + "start_t2t": 119226662, + "stop_t2t": 119226696, + "disease": "Jacobsen syndrome (FRAX11B fragile site)", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "A multiple congenital anomaly/intellectual disability contiguous gene syndrome caused by partial deletion of the long arm of chromosome 11 [@mondo:0007838].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "1/100,000 births; female/male ratio 2:1 [@pmid:19267933]. Found across ancestries/ethnicities [@omim:147791].", + "age_onset": "Condition at birth.", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "70% of individuals have 11 repeats [@pmid:7603564], but pathogenic expansion can span hundreds of motifs [@pmid:10767345]. The CGG repeat expansion can lead to a fragile site and subsequent deletion of 11q (shown in 2 cases) but total causality is unclear; intermediate alleles are associated with a premutation [@pmid:19267933].", + "detection": null, + "mechanism": "Hypermethylation", + "mechanism_detail": "DNA hypermethylation/11q deletion in sporadic cases [@pmid:38467784].", + "year": "1995 [@pmid:7603564]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CGG"], + "pathogenic_motif_reference_orientation": ["CGG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 79, + "intermediate_min": 80, + "intermediate_max": 100, + "pathogenic_min": 101, + "pathogenic_max": 300, + "motif_len": 3, + "ref_copies": 11.3, + "novel": "ref", + "gard": ["307"], + "genereviews": [], + "malacard": ["JCB001"], + "medgen": ["162878"], + "mondo": ["0007838"], + "omim": ["147791"], + "orphanet": ["2308"], + "gnomad": ["CBL"], + "stripy": ["CBL"], + "tr_atlas": ["TR112816"], + "webstr_hg38": ["6166081", "430025"], + "webstr_hg19": ["STR_266122"], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:38467784", "pmid:7603564", "pmid:10767345", "pmid:19267933", "omim:147791", "mondo:0007838"], + "additional_literature": ["pmid:41964119", "pmid:37422244", "pmid:22131879", "pmid:22084433", "pmid:16474167"] +}, +{ + "id": "MODY8_CEL", + "disease_id": "MODY8", + "gene": "CEL", + "evidence": ["Provisional"], + "chrom": "chr9", + "start_hg38": 133071177, + "stop_hg38": 133071737, + "start_hg19": 135946564, + "stop_hg19": 135947124, + "start_t2t": 145285333, + "stop_t2t": 145285861, + "disease": "Maturity-Onset Diabetes of the Young Type 8", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions [@genereviews:NBK500456]. In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype [@pmid:34850019]. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED) [@pmid:18544793].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265].", + "age_onset": "11-17 [@pmid:19760265]", + "age_onset_min": 11.0, + "age_onset_max": 17.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5 [@pmid:34850019]. One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential [@pmid:38483348]. Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse [@pmid:19760265]. Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs) [@pmid:39361122]. Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved [@pmid:21784842; @pmid:27650499; @pmid:33862081]. Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects [@pmid:38483348].", + "year": "2005", + "location_in_gene": "Exon 11", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG"], + "pathogenic_motif_reference_orientation": ["GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "SCA6_CACNA1A", - "disease_id": "SCA6", - "gene": "CACNA1A", - "evidence": [ - "Definitive" - ], - "chrom": "chr19", - "start_hg38": 13207858, - "stop_hg38": 13207898, - "start_hg19": 13318672, - "stop_hg19": 13318712, - "start_t2t": 13333136, - "stop_t2t": 13333176, - "disease": "Spinocerebellar ataxia type 6", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 6 (SCA6) is the most common subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by late-onset and slowly progressive gait ataxia and other cerebellar signs such as impaired muscle coordination and nystagmus [@mondo:0008457]. Ao et al. have proposed that this expansion may have effects on chronotype, differing by sex and menopausal status, as well as depression severity [@pmid:41358280].", - "hpo_terms": null, - "prevalence": "2.65/100000", - "prevalence_details": "13-15% of global SCA prevalence, estimated to be 0.02-31/100,000 [@genereviews:NBK1140; @pmid:29100084]: resultant estimate is 0.3-5/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1140].", - "age_onset": "Typical: 43-52 [@genereviews:NBK1140]; Range: 16 [@pmid:23331413] - 73 [@genereviews:NBK1140].", - "age_onset_min": 16, - "age_onset_max": 73, - "typ_age_onset_min": 43, - "typ_age_onset_max": 52, - "details": "The intermediate range (19-20 motifs) [@pmid:39996131; @genereviews:NBK1140] can be associated with a premutation, reduced penetrance, atypical phenotype, or a disease state when homozygous [@genereviews:NBK1140]. When the longer allele is > 22 motifs, the short allele does not play a role in pathogenicity/age of onset, but expansions of 21-22 motifs have age of onset influenced by the smaller allele [@pmid:39996131]. For individuals with a longest allele of 19-20, the presence of a second allele of 19-20 likely increases the risk of developing SCA6 [@pmid:39996131]. Undiagnosed carriers of pathogenic range repeats in CACNA1A exhibit significant cerebellar volume loss and elevated NEFL levels before clinical diagnosis, also seen in other loci [@pmid:41951733].", - "detection": "Expansions have been detected by PCR fragment analysis [@pmid:35573049].", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyglutamine expansions associated with increased expression of altered product leading to impaired gene binding and transcription factor function as well as cellular toxicity [@genereviews:NBK1140].", - "year": "1997 [@pmid:8988170]", - "location_in_gene": "Coding, Last Exon: 47 or 48", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CTG" - ], - "pathogenic_motif_reference_orientation": [ - "CTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 18, - "intermediate_min": 19, - "intermediate_max": 20, - "pathogenic_min": 21, - "pathogenic_max": 33, - "motif_len": 3, - "ref_copies": 13.3, - "novel": "ref", - "gard": [ - "10351" - ], - "genereviews": [ - "NBK1140" - ], - "malacard": [ - "SPN309" - ], - "medgen": [ - "148458" - ], - "mondo": [ - "0008457" - ], - "omim": [ - "183086" - ], - "orphanet": [ - "98758" - ], - "gnomad": [ - "CACNA1A" - ], - "stripy": [ - "CACNA1A" - ], - "tr_atlas": [ - "TR154515" - ], - "webstr_hg38": [ - "5624835" - ], - "webstr_hg19": [ - "Expansion_SCA6/CACNA1A" - ], - "locus_tags": [ - "length_affects_phenotype", - "length_affects_penetrance", - "length_affects_onset" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK1140", - "pmid:23331413", - "doi:10.1212/NXG.0000000000200245", - "pmid:41951733", - "pmid:29100084", - "pmid:8988170", - "mondo:0008457", - "pmid:41358280" - ], - "additional_literature": [ - "pmid:42038259", - "pmid:41951733", - "pmid:41771688", - "pmid:41762523", - "pmid:41612618", - "pmid:41082794", - "pmid:41009775", - "pmid:40906330", - "pmid:40900235", - "pmid:40879304", - "pmid:40746751", - "pmid:40488180", - "pmid:40189664", - "pmid:39812846", - "pmid:39571249", - "pmid:39152783", - "pmid:39048885", - "pmid:38961870", - "pmid:38227102", - "pmid:38165578", - "pmid:38152578", - "pmid:37848721", - "pmid:37307504", - "pmid:37301203", - "pmid:36618024", - "pmid:36599645", - "pmid:36530930", - "pmid:35962273", - "pmid:35188716", - "pmid:35182509", - "pmid:35052497", - "pmid:34647648", - "pmid:34600502", - "pmid:34565721", - "pmid:34371182", - "pmid:34159894", - "pmid:33502644", - "pmid:33121221", - "pmid:32888184", - "pmid:32822634", - "pmid:31522753", - "pmid:30891880", - "pmid:30591349", - "pmid:30342765", - "pmid:30314815", - "pmid:30120431", - "pmid:30078120", - "pmid:29959555", - "pmid:29553382", - "pmid:29367260", - "pmid:29316893", - "pmid:29249939", - "pmid:29111027", - "pmid:29057148", - "pmid:28946818", - "pmid:28782341", - "pmid:28585930", - "pmid:28444220", - "pmid:28131213", - "pmid:27979829", - "pmid:27896316", - "pmid:27848087", - "pmid:27806289", - "pmid:27412786", - "pmid:27400454", - "pmid:27333979", - "pmid:26730403", - "pmid:26377379", - "pmid:26374734", - "pmid:26354989", - "pmid:26077168", - "pmid:26054379", - "pmid:25634432", - "pmid:25624155", - "pmid:25466696", - "pmid:24780882", - "pmid:24534762", - "pmid:24486772", - "pmid:24209901", - "pmid:23423669", - "pmid:23407676", - "pmid:23368522", - "pmid:23026538", - "pmid:22520093", - "pmid:26859398", - "pmid:26676458", - "pmid:21832228", - "pmid:21550405", - "pmid:20069235", - "pmid:19631275", - "pmid:19429075", - "pmid:19259763", - "pmid:19224313", - "pmid:18949263", - "pmid:18759344", - "pmid:18687887", - "pmid:18685131", - "pmid:18684474", - "pmid:18506570", - "pmid:18418678", - "pmid:18285829", - "pmid:18074367", - "pmid:17961920", - "pmid:17682009", - "pmid:17516099", - "pmid:17420317", - "pmid:16396623", - "pmid:16389595", - "pmid:16310805", - "pmid:16000334", - "pmid:15875905", - "pmid:15747371", - "pmid:15553088", - "pmid:15148151", - "pmid:15080863", - "pmid:15026782", - "pmid:14967767", - "pmid:14966163", - "pmid:14756671", - "pmid:14534930", - "pmid:12810491", - "pmid:12764052", - "pmid:12676347", - "pmid:12614315", - "pmid:12545428", - "pmid:11939898", - "pmid:11889231", - "pmid:11839840", - "pmid:11804332", - "pmid:11717352", - "pmid:11708993", - "pmid:11448300", - "pmid:11355155", - "pmid:11341481", - "pmid:11311290", - "pmid:11176970", - "pmid:11160961", - "pmid:10369884", - "pmid:11081813", - "pmid:11030410", - "pmid:10985694", - "pmid:10964945", - "pmid:10945665", - "pmid:10942107", - "pmid:10894992", - "pmid:10785256", - "pmid:10768629", - "pmid:10766906", - "pmid:10690991", - "pmid:10674974", - "pmid:10601803", - "pmid:10453742", - "pmid:10442462", - "pmid:10369863", - "pmid:10369828", - "pmid:10366652", - "pmid:10225349", - "pmid:9973298", - "pmid:9915947", - "pmid:9879686", - "pmid:9855520", - "pmid:9779664", - "pmid:9758625", - "pmid:9741473", - "pmid:9696528", - "pmid:9674805", - "pmid:9613852", - "pmid:9600677", - "pmid:9559993", - "pmid:9507387", - "pmid:9436730", - "pmid:9385362", - "pmid:9371901", - "pmid:9371900", - "pmid:9403486", - "pmid:9403480", - "pmid:9345107", - "pmid:9339681", - "pmid:9302278", - "pmid:9311738", - "pmid:9259275", - "pmid:9259274", - "pmid:10464657", - "pmid:9043864" - ] - }, + "motif": "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": null, + "pathogenic_max": null, + "motif_len": 33, + "ref_copies": 17.0, + "novel": null, + "gard": [], + "genereviews": [], + "malacard": ["MTR082"], + "medgen": ["342845"], + "mondo": ["0012348"], + "omim": ["609812"], + "orphanet": ["552"], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": ["contraction", "motif_affects_pathogenicity"], + "disease_tags": [], + "references": ["pmid:19760265", "pmid:16369531", "pmid:39361122", "omim:609812"], + "additional_literature": ["pmid:41894686", "pmid:41057236", "pmid:40840513", "pmid:40641008", "pmid:39710966", "pmid:38483348", "pmid:38473919", "pmid:38458477", "pmid:36379850", "pmid:35583610", "pmid:35215948", "pmid:35156195", "pmid:35082198", "pmid:34850019", "pmid:34507899", "pmid:34100900", "pmid:33862081", "pmid:27802312", "pmid:27650499", "pmid:27773618", "pmid:23395566", "pmid:21784842", "pmid:15841033"] +}, +{ + "id": "DM2_CNBP", + "disease_id": "DM2", + "gene": "CNBP", + "evidence": ["Definitive"], + "chrom": "chr3", + "start_hg38": 129172576, + "stop_hg38": 129172656, + "start_hg19": 128891419, + "stop_hg19": 128891499, + "start_t2t": 131917482, + "stop_t2t": 131917557, + "disease": "Myotonic dystrophy type 2", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Myotonic dystrophy type 2 (MD2), also known as proximal myotonic myopathy, is a very rare genetic multi-system disorder of late childhood or adult-onset characterized by mild myotonia, muscle weakness, and rarely cardiac conduction disorders [@mondo:0011266].", + "hpo_terms": null, + "prevalence": "2.29/100000", + "prevalence_details": "2.29/100,000 [@pmid:35483324]; population specific prevalence [@genereviews:NBK1466]. Most cases have European ancestry, but disease has been reported worldwide [@genereviews:NBK1466].", + "age_onset": "Typical: 28-56 [@pmid:29086017]; Range: 0-73 [@pmid:31159885].", + "age_onset_min": 0.0, + "age_onset_max": 73.0, + "typ_age_onset_min": 28.0, + "typ_age_onset_max": 56.0, + "details": "≤30 uninterrupted CCTG repeats or 11-26 CCTG repeats with GCTC/TCTG interruptions are considered benign; 27-29 repeats with interruptions have currently unknown significance, ~30-~54 repeats are considered premutations, ~55-74 repeats are premutations with possible reduced penetrance, and >74 repeat alleles are considered pathogenic [@genereviews:NBK1466]. Penetrance is age-dependent and approaches 100%. Locus structure is (TG)n(TCTG)n(CCTG)n. CCTG expansion causes DM2 but the other repeat units are also variable. Interruptions include GCTG/TCTG/GGCT [@pmid:35245110]. Many DM2 expansions include a downstream 3' (TCTG)n block after the main array. One cohort found this structure in 88% of DM2 patients [@pmid:39703464].", + "detection": "Bidirectional RP-PCR and Southern blotting are commonly used for detection [@genereviews:NBK1466]. A downstream 3′ (TCTG)n block can cause false negative or unclear results, so TCTG targeted RP-PCR or long-read sequencing has been used to resolve these cases [@pmid:36018009; @pmid:41937177].", + "mechanism": "GoF", + "mechanism_detail": "Aberrant splicing, RAN translation [@pmid:22140091; @pmid:38467784]. Proposed pathogenisis contributions include nucleolar stress, autophagy dysregulation, and stress granule formation [@pmid:42003432].", + "year": "2001 [@pmid:11486088]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CAGG"], + "pathogenic_motif_reference_orientation": ["CAGG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["CAGA"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCTG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["CTGT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "JBS_CBL", - "disease_id": "JBS", - "gene": "CBL", - "evidence": [ - "Definitive" - ], - "chrom": "chr11", - "start_hg38": 119206289, - "stop_hg38": 119206323, - "start_hg19": 119076999, - "stop_hg19": 119077033, - "start_t2t": 119226662, - "stop_t2t": 119226696, - "disease": "Jacobsen syndrome (FRAX11B fragile site)", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A multiple congenital anomaly/intellectual disability contiguous gene syndrome caused by partial deletion of the long arm of chromosome 11 [@mondo:0007838].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "1/100,000 births; female/male ratio 2:1 [@pmid:19267933]. Found across ancestries/ethnicities [@omim:147791].", - "age_onset": "Condition at birth.", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "70% of individuals have 11 repeats [@pmid:7603564], but pathogenic expansion can span hundreds of motifs [@pmid:10767345]. The CGG repeat expansion can lead to a fragile site and subsequent deletion of 11q (shown in 2 cases) but total causality is unclear; intermediate alleles are associated with a premutation [@pmid:19267933].", - "detection": null, - "mechanism": "Hypermethylation", - "mechanism_detail": "DNA hypermethylation/11q deletion in sporadic cases [@pmid:38467784].", - "year": "1995 [@pmid:7603564]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CGG" - ], - "pathogenic_motif_reference_orientation": [ - "CGG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 79, - "intermediate_min": 80, - "intermediate_max": 100, - "pathogenic_min": 101, - "pathogenic_max": 300, - "motif_len": 3, - "ref_copies": 11.3, - "novel": "ref", - "gard": [ - "307" - ], - "genereviews": [], - "malacard": [ - "JCB001" - ], - "medgen": [ - "162878" - ], - "mondo": [ - "0007838" - ], - "omim": [ - "147791" - ], - "orphanet": [ - "2308" - ], - "gnomad": [ - "CBL" - ], - "stripy": [ - "CBL" - ], - "tr_atlas": [ - "TR112816" - ], - "webstr_hg38": [ - "6166081", - "430025" - ], - "webstr_hg19": [ - "STR_266122" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:38467784", - "pmid:7603564", - "pmid:10767345", - "pmid:19267933", - "omim:147791", - "mondo:0007838" - ], - "additional_literature": [ - "pmid:41964119", - "pmid:37422244", - "pmid:22131879", - "pmid:22084433", - "pmid:16474167" - ] + "motif": "CAGG", + "count": null, + "type": "pathogenic_repeat" }, { - "id": "MODY8_CEL", - "disease_id": "MODY8", - "gene": "CEL", - "evidence": [ - "Provisional" - ], - "chrom": "chr9", - "start_hg38": 133071177, - "stop_hg38": 133071737, - "start_hg19": 135946564, - "stop_hg19": 135947124, - "start_t2t": 145285333, - "stop_t2t": 145285861, - "disease": "Maturity-Onset Diabetes of the Young Type 8", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions [@genereviews:NBK500456]. In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype [@pmid:34850019]. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED) [@pmid:18544793].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265].", - "age_onset": "11-17 [@pmid:19760265]", - "age_onset_min": 11, - "age_onset_max": 17, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5 [@pmid:34850019]. One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential [@pmid:38483348]. Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse [@pmid:19760265]. Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs) [@pmid:39361122]. Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved [@pmid:21784842; @pmid:27650499; @pmid:33862081]. Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects [@pmid:38483348].", - "year": "2005", - "location_in_gene": "Exon 11", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG" - ], - "pathogenic_motif_reference_orientation": [ - "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": null, - "pathogenic_max": null, - "motif_len": 33, - "ref_copies": 17, - "novel": null, - "gard": [], - "genereviews": [], - "malacard": [ - "MTR082" - ], - "medgen": [ - "342845" - ], - "mondo": [ - "0012348" - ], - "omim": [ - "609812" - ], - "orphanet": [ - "552" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [ - "contraction", - "motif_affects_pathogenicity" - ], - "disease_tags": [], - "references": [ - "pmid:19760265", - "pmid:16369531", - "pmid:39361122", - "omim:609812" - ], - "additional_literature": [ - "pmid:41894686", - "pmid:41057236", - "pmid:40840513", - "pmid:40641008", - "pmid:39710966", - "pmid:38483348", - "pmid:38473919", - "pmid:38458477", - "pmid:36379850", - "pmid:35583610", - "pmid:35215948", - "pmid:35156195", - "pmid:35082198", - "pmid:34850019", - "pmid:34507899", - "pmid:34100900", - "pmid:33862081", - "pmid:27802312", - "pmid:27650499", - "pmid:27773618", - "pmid:23395566", - "pmid:21784842", - "pmid:15841033" - ] + "motif": "CAGA", + "count": 10, + "type": "flank_repeat" }, { - "id": "DM2_CNBP", - "disease_id": "DM2", - "gene": "CNBP", - "evidence": [ - "Definitive" - ], - "chrom": "chr3", - "start_hg38": 129172576, - "stop_hg38": 129172656, - "start_hg19": 128891419, - "stop_hg19": 128891499, - "start_t2t": 131917482, - "stop_t2t": 131917557, - "disease": "Myotonic dystrophy type 2", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Myotonic dystrophy type 2 (MD2), also known as proximal myotonic myopathy, is a very rare genetic multi-system disorder of late childhood or adult-onset characterized by mild myotonia, muscle weakness, and rarely cardiac conduction disorders [@mondo:0011266].", - "hpo_terms": null, - "prevalence": "2.29/100000", - "prevalence_details": "2.29/100,000 [@pmid:35483324]; population specific prevalence [@genereviews:NBK1466]. Most cases have European ancestry, but disease has been reported worldwide [@genereviews:NBK1466].", - "age_onset": "Typical: 28-56 [@pmid:29086017]; Range: 0-73 [@pmid:31159885].", - "age_onset_min": 0, - "age_onset_max": 73, - "typ_age_onset_min": 28, - "typ_age_onset_max": 56, - "details": "≤30 uninterrupted CCTG repeats or 11-26 CCTG repeats with GCTC/TCTG interruptions are considered benign; 27-29 repeats with interruptions have currently unknown significance, ~30-~54 repeats are considered premutations, ~55-74 repeats are premutations with possible reduced penetrance, and >74 repeat alleles are considered pathogenic [@genereviews:NBK1466]. Penetrance is age-dependent and approaches 100%. Locus structure is (TG)n(TCTG)n(CCTG)n. CCTG expansion causes DM2 but the other repeat units are also variable. Interruptions include GCTG/TCTG/GGCT [@pmid:35245110]. Many DM2 expansions include a downstream 3' (TCTG)n block after the main array. One cohort found this structure in 88% of DM2 patients [@pmid:39703464].", - "detection": "Bidirectional RP-PCR and Southern blotting are commonly used for detection [@genereviews:NBK1466]. A downstream 3′ (TCTG)n block can cause false negative or unclear results, so TCTG targeted RP-PCR or long-read sequencing has been used to resolve these cases [@pmid:36018009; @pmid:41937177].", - "mechanism": "GoF", - "mechanism_detail": "Aberrant splicing, RAN translation [@pmid:22140091; @pmid:38467784]. Proposed pathogenisis contributions include nucleolar stress, autophagy dysregulation, and stress granule formation [@pmid:42003432].", - "year": "2001 [@pmid:11486088]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CAGG" - ], - "pathogenic_motif_reference_orientation": [ - "CAGG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "CAGA" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCTG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "CTGT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "CAGG", - "count": null, - "type": "pathogenic_repeat" - }, - { - "motif": "CAGA", - "count": 10, - "type": "flank_repeat" - }, - { - "motif": "CA", - "count": 19, - "type": "flank_repeat" - } - ], - "benign_min": 11, - "benign_max": 26, - "intermediate_min": 27, - "intermediate_max": 74, - "pathogenic_min": 75, - "pathogenic_max": 11000, - "motif_len": 4, - "ref_copies": 20.8, - "novel": "ref", - "gard": [ - "9728" - ], - "genereviews": [ - "NBK1466" - ], - "malacard": [ - "MYT020" - ], - "medgen": [ - "419137" - ], - "mondo": [ - "0011266" - ], - "omim": [ - "602668" - ], - "orphanet": [ - "606" - ], - "gnomad": [ - "CNBP" - ], - "stripy": [ - "CNBP" - ], - "tr_atlas": [ - "TR35563", - "TR35564", - "TR35565" - ], - "webstr_hg38": [ - "741073" - ], - "webstr_hg19": [], - "locus_tags": [ - "somatic_instability", - "motif_affects_instability" - ], - "disease_tags": [ - "myotonic_dystrophy" - ], - "references": [ - "pmid:29086017", - "pmid:31159885", - "pmid:22140091", - "pmid:38467784", - "pmid:42003432", - "pmid:39643839", - "genereviews:NBK1466", - "pmid:35245110", - "pmid:39703464", - "pmid:35483324", - "pmid:11486088", - "mondo:0011266" - ], - "additional_literature": [ - "pmid:42094143", - "pmid:41937177", - "pmid:41610137", - "pmid:41074692", - "pmid:40113266", - "pmid:39894140", - "pmid:39240646", - "pmid:39119544", - "pmid:38922834", - "pmid:37950892", - "pmid:37461657", - "pmid:37146135", - "pmid:36778282", - "pmid:36018009", - "pmid:35945246", - "pmid:35567413", - "pmid:34101465", - "pmid:34024776", - "pmid:33595997", - "pmid:31981476", - "pmid:31927948", - "pmid:30984523", - "pmid:30140252", - "pmid:30100878", - "pmid:29973908", - "pmid:29291944", - "pmid:28623239", - "pmid:28491317", - "pmid:28130447", - "pmid:27727437", - "pmid:27222292", - "pmid:26586700", - "pmid:25443993", - "pmid:25186227", - "pmid:24907641", - "pmid:23570879", - "pmid:22723857", - "pmid:22643181", - "pmid:22587749", - "pmid:22459146", - "pmid:22332444", - "pmid:22062891", - "pmid:21303839", - "pmid:21224892", - "pmid:21204798", - "pmid:20971734", - "pmid:20491895", - "pmid:20174632", - "pmid:19683984", - "pmid:19632331", - "pmid:19218442", - "pmid:18804219", - "pmid:18213375", - "pmid:16927100", - "pmid:16624843", - "pmid:16376058", - "pmid:15718211", - "pmid:15704146", - "pmid:15322428", - "pmid:15231584", - "pmid:15215218", - "pmid:15114529", - "pmid:15019706", - "pmid:14505273", - "pmid:12970845", - "pmid:12601109" - ] - }, + "motif": "CA", + "count": 19, + "type": "flank_repeat" + }], + "benign_min": 11, + "benign_max": 26, + "intermediate_min": 27, + "intermediate_max": 74, + "pathogenic_min": 75, + "pathogenic_max": 11000, + "motif_len": 4, + "ref_copies": 20.8, + "novel": "ref", + "gard": ["9728"], + "genereviews": ["NBK1466"], + "malacard": ["MYT020"], + "medgen": ["419137"], + "mondo": ["0011266"], + "omim": ["602668"], + "orphanet": ["606"], + "gnomad": ["CNBP"], + "stripy": ["CNBP"], + "tr_atlas": ["TR35563", "TR35564", "TR35565"], + "webstr_hg38": ["741073"], + "webstr_hg19": [], + "locus_tags": ["somatic_instability", "motif_affects_instability"], + "disease_tags": ["myotonic_dystrophy"], + "references": ["pmid:29086017", "pmid:31159885", "pmid:22140091", "pmid:38467784", "pmid:42003432", "pmid:39643839", "genereviews:NBK1466", "pmid:35245110", "pmid:39703464", "pmid:35483324", "pmid:11486088", "mondo:0011266"], + "additional_literature": ["pmid:42094143", "pmid:41937177", "pmid:41610137", "pmid:41074692", "pmid:40113266", "pmid:39894140", "pmid:39240646", "pmid:39119544", "pmid:38922834", "pmid:37950892", "pmid:37461657", "pmid:37146135", "pmid:36778282", "pmid:36018009", "pmid:35945246", "pmid:35567413", "pmid:34101465", "pmid:34024776", "pmid:33595997", "pmid:31981476", "pmid:31927948", "pmid:30984523", "pmid:30140252", "pmid:30100878", "pmid:29973908", "pmid:29291944", "pmid:28623239", "pmid:28491317", "pmid:28130447", "pmid:27727437", "pmid:27222292", "pmid:26586700", "pmid:25443993", "pmid:25186227", "pmid:24907641", "pmid:23570879", "pmid:22723857", "pmid:22643181", "pmid:22587749", "pmid:22459146", "pmid:22332444", "pmid:22062891", "pmid:21303839", "pmid:21224892", "pmid:21204798", "pmid:20971734", "pmid:20491895", "pmid:20174632", "pmid:19683984", "pmid:19632331", "pmid:19218442", "pmid:18804219", "pmid:18213375", "pmid:16927100", "pmid:16624843", "pmid:16376058", "pmid:15718211", "pmid:15704146", "pmid:15322428", "pmid:15231584", "pmid:15215218", "pmid:15114529", "pmid:15019706", "pmid:14505273", "pmid:12970845", "pmid:12601109"] +}, +{ + "id": "EDM1-PSACH_COMP", + "disease_id": "EDM1, PSACH", + "gene": "COMP", + "evidence": ["Definitive"], + "chrom": "chr19", + "start_hg38": 18786034, + "stop_hg38": 18786050, + "start_hg19": 18896844, + "stop_hg19": 18896860, + "start_t2t": 18921630, + "stop_t2t": 18921645, + "disease": "Multiple epiphyseal dysplasia, Pseudoachondroplasia", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Pseudoachondroplasia is characterized by severe growth deficiency and deformations such as bow legs and hyperlordosis.; Multiple epiphyseal dysplasia type 1 (MED 1) is a form of multiple epiphyseal dysplasia that is characterized by normal or mild short stature, pain in the hips and/or knees, progressive deformity of extremities and early-onset osteoarthrosis. Specific features to MED 1 include a more pronounced involvement of hip joints and gait abnormality and a shorter adult height. MED1 is allelic to pseudoachondroplasia with which it shares clinical and radiological features. The disease follows an autosomal dominant mode of transmission [@mondo:0008322; @mondo:0007561].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Specific contribution of COMP repeats to EDM1 is unknown (~300 COMP mutation variants for both phenotypes); likely 1:90,000 prevalence for COMP-PSACH that is repeat-specific. Found across ancestries/ethnicities [@genereviews:NBK1123; @genereviews:NBK1487].", + "age_onset": "Typical: 0-2 (COMP-PSACH)/ 1-12 (EDM1); Range: 0 (PSACH) - 13 (EDM1). 3-13 specific to trinucleotide expansions (duplications) [@pmid:29530484], several contractions but unknown exact AoO [@genereviews:NBK1123; @genereviews:NBK1487].", + "age_onset_min": 3.0, + "age_onset_max": 13.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Both expansions to (GTC)6-7 and contractions to (GTC)4 are associated with disease [@genereviews:NBK1487].", + "detection": null, + "mechanism": "LoF/GoF?", + "mechanism_detail": "Poly-aspartic acid expansions, domain dependent [@pmid:29530484]; may involve misfolding but still unestablished [@genereviews:NBK1123].", + "year": "1999 [@pmid:9887340]", + "location_in_gene": "Coding Exon 13", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GTC"], + "pathogenic_motif_reference_orientation": ["GTC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ACG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 5, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 6, + "pathogenic_max": 7, + "motif_len": 3, + "ref_copies": 5.0, + "novel": "ref", + "gard": ["4540", "2180"], + "genereviews": ["NBK1123", "NBK1487"], + "malacard": ["EPP017", "PSD012"], + "medgen": ["98378", "325376"], + "mondo": ["0008322", "0007561"], + "omim": ["132400", "177170"], + "orphanet": ["750", "93308"], + "gnomad": ["COMP"], + "stripy": ["COMP"], + "tr_atlas": ["TR155017"], + "webstr_hg38": ["1317658"], + "webstr_hg19": ["STR_673389"], + "locus_tags": ["contraction"], + "disease_tags": ["phenotypic_spectrum"], + "references": ["pmid:29530484", "genereviews:NBK1123", "genereviews:NBK1487", "pmid:9887340", "mondo:0008322", "mondo:0007561"], + "additional_literature": ["pmid:32097846", "pmid:28924040", "pmid:21644213", "pmid:18353302", "pmid:15014436", "pmid:12483437"] +}, +{ + "id": "EPM_CSNK1E", + "disease_id": "EPM, DEE", + "gene": "CSNK1E", + "evidence": ["Limited"], + "chrom": "chr22", + "start_hg38": 38317282, + "stop_hg38": 38317375, + "start_hg19": 38713287, + "stop_hg19": 38713380, + "start_t2t": 38781587, + "stop_t2t": 38781680, + "disease": "Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Progressive myoclonic epilepsy is a heterogeneous neurodegenerative disorder characterized by early-onset myoclonus, epilepsy, generalized tonic-clonic seizures, and progressive neurological deterioration [@pmid:40751262]. It has also been proposed that this locus is also associated with developmental and epileptic encephalopathies [@pmid:39107278]. We hypothesize that the two diseases may make up an expressivity or phenotypic spectrum and/or that hypermethylation causes changes in onset and severity.", + "hpo_terms": ["HP:0001336 Myoclonous", "HP:0001251 Ataxia", "HP:0002080 Intention Tremor", "HP:0007000 Morning Myoclonic Jerks", "HP:0001260 Dysarthia", "HP:0001249 Intellectual Disability", "HP:0002392 EEG with Polyspike Wave Complexes", "HP:0002070 Limb Ataxia", "HP:0000726 Dementia", "HP:0000992 Cutaneous Photosensitivity"], + "prevalence": null, + "prevalence_details": "EPM found in one Azerbaijani proband [@pmid:40751262] and DEE found in two additional patients [@pmid:39107278]. This expansion has been reported in unaffected individuals [@pmid:40751262].", + "age_onset": "EPM case reports age of onset 10 years [@pmid:40751262] and DEE cases onset in infancy", + "age_onset_min": 0.0, + "age_onset_max": 10.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "CGG repeat in exon 1 of CSNK1E. Longest reported expanded allele of an affected individual is 745, with an unaffected sibling with repeat length 980. Father had a repeat of 8 and mother of 131.", + "detection": "Exome sequencing does not reliably detect expansions at this locus. Reported cases were identified through methylation outlier detection and confirmed by targeted long-read sequencing [@pmid:40751262].", + "mechanism": "Unknown", + "mechanism_detail": "Mechanism of this disease is largely unknown, but hypermethylation is observed. Expanded alleles exhibit hypermethylation and may mediate epigenetic silencing. Unaffected carriers have been observed, indicating variable expressivity or penetrance.", + "year": "2025", + "location_in_gene": "Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CCG"], + "pathogenic_motif_reference_orientation": ["CCG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "EDM1-PSACH_COMP", - "disease_id": "EDM1, PSACH", - "gene": "COMP", - "evidence": [ - "Definitive" - ], - "chrom": "chr19", - "start_hg38": 18786034, - "stop_hg38": 18786050, - "start_hg19": 18896844, - "stop_hg19": 18896860, - "start_t2t": 18921630, - "stop_t2t": 18921645, - "disease": "Multiple epiphyseal dysplasia, Pseudoachondroplasia", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Pseudoachondroplasia is characterized by severe growth deficiency and deformations such as bow legs and hyperlordosis.; Multiple epiphyseal dysplasia type 1 (MED 1) is a form of multiple epiphyseal dysplasia that is characterized by normal or mild short stature, pain in the hips and/or knees, progressive deformity of extremities and early-onset osteoarthrosis. Specific features to MED 1 include a more pronounced involvement of hip joints and gait abnormality and a shorter adult height. MED1 is allelic to pseudoachondroplasia with which it shares clinical and radiological features. The disease follows an autosomal dominant mode of transmission [@mondo:0008322; @mondo:0007561].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Specific contribution of COMP repeats to EDM1 is unknown (~300 COMP mutation variants for both phenotypes); likely 1:90,000 prevalence for COMP-PSACH that is repeat-specific. Found across ancestries/ethnicities [@genereviews:NBK1123; @genereviews:NBK1487].", - "age_onset": "Typical: 0-2 (COMP-PSACH)/ 1-12 (EDM1); Range: 0 (PSACH) - 13 (EDM1). 3-13 specific to trinucleotide expansions (duplications) [@pmid:29530484], several contractions but unknown exact AoO [@genereviews:NBK1123; @genereviews:NBK1487].", - "age_onset_min": 3, - "age_onset_max": 13, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Both expansions to (GTC)6-7 and contractions to (GTC)4 are associated with disease [@genereviews:NBK1487].", - "detection": null, - "mechanism": "LoF/GoF?", - "mechanism_detail": "Poly-aspartic acid expansions, domain dependent [@pmid:29530484]; may involve misfolding but still unestablished [@genereviews:NBK1123].", - "year": "1999 [@pmid:9887340]", - "location_in_gene": "Coding Exon 13", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GTC" - ], - "pathogenic_motif_reference_orientation": [ - "GTC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ACG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 5, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 6, - "pathogenic_max": 7, - "motif_len": 3, - "ref_copies": 5, - "novel": "ref", - "gard": [ - "4540", - "2180" - ], - "genereviews": [ - "NBK1123", - "NBK1487" - ], - "malacard": [ - "EPP017", - "PSD012" - ], - "medgen": [ - "98378", - "325376" - ], - "mondo": [ - "0008322", - "0007561" - ], - "omim": [ - "132400", - "177170" - ], - "orphanet": [ - "750", - "93308" - ], - "gnomad": [ - "COMP" - ], - "stripy": [ - "COMP" - ], - "tr_atlas": [ - "TR155017" - ], - "webstr_hg38": [ - "1317658" - ], - "webstr_hg19": [ - "STR_673389" - ], - "locus_tags": [ - "contraction" - ], - "disease_tags": [ - "phenotypic_spectrum" - ], - "references": [ - "pmid:29530484", - "genereviews:NBK1123", - "genereviews:NBK1487", - "pmid:9887340", - "mondo:0008322", - "mondo:0007561" - ], - "additional_literature": [ - "pmid:32097846", - "pmid:28924040", - "pmid:21644213", - "pmid:18353302", - "pmid:15014436", - "pmid:12483437" - ] - }, + "motif": "CCG", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 0, + "benign_max": 48, + "intermediate_min": 49, + "intermediate_max": 131, + "pathogenic_min": 366, + "pathogenic_max": 980, + "motif_len": 3, + "ref_copies": null, + "novel": null, + "gard": ["7140"], + "genereviews": [], + "malacard": ["MYC080"], + "medgen": ["199732"], + "mondo": ["0020074"], + "omim": ["600863"], + "orphanet": [], + "gnomad": ["CSNK1E"], + "stripy": [], + "tr_atlas": ["TR344468"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": ["epilepsy"], + "references": ["pmid:40751262", "pmid:39107278", "pmid: 39107278"], + "additional_literature": [] +}, +{ + "id": "EPM1_CSTB", + "disease_id": "EPM1", + "gene": "CSTB", + "evidence": ["Definitive"], + "chrom": "chr21", + "start_hg38": 43776442, + "stop_hg38": 43776479, + "start_hg19": 45196323, + "stop_hg19": 45196360, + "start_t2t": 42132054, + "stop_t2t": 42132091, + "disease": "Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD)", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Unverricht-Lundborg disease (ULD) is a rare progressive myoclonic epilepsy disorder characterized by action- and stimulus-sensitive myoclonus, and tonic-clonic seizures with ataxia, but with only a mild cognitive decline over time [@mondo:0009698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Worldwide prevalence unknown; Finland prevalence 2-4/100,000. Found across ethnicities/ancestries, with population-dependent prevalence; highest in Tunisia, Algeria, Morocco, and Finland [@genereviews:NBK1142].", + "age_onset": "Typical: 6-15 [@genereviews:NBK1142]; Range: 6-18 [@pmid:18325013].", + "age_onset_min": 6.0, + "age_onset_max": 18.0, + "typ_age_onset_min": 6.0, + "typ_age_onset_max": 15.0, + "details": "Affected individuals have an unstable 12-nucleotide (dodecomer) repeat expansion. Alleles containing 2-3 motifs are considered benign, while alleles with 30-125 repeats are fully penetrant [@pmid:18325013]. Alleles in the range 12-17 repeats have been observed, however the individuals carrying them have not undergone clinical evaluation. Alleles in the range 4-11 and 18-29 repeats have not been reported to date.", + "detection": "short-read sequencing cannot detect pathogenic expansions. Conventional PCR has detected normal range alleles, while Southern blotting approximates expanded allele size [@genereviews:NBK1142].", + "mechanism": "LoF", + "mechanism_detail": "The repeat expansion causes significantly reduced expression of cystatin-B protein [@genereviews:NBK1142].", + "year": "1997 [@pmid:9126745]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CGCGGGGCGGGG"], + "pathogenic_motif_reference_orientation": ["CGCGGGGCGGGG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCCCGCCCCGCG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 3, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 30, + "pathogenic_max": 125, + "motif_len": 12, + "ref_copies": null, + "novel": null, + "gard": ["3876"], + "genereviews": ["NBK1142"], + "malacard": ["MYC080"], + "medgen": ["155923"], + "mondo": ["0009698"], + "omim": ["254800"], + "orphanet": ["308"], + "gnomad": ["CSTB"], + "stripy": [], + "tr_atlas": ["TR163552"], + "webstr_hg38": ["5547429"], + "webstr_hg19": ["STR_886261"], + "locus_tags": ["length_affects_onset", "length_affects_severity"], + "disease_tags": ["ataxia"], + "references": ["genereviews:NBK1142", "pmid:18325013", "pmid:9126745", "mondo:0009698"], + "additional_literature": ["pmid:42094143", "pmid:41268177", "pmid:41074692", "pmid:40442775", "pmid:40340521", "pmid:39156922", "pmid:38135787", "pmid:36398398", "pmid:36359887", "pmid:34474241", "pmid:32920378", "pmid:32875576", "pmid:29352102", "pmid:25752200", "pmid:23883076", "pmid:22581592", "pmid:21757863", "pmid:21075014", "pmid:18358403", "pmid:17003839", "pmid:16379547", "pmid:15483648", "pmid:14517952", "pmid:14510831", "pmid:12215838", "pmid:11790146", "pmid:11697734", "pmid:11571333", "pmid:11524486", "pmid:11240124", "pmid:10927802", "pmid:10721698", "pmid:10660338", "pmid:10515170", "pmid:10441345", "pmid:9529356", "pmid:9090386", "pmid:9054946", "pmid:9012407", "pmid:7885531"] +}, +{ + "id": "SCA37_DAB1", + "disease_id": "SCA37", + "gene": "DAB1", + "evidence": ["Strong"], + "chrom": "chr1", + "start_hg38": 57367043, + "stop_hg38": 57367121, + "start_hg19": 57832715, + "stop_hg19": 57832793, + "start_t2t": 57245935, + "stop_t2t": 57245973, + "disease": "Spinocerebellar ataxia type 37", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 37 (SCA37) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1), characterized by a cerebellar syndrome along with altered vertical eye movements [@mondo:0014410].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "0.20/100,000 specific to Portugal; not yet found in other geographic regions. Founder effect from Iberian Peninsula [@genereviews:NBK541729].", + "age_onset": "Typical: 33-53; Range: 18-64 [@genereviews:NBK541729].", + "age_onset_min": 18.0, + "age_onset_max": 64.0, + "typ_age_onset_min": 33.0, + "typ_age_onset_max": 53.0, + "details": "Pathogenicity only associated with pathogenic motif >30 repeats, flanked by at least 58 repeats of reference motif on either side; reference repeat (AAAAT) can range from 1 to 400 repeats, although typically less than 30 [@genereviews:NBK541729]. The pathogenic motif is unstable, particularly when transmitted by the father [@genereviews:NBK541729].", + "detection": "Short-read sequencing, exome sequencing, and RP-PCR do not accurately detect this repeat, but long-range PCR with targeted Sanger sequencing is commonly used for detection and characterization [@genereviews:NBK541729].", + "mechanism": "GoF", + "mechanism_detail": "Toxic gain-of-function mechanism in protein, associated with alternative splicing, an RNA switch, and an upregulation of reelin-DAB1 signalling [@omim:615945; @pmid:30284037].", + "year": "2017 [@pmid:28686858]", + "location_in_gene": "Intron 1 (most isoforms)", + "gene_strand": "-", + "reference_motif_reference_orientation": ["AAAAT"], + "pathogenic_motif_reference_orientation": ["GAAAT"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["AAAAA"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["TTTTT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "EPM_CSNK1E", - "disease_id": "EPM, DEE", - "gene": "CSNK1E", - "evidence": [ - "Limited" - ], - "chrom": "chr22", - "start_hg38": 38317282, - "stop_hg38": 38317375, - "start_hg19": 38713287, - "stop_hg19": 38713380, - "start_t2t": 38781587, - "stop_t2t": 38781680, - "disease": "Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Progressive myoclonic epilepsy is a heterogeneous neurodegenerative disorder characterized by early-onset myoclonus, epilepsy, generalized tonic-clonic seizures, and progressive neurological deterioration [@pmid:40751262]. It has also been proposed that this locus is also associated with developmental and epileptic encephalopathies [@pmid:39107278]. We hypothesize that the two diseases may make up an expressivity or phenotypic spectrum and/or that hypermethylation causes changes in onset and severity.", - "hpo_terms": [ - "HP:0001336 Myoclonous", - "HP:0001251 Ataxia", - "HP:0002080 Intention Tremor", - "HP:0007000 Morning Myoclonic Jerks", - "HP:0001260 Dysarthia", - "HP:0001249 Intellectual Disability", - "HP:0002392 EEG with Polyspike Wave Complexes", - "HP:0002070 Limb Ataxia", - "HP:0000726 Dementia", - "HP:0000992 Cutaneous Photosensitivity" - ], - "prevalence": null, - "prevalence_details": "EPM found in one Azerbaijani proband [@pmid:40751262] and DEE found in two additional patients [@pmid:39107278]. This expansion has been reported in unaffected individuals [@pmid:40751262].", - "age_onset": "EPM case reports age of onset 10 years [@pmid:40751262] and DEE cases onset in infancy", - "age_onset_min": 0, - "age_onset_max": 10, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "CGG repeat in exon 1 of CSNK1E. Longest reported expanded allele of an affected individual is 745, with an unaffected sibling with repeat length 980. Father had a repeat of 8 and mother of 131.", - "detection": "Exome sequencing does not reliably detect expansions at this locus. Reported cases were identified through methylation outlier detection and confirmed by targeted long-read sequencing [@pmid:40751262].", - "mechanism": "Unknown", - "mechanism_detail": "Mechanism of this disease is largely unknown, but hypermethylation is observed. Expanded alleles exhibit hypermethylation and may mediate epigenetic silencing. Unaffected carriers have been observed, indicating variable expressivity or penetrance.", - "year": "2025", - "location_in_gene": "Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CCG" - ], - "pathogenic_motif_reference_orientation": [ - "CCG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "CCG", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 0, - "benign_max": 48, - "intermediate_min": 49, - "intermediate_max": 131, - "pathogenic_min": 366, - "pathogenic_max": 980, - "motif_len": 3, - "ref_copies": null, - "novel": null, - "gard": [ - "7140" - ], - "genereviews": [], - "malacard": [ - "MYC080" - ], - "medgen": [ - "199732" - ], - "mondo": [ - "0020074" - ], - "omim": [ - "600863" - ], - "orphanet": [], - "gnomad": [ - "CSNK1E" - ], - "stripy": [], - "tr_atlas": [ - "TR344468" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [ - "epilepsy" - ], - "references": [ - "pmid:40751262", - "pmid:39107278", - "pmid: 39107278" - ], - "additional_literature": [] + "motif": "AAAAT", + "count": 7, + "type": "internal_repeat" }, { - "id": "EPM1_CSTB", - "disease_id": "EPM1", - "gene": "CSTB", - "evidence": [ - "Definitive" - ], - "chrom": "chr21", - "start_hg38": 43776442, - "stop_hg38": 43776479, - "start_hg19": 45196323, - "stop_hg19": 45196360, - "start_t2t": 42132054, - "stop_t2t": 42132091, - "disease": "Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD)", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Unverricht-Lundborg disease (ULD) is a rare progressive myoclonic epilepsy disorder characterized by action- and stimulus-sensitive myoclonus, and tonic-clonic seizures with ataxia, but with only a mild cognitive decline over time [@mondo:0009698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Worldwide prevalence unknown; Finland prevalence 2-4/100,000. Found across ethnicities/ancestries, with population-dependent prevalence; highest in Tunisia, Algeria, Morocco, and Finland [@genereviews:NBK1142].", - "age_onset": "Typical: 6-15 [@genereviews:NBK1142]; Range: 6-18 [@pmid:18325013].", - "age_onset_min": 6, - "age_onset_max": 18, - "typ_age_onset_min": 6, - "typ_age_onset_max": 15, - "details": "Affected individuals have an unstable 12-nucleotide (dodecomer) repeat expansion. Alleles containing 2-3 motifs are considered benign, while alleles with 30-125 repeats are fully penetrant [@pmid:18325013]. Alleles in the range 12-17 repeats have been observed, however the individuals carrying them have not undergone clinical evaluation. Alleles in the range 4-11 and 18-29 repeats have not been reported to date.", - "detection": "short-read sequencing cannot detect pathogenic expansions. Conventional PCR has detected normal range alleles, while Southern blotting approximates expanded allele size [@genereviews:NBK1142].", - "mechanism": "LoF", - "mechanism_detail": "The repeat expansion causes significantly reduced expression of cystatin-B protein [@genereviews:NBK1142].", - "year": "1997 [@pmid:9126745]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CGCGGGGCGGGG" - ], - "pathogenic_motif_reference_orientation": [ - "CGCGGGGCGGGG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCCCGCCCCGCG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 3, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 30, - "pathogenic_max": 125, - "motif_len": 12, - "ref_copies": null, - "novel": null, - "gard": [ - "3876" - ], - "genereviews": [ - "NBK1142" - ], - "malacard": [ - "MYC080" - ], - "medgen": [ - "155923" - ], - "mondo": [ - "0009698" - ], - "omim": [ - "254800" - ], - "orphanet": [ - "308" - ], - "gnomad": [ - "CSTB" - ], - "stripy": [], - "tr_atlas": [ - "TR163552" - ], - "webstr_hg38": [ - "5547429" - ], - "webstr_hg19": [ - "STR_886261" - ], - "locus_tags": [ - "length_affects_onset", - "length_affects_severity" - ], - "disease_tags": [ - "ataxia" - ], - "references": [ - "genereviews:NBK1142", - "pmid:18325013", - "pmid:9126745", - "mondo:0009698" - ], - "additional_literature": [ - "pmid:42094143", - "pmid:41268177", - "pmid:41074692", - "pmid:40442775", - "pmid:40340521", - "pmid:39156922", - "pmid:38135787", - "pmid:36398398", - "pmid:36359887", - "pmid:34474241", - "pmid:32920378", - "pmid:32875576", - "pmid:29352102", - "pmid:25752200", - "pmid:23883076", - "pmid:22581592", - "pmid:21757863", - "pmid:21075014", - "pmid:18358403", - "pmid:17003839", - "pmid:16379547", - "pmid:15483648", - "pmid:14517952", - "pmid:14510831", - "pmid:12215838", - "pmid:11790146", - "pmid:11697734", - "pmid:11571333", - "pmid:11524486", - "pmid:11240124", - "pmid:10927802", - "pmid:10721698", - "pmid:10660338", - "pmid:10515170", - "pmid:10441345", - "pmid:9529356", - "pmid:9090386", - "pmid:9054946", - "pmid:9012407", - "pmid:7885531" - ] - }, + "motif": "GAAAT", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 0, + "benign_max": 30, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 31, + "pathogenic_max": 75, + "motif_len": 5, + "ref_copies": 0.0, + "novel": "novel", + "gard": ["12368"], + "genereviews": ["NBK541729"], + "malacard": ["SPN283"], + "medgen": ["855217"], + "mondo": ["0014410"], + "omim": ["615945"], + "orphanet": ["363710"], + "gnomad": ["DAB1"], + "stripy": ["DAB1"], + "tr_atlas": ["TR3445"], + "webstr_hg38": ["1144531"], + "webstr_hg19": ["STR_39393"], + "locus_tags": ["maternal_expansion", "paternal_expansion", "motif_affects_onset", "motif_affects_penetrance"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK541729", "omim:615945", "pmid:30284037", "pmid:28686858", "mondo:0014410"], + "additional_literature": ["pmid:41871099", "pmid:41426430", "pmid:38961870", "pmid:36622139", "pmid:36148898", "pmid:36092952", "pmid:32582864", "pmid:30588707"] +}, +{ + "id": "FRA12A_DIP2B", + "disease_id": "FRA12A", + "gene": "DIP2B", + "evidence": ["Disputed"], + "chrom": "chr12", + "start_hg38": 50505001, + "stop_hg38": 50505024, + "start_hg19": 50898784, + "stop_hg19": 50898807, + "start_t2t": 50468095, + "stop_t2t": 50468118, + "disease": "Intellectual developmental disorder, FRA12A type", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. Impaired intellectual development with or without other anomalies has been described in patients with over 40% of cells expressing FRA12A [@omim:136630]. The DIP2B CGG repeat expansion causes this folate-sensitive site and is associated with a broad phenotypic range, including intellectual disability, ataxia/movement disorder, and epilepsy [@pmid:39854091; @pmid:17236128; @pmid:34622207]; cardiovascular associations have also been reported [@pmid:38418263].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Appears to occur in those of European ancestry/ethnicity [@omim:136630].", + "age_onset": "Typical: 0-1 (small sample size) [@pmid:3742859]. Range: 0-3 [@pmid:4042396].", + "age_onset_min": 0.0, + "age_onset_max": 3.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Repeat ranges reflect affected and unaffected individuals from a cohort study of 70 controls (6-23 repeats), unaffected carriers representing the intermediate alleles (139-206), and affected individuals (273-306) [@pmid:17236128]. It has been hypothesized that unmethylated expansions may correspond to movement-related phenotypes (chorea, dystonia, and ataxia) [@pmid:39854091].", + "detection": "Short-read sequencing can underestimate expansion size. RP-PCR and Southern blotting detect expansions [@pmid:17236128], while long-read sequencing has been reported to accurately size them [@pmid:39854091].", + "mechanism": "LoF", + "mechanism_detail": "Hypermethylation leading to decreased expression, although unmethylated expansion leads to increased expression [@omim:136630; @pmid:37248219].", + "year": "2007 [@pmid:17236128]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGC"], + "pathogenic_motif_reference_orientation": ["GGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 23, + "intermediate_min": 139, + "intermediate_max": 206, + "pathogenic_min": 273, + "pathogenic_max": 306, + "motif_len": 3, + "ref_copies": 7.0, + "novel": "ref", + "gard": [], + "genereviews": ["NBK535148"], + "malacard": ["INT482"], + "medgen": ["369613"], + "mondo": ["0007634"], + "omim": ["136630"], + "orphanet": [], + "gnomad": ["DIP2B"], + "stripy": ["DIP2B"], + "tr_atlas": ["TR116656"], + "webstr_hg38": ["5075695"], + "webstr_hg19": ["Expansion_FRA12A_MR/DIP2B"], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:3742859", "pmid:4042396", "omim:136630", "pmid:37248219", "pmid:17236128", "pmid:39854091", "pmid:34622207", "pmid:38418263"], + "additional_literature": ["pmid:42205056", "pmid:37090938"] +}, +{ + "id": "DMD_DMD", + "disease_id": "DMD", + "gene": "DMD", + "evidence": ["Refuted"], + "chrom": "chrX", + "start_hg38": 31284557, + "stop_hg38": 31284605, + "start_hg19": 31302674, + "stop_hg19": 31302722, + "start_t2t": 30882677, + "stop_t2t": 30882743, + "disease": "Duchenne muscular dystrophy", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "Duchenne muscular dystrophy (DMD) is a neuromuscular disease characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle [@mondo:0010679].", + "hpo_terms": null, + "prevalence": "4.8/100000", + "prevalence_details": "Believed to be 0 for disease specific to STR expansion. 1/3500-4700 male births (incidence) for overall DMD (one of the most common and severe congenital myopathies) [@genereviews:NBK1119]. 4.8/100,000 prevalence [@pmid:35168641]. DMD repeat locus expansion only identified in one Greek family [@pmid:27417533].", + "age_onset": "Typical: 6-7 (usual disease is 0-3) [@pmid:27417533].", + "age_onset_min": 6.0, + "age_onset_max": 7.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "There is conflicting evidence for the association between this repeat expansion and Duchenne muscular dystrophy. The association was reported in a single family, from which the benign and pathogenic ranges were inferred from affected and unaffected family members [@pmid:27417533]. The population frequency of the proposed pathogenic allele is much higher than expected for a highly penetrant early-onset condition.", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Functional defect in dystrophin/dystroglycan [@pmid:16969582].", + "year": "2016 [@pmid:27417533]", + "location_in_gene": "Intron 62", + "gene_strand": "-", + "reference_motif_reference_orientation": ["TTC"], + "pathogenic_motif_reference_orientation": ["TTC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AAG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "SCA37_DAB1", - "disease_id": "SCA37", - "gene": "DAB1", - "evidence": [ - "Strong" - ], - "chrom": "chr1", - "start_hg38": 57367043, - "stop_hg38": 57367121, - "start_hg19": 57832715, - "stop_hg19": 57832793, - "start_t2t": 57245935, - "stop_t2t": 57245973, - "disease": "Spinocerebellar ataxia type 37", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 37 (SCA37) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1), characterized by a cerebellar syndrome along with altered vertical eye movements [@mondo:0014410].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "0.20/100,000 specific to Portugal; not yet found in other geographic regions. Founder effect from Iberian Peninsula [@genereviews:NBK541729].", - "age_onset": "Typical: 33-53; Range: 18-64 [@genereviews:NBK541729].", - "age_onset_min": 18, - "age_onset_max": 64, - "typ_age_onset_min": 33, - "typ_age_onset_max": 53, - "details": "Pathogenicity only associated with pathogenic motif >30 repeats, flanked by at least 58 repeats of reference motif on either side; reference repeat (AAAAT) can range from 1 to 400 repeats, although typically less than 30 [@genereviews:NBK541729]. The pathogenic motif is unstable, particularly when transmitted by the father [@genereviews:NBK541729].", - "detection": "Short-read sequencing, exome sequencing, and RP-PCR do not accurately detect this repeat, but long-range PCR with targeted Sanger sequencing is commonly used for detection and characterization [@genereviews:NBK541729].", - "mechanism": "GoF", - "mechanism_detail": "Toxic gain-of-function mechanism in protein, associated with alternative splicing, an RNA switch, and an upregulation of reelin-DAB1 signalling [@omim:615945; @pmid:30284037].", - "year": "2017 [@pmid:28686858]", - "location_in_gene": "Intron 1 (most isoforms)", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "AAAAT" - ], - "pathogenic_motif_reference_orientation": [ - "GAAAT" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "AAAAA" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "TTTTT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "AAAAT", - "count": 7, - "type": "internal_repeat" - }, - { - "motif": "GAAAT", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 0, - "benign_max": 30, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 31, - "pathogenic_max": 75, - "motif_len": 5, - "ref_copies": 0, - "novel": "novel", - "gard": [ - "12368" - ], - "genereviews": [ - "NBK541729" - ], - "malacard": [ - "SPN283" - ], - "medgen": [ - "855217" - ], - "mondo": [ - "0014410" - ], - "omim": [ - "615945" - ], - "orphanet": [ - "363710" - ], - "gnomad": [ - "DAB1" - ], - "stripy": [ - "DAB1" - ], - "tr_atlas": [ - "TR3445" - ], - "webstr_hg38": [ - "1144531" - ], - "webstr_hg19": [ - "STR_39393" - ], - "locus_tags": [ - "maternal_expansion", - "paternal_expansion", - "motif_affects_onset", - "motif_affects_penetrance" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK541729", - "omim:615945", - "pmid:30284037", - "pmid:28686858", - "mondo:0014410" - ], - "additional_literature": [ - "pmid:41871099", - "pmid:41426430", - "pmid:38961870", - "pmid:36622139", - "pmid:36148898", - "pmid:36092952", - "pmid:32582864", - "pmid:30588707" - ] + "motif": "TTC", + "count": null, + "type": "pathogenic_repeat" }, { - "id": "FRA12A_DIP2B", - "disease_id": "FRA12A", - "gene": "DIP2B", - "evidence": [ - "Disputed" - ], - "chrom": "chr12", - "start_hg38": 50505001, - "stop_hg38": 50505024, - "start_hg19": 50898784, - "stop_hg19": 50898807, - "start_t2t": 50468095, - "stop_t2t": 50468118, - "disease": "Intellectual developmental disorder, FRA12A type", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. Impaired intellectual development with or without other anomalies has been described in patients with over 40% of cells expressing FRA12A [@omim:136630]. The DIP2B CGG repeat expansion causes this folate-sensitive site and is associated with a broad phenotypic range, including intellectual disability, ataxia/movement disorder, and epilepsy [@pmid:39854091; @pmid:17236128; @pmid:34622207]; cardiovascular associations have also been reported [@pmid:38418263].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Appears to occur in those of European ancestry/ethnicity [@omim:136630].", - "age_onset": "Typical: 0-1 (small sample size) [@pmid:3742859]. Range: 0-3 [@pmid:4042396].", - "age_onset_min": 0, - "age_onset_max": 3, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Repeat ranges reflect affected and unaffected individuals from a cohort study of 70 controls (6-23 repeats), unaffected carriers representing the intermediate alleles (139-206), and affected individuals (273-306) [@pmid:17236128]. It has been hypothesized that unmethylated expansions may correspond to movement-related phenotypes (chorea, dystonia, and ataxia) [@pmid:39854091].", - "detection": "Short-read sequencing can underestimate expansion size. RP-PCR and Southern blotting detect expansions [@pmid:17236128], while long-read sequencing has been reported to accurately size them [@pmid:39854091].", - "mechanism": "LoF", - "mechanism_detail": "Hypermethylation leading to decreased expression, although unmethylated expansion leads to increased expression [@omim:136630; @pmid:37248219].", - "year": "2007 [@pmid:17236128]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGC" - ], - "pathogenic_motif_reference_orientation": [ - "GGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 23, - "intermediate_min": 139, - "intermediate_max": 206, - "pathogenic_min": 273, - "pathogenic_max": 306, - "motif_len": 3, - "ref_copies": 7, - "novel": "ref", - "gard": [], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "INT482" - ], - "medgen": [ - "369613" - ], - "mondo": [ - "0007634" - ], - "omim": [ - "136630" - ], - "orphanet": [], - "gnomad": [ - "DIP2B" - ], - "stripy": [ - "DIP2B" - ], - "tr_atlas": [ - "TR116656" - ], - "webstr_hg38": [ - "5075695" - ], - "webstr_hg19": [ - "Expansion_FRA12A_MR/DIP2B" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:3742859", - "pmid:4042396", - "omim:136630", - "pmid:37248219", - "pmid:17236128", - "pmid:39854091", - "pmid:34622207", - "pmid:38418263" - ], - "additional_literature": [ - "pmid:42205056", - "pmid:37090938" - ] - }, + "motif": "T", + "count": 8, + "type": "flank_repeat" + }], + "benign_min": 16, + "benign_max": 33, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 59, + "pathogenic_max": 82, + "motif_len": 3, + "ref_copies": 16.7, + "novel": "ref", + "gard": ["6291"], + "genereviews": ["NBK535148"], + "malacard": ["MSC157"], + "medgen": ["3925"], + "mondo": ["0010679"], + "omim": ["310200"], + "orphanet": ["98896"], + "gnomad": ["DMD"], + "stripy": ["DMD"], + "tr_atlas": ["TR167703"], + "webstr_hg38": [], + "webstr_hg19": ["STR_1545664"], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:27417533", "pmid:16969582", "genereviews:NBK1119", "pmid:35168641", "mondo:0010679"], + "additional_literature": ["pmid:41906116", "pmid:41691287", "pmid:41244984", "pmid:41173008", "pmid:39874107", "pmid:39803454", "pmid:39713478", "pmid:39251998", "pmid:38290145", "pmid:37829280", "pmid:37270548", "pmid:37090938", "pmid:36975100", "pmid:36048237", "pmid:35615378", "pmid:35093299", "pmid:34371182", "pmid:34238289", "pmid:33349121", "pmid:30914715", "pmid:30349485", "pmid:29687370", "pmid:27924830", "pmid:27178005", "pmid:27529242", "pmid:27276190", "pmid:24411039", "pmid:25804023", "pmid:24191945", "pmid:23894429", "pmid:23695957", "pmid:23659897", "pmid:23574351", "pmid:23538453", "pmid:21901138", "pmid:21305566", "pmid:22830166", "pmid:19927354", "pmid:19907931", "pmid:19309270", "pmid:19158820", "pmid:19108751", "pmid:18393226", "pmid:18359022", "pmid:17439955", "pmid:16553208", "pmid:16415967", "pmid:12132577", "pmid:11807410", "pmid:11593558", "pmid:11280167", "pmid:11185740", "pmid:10445321", "pmid:9894797", "pmid:8588583", "pmid:7633442", "pmid:7705851"] +}, +{ + "id": "DM1_DMPK", + "disease_id": "DM1", + "gene": "DMPK", + "evidence": ["Definitive"], + "chrom": "chr19", + "start_hg38": 45770204, + "stop_hg38": 45770266, + "start_hg19": 46273462, + "stop_hg19": 46273524, + "start_t2t": 48597739, + "stop_t2t": 48597756, + "disease": "Myotonic dystrophy type 1", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Steinert disease, also known as myotonic dystrophy type 1, is a muscle disease characterized by myotonia and by multiorgan damage that combines various degrees of muscle weakness, arrhythmia and/or cardiac conduction disorders, cataract, endocrine damage, sleep disorders and baldness [@mondo:0008056]. It has also been linked to Autism and related traits, especially in individuals with earlier onset [@pmid:40259070; @pmid:29361396; @pmid:8810716; @pmid:27695335; @pmid:29871899; @pmid:37209486].", + "hpo_terms": null, + "prevalence": "9.27/100000", + "prevalence_details": "5-20/100,000 [@genereviews:NBK1165]. 0.5-18.1/100,000 [@pmid:29100084]; 6.5/100,000 [@pmid:31159885]. 9.27 cases (95% CI: 4.73-15.21) per 100,000, ranging from 0.37 to 36.29 cases per 100,000 [@pmid:35483324]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1165].", + "age_onset": "Typical: 10-30 [@genereviews:NBK1165]; Range: 0-74 [@pmid:38454488].", + "age_onset_min": 0.0, + "age_onset_max": 74.0, + "typ_age_onset_min": 10.0, + "typ_age_onset_max": 30.0, + "details": "Intermediate alleles (35-49) associated with premutation [@genereviews:NBK1165]. 3%-8% of DM1 expansions contain interrupting variant repeats such as CCG and CGG, associated with later onset and milder phenotype; the variant repeat GCGGCA has also been reported [@pmid:32851192; @pmid:39710066]. In another study, interruptions of the CTG repeat with CCG, GGC, CTC or CAG motifs are estimated to occur in 3-11% of DM1 patients [@pmid:35741732]. Expansions within gene ZNF850 may function as DM1 modifiers [@pmid:39679849].", + "detection": "Flanking PCR has detected alleles up to ~150 repeats, while RP-PCR may detect missed expanded alleles [@genereviews:NBK1165; @pmid:24795756]. Southern blotting has approximated the size of large expansions [@pmid:22643181], while long-read sequencing has resolved repeat size and structure [@pmid:41974889].", + "mechanism": "GoF", + "mechanism_detail": "RNA gain-of-function: RNA gelation leading to misregulation of alternative splicing [@pmid:36169768]. Expanded DMPK r(CUG)n RNA forms a hairpin containing periodic 1*1 U/U internal loops that engage/sequester MBNL family RNA-binding proteins, especially MBNL1 [@pmid:42182465], disrupting pre mRNA processing and contributing to cardiac phenotypes [@pmid:39932794]. Loss of MBNL proteins has been linked to mis-splicing of Autism spectrum-risk genes such as SCN2A, ANK2, and SHANK2, possibly leading to Autism-related traits [@pmid:40259070]. Evidence suggests that disulfide bond-dependent MBNL1/MBNL2 dimerization maintains toxic RNA foci [@pmid:41929128].", + "year": "1992 [@pmid:1310900]", + "location_in_gene": "3' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CTG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 34, + "intermediate_min": 35, + "intermediate_max": 49, + "pathogenic_min": 50, + "pathogenic_max": 4000, + "motif_len": 3, + "ref_copies": 20.7, + "novel": "ref", + "gard": ["8310"], + "genereviews": ["NBK1165"], + "malacard": ["MYT021"], + "medgen": ["886881"], + "mondo": ["0008056"], + "omim": ["160900"], + "orphanet": ["273"], + "gnomad": ["DMPK"], + "stripy": ["DMPK"], + "tr_atlas": ["TR156684"], + "webstr_hg38": ["5650727"], + "webstr_hg19": ["Expansion_DM1/DMPK"], + "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "length_affects_onset", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability", "motif_affects_onset", "motif_affects_phenotype", "motif_affects_severity"], + "disease_tags": ["myotonic_dystrophy"], + "references": ["genereviews:NBK1165", "pmid:38454488", "pmid:36169768", "pmid:39932794", "pmid:40259070", "pmid:41929128", "pmid:39643839", "pmid:32851192", "doi:10.1016/j.mcp.2024.102005", "pmid:35741732", "doi:10.1093/hmg/ddae186", "pmid:29100084", "pmid:31159885", "pmid:35483324", "pmid:1310900", "mondo:0008056", "pmid:29361396", "pmid:8810716", "pmid:27695335", "pmid:29871899", "pmid:37209486"], + "additional_literature": ["pmid:41996006", "pmid:41974889", "pmid:41951733", "pmid:41946260", "pmid:41855125", "pmid:41848171", "pmid:41766784", "pmid:41762523", "pmid:41722569", "pmid:41710065", "pmid:41707138", "pmid:41672630", "pmid:41610137", "pmid:41533635", "pmid:41379996", "pmid:41260620", "pmid:41250834", "pmid:41226829", "pmid:41212113", "pmid:41161721", "pmid:41074692", "pmid:40903903", "pmid:40896579", "pmid:40879030", "pmid:40712995", "pmid:40606545", "pmid:40599975", "pmid:40417743", "pmid:40296143", "pmid:40113266", "pmid:40092662", "pmid:40004498", "pmid:39710066", "pmid:39679849", "pmid:39492694", "pmid:39433769", "pmid:39415708", "pmid:39391712", "pmid:39383229", "pmid:39278936", "pmid:39267217", "pmid:39273681", "pmid:39232665", "pmid:39180495", "pmid:39126705", "pmid:38709060", "pmid:38704930", "pmid:38490135", "pmid:38314057", "pmid:37829280", "pmid:37744174", "pmid:37645891", "pmid:37638448", "pmid:37521782", "pmid:37397246", "pmid:37373276", "pmid:37352653", "pmid:37200862", "pmid:37146135", "pmid:37143315", "pmid:36892629", "pmid:36778282", "pmid:36701310", "pmid:36627397", "pmid:36352383", "pmid:36230978", "pmid:36222125", "pmid:36099027", "pmid:36084803", "pmid:36011377", "pmid:35770133", "pmid:35767654", "pmid:35567413", "pmid:35328504", "pmid:35243403", "pmid:35182509", "pmid:34976437", "pmid:34915310", "pmid:34513303", "pmid:34472530", "pmid:34432028", "pmid:34386887", "pmid:34372915", "pmid:34371182", "pmid:34262431", "pmid:34114350", "pmid:34025359", "pmid:33682722", "pmid:33624941", "pmid:33575482", "pmid:33526774", "pmid:33497365", "pmid:33363709", "pmid:33362853", "pmid:33235377", "pmid:32929188", "pmid:32823742", "pmid:32717741", "pmid:32656337", "pmid:32607474", "pmid:32350131", "pmid:32203199", "pmid:32109384", "pmid:32063450", "pmid:31996899", "pmid:31873063", "pmid:31759551", "pmid:31649961", "pmid:31624084", "pmid:31570586", "pmid:31395669", "pmid:31334355", "pmid:31316546", "pmid:31253581", "pmid:31227653", "pmid:31220271", "pmid:31164682", "pmid:31027145", "pmid:30891637", "pmid:30700578", "pmid:30615214", "pmid:30546383", "pmid:30425655", "pmid:30304901", "pmid:30216892", "pmid:30140252", "pmid:29967337", "pmid:29947794", "pmid:29592894", "pmid:29551391", "pmid:29381654", "pmid:29334465", "pmid:29274549", "pmid:29246312", "pmid:29114849", "pmid:28942489", "pmid:28886202", "pmid:28810563", "pmid:28782311", "pmid:28623239", "pmid:28435090", "pmid:28363916", "pmid:28211918", "pmid:28129118", "pmid:28102759", "pmid:27854230", "pmid:27727437", "pmid:27358583", "pmid:27245480", "pmid:27222292", "pmid:26708183", "pmid:26640575", "pmid:26586700", "pmid:26498872", "pmid:26190529", "pmid:25958258", "pmid:25712547", "pmid:25655594", "pmid:25606394", "pmid:25307018", "pmid:25303993", "pmid:25168381", "pmid:24824895", "pmid:24795756", "pmid:24781112", "pmid:24715907", "pmid:24705798", "pmid:24455202", "pmid:24269018", "pmid:24196578", "pmid:24092878", "pmid:23811192", "pmid:23570879", "pmid:23308382", "pmid:26317000", "pmid:23263591", "pmid:23209425", "pmid:23183533", "pmid:23161457", "pmid:23159592", "pmid:23139243", "pmid:22643181", "pmid:22595968", "pmid:22459146", "pmid:22427994", "pmid:22078098", "pmid:22062891", "pmid:21971425", "pmid:21949239", "pmid:21511730", "pmid:21303839", "pmid:21245981", "pmid:21204798", "pmid:21103235", "pmid:20801043", "pmid:20635151", "pmid:20603324", "pmid:20346670", "pmid:20228473", "pmid:20179953", "pmid:20171614", "pmid:20074967", "pmid:19946639", "pmid:19715468", "pmid:19632331", "pmid:19516957", "pmid:19470458", "pmid:18798829", "pmid:18729234", "pmid:18611984", "pmid:18563724", "pmid:18561181", "pmid:18559347", "pmid:18299519", "pmid:18228241", "pmid:18213375", "pmid:17987120", "pmid:17950578", "pmid:17877752", "pmid:17728322", "pmid:17487865", "pmid:17158949", "pmid:17150182", "pmid:17145685", "pmid:17114933", "pmid:16978612", "pmid:16927100", "pmid:16716318", "pmid:16624843", "pmid:16401743", "pmid:16376058", "pmid:16193250", "pmid:16027111", "pmid:15972723", "pmid:15961406", "pmid:15750273", "pmid:15684391", "pmid:15576360", "pmid:15489504", "pmid:15462191", "pmid:15459182", "pmid:15336691", "pmid:15215218", "pmid:15114529", "pmid:15019706", "pmid:14734627", "pmid:14597103", "pmid:12970845", "pmid:12630069", "pmid:12614928", "pmid:12427866", "pmid:11978764", "pmid:11809728", "pmid:11793472", "pmid:11726559", "pmid:11686919", "pmid:11592825", "pmid:11590133", "pmid:11555624", "pmid:11526199", "pmid:11260612", "pmid:11124939", "pmid:11013451", "pmid:11001736", "pmid:10970838", "pmid:10958655", "pmid:10951446", "pmid:10909850", "pmid:10802668", "pmid:10802667", "pmid:10767343", "pmid:10699184", "pmid:10668800", "pmid:10480373", "pmid:10454725", "pmid:10435210", "pmid:10332037", "pmid:10332033", "pmid:9950368", "pmid:9887331", "pmid:9858828", "pmid:9668171", "pmid:9537423", "pmid:9402536", "pmid:9401353", "pmid:9371827", "pmid:9294109", "pmid:9241283", "pmid:9241282", "pmid:9207101", "pmid:8948631", "pmid:8923304", "pmid:8673131", "pmid:8659513", "pmid:8784809", "pmid:8595416", "pmid:7626046", "pmid:7590731", "pmid:7726160", "pmid:7896884", "pmid:8288237"] +}, +{ + "id": "RCPS_EIF4A3", + "disease_id": "RCPS", + "gene": "EIF4A3", + "evidence": ["Definitive"], + "chrom": "chr17", + "start_hg38": 80147009, + "stop_hg38": 80147139, + "start_hg19": 78120808, + "stop_hg19": 78120938, + "start_t2t": 81047404, + "stop_t2t": 81047534, + "disease": "Richieri-Costa-Pereira syndrome", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Richieri Costa-Pereira syndrome is characterized by short stature, Robin sequence, cleft mandible, pre/postaxial hand anomalies (including hypoplastic thumbs), and clubfoot. It has been described in 14 Brazilian families and in one unrelated French patient. Prominent low set ears and a highly arched palate were also observed. Transmission is autosomal recessive [@mondo:0009998].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "49 cases as of Nov 2023 [@doi:10.1016/j.omsc.2023.100340]. Found in Brazilian families and one unrelated French patient [@mondo:0009998].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": 0.0, + "typ_age_onset_max": 0.0, + "details": "Complex repeat of 18-20 nucleotides expands to cause disease: disease is found in individuals with 14-16 repeats [@pmid:24360810], while controls have typically 3-12 repeats with as low as 1 repeat [@genereviews:NBK535148; @gnomad:EIF4A3]. Significance of intermediate alleles is unknown [@pmid:29112243].", + "detection": "Short-read sequencing and exome sequencing do not reliably detect this expansion. Targeted 5′ UTR PCR with Sanger sequencing is the common detection methodology [@pmid:29112243; @pmid:24360810].", + "mechanism": "LoF", + "mechanism_detail": "LoF from a hypomorphic allele [@pmid:24360810].", + "year": "2014 [@pmid:24360810]; syndrome described in 1992 [@pmid:1632438]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CCTCGCTGTGCCGCTGCCGA"], + "pathogenic_motif_reference_orientation": ["CCTCGCTGTGCCGCTGCCGA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ACAGCGAGGTCGGCAGCGGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 1, + "benign_max": 12, + "intermediate_min": 13, + "intermediate_max": 13, + "pathogenic_min": 14, + "pathogenic_max": 16, + "motif_len": 20, + "ref_copies": null, + "novel": "ref", + "gard": ["4718"], + "genereviews": ["NBK535148"], + "malacard": ["RBN014"], + "medgen": ["336581"], + "mondo": ["0009998"], + "omim": ["268305"], + "orphanet": ["3102"], + "gnomad": ["EIF4A3"], + "stripy": [], + "tr_atlas": ["TR148462"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:24360810", "genereviews:NBK535148", "gnomad:EIF4A3", "pmid:29112243", "doi:10.1016/j.omsc.2023.100340", "mondo:0009998", "pmid:1632438"], + "additional_literature": [] +}, +{ + "id": "OPDM_FAM193B", + "disease_id": "OPDM", + "gene": "FAM193B", + "evidence": ["Provisional"], + "chrom": "chr5", + "start_hg38": 177554489, + "stop_hg38": 177554531, + "start_hg19": 176981490, + "stop_hg19": 176981532, + "start_t2t": 178096748, + "stop_t2t": 178096792, + "disease": "Oculopharyngodistal myopathy", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "This is a newly proposed locus for OPDM, it does not have a type number yet and has not been validated. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in two siblings in a UDN family [@pmid:38297326; @pmid:40357124].", + "age_onset": "49-51 based on two siblings [@pmid:39868092].", + "age_onset_min": 49.0, + "age_onset_max": 51.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (<50) inferred from cohort data, but exact upper bound was not reported. Two affected patients had repeat lengths of 194 and 198, with an unaffected parent with a repeat length of 158 [@pmid:39868092]. The unaffected parent makes the inheritance pattern uncertain, but it appears to be autosomal dominant.", + "detection": null, + "mechanism": null, + "mechanism_detail": "Accumulation of toxic RAN proteins is a proposed mechanism [@pmid:38585781]", + "year": "2026 [@pmid:39868092]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 0, + "benign_max": 50, + "intermediate_min": 158, + "intermediate_max": 158, + "pathogenic_min": 194, + "pathogenic_max": 198, + "motif_len": 3, + "ref_copies": null, + "novel": "ref", + "gard": ["12592"], + "genereviews": [], + "malacard": [], + "medgen": ["320250"], + "mondo": [], + "omim": ["615813"], + "orphanet": ["98897"], + "gnomad": ["FAM193B"], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": ["oculopharyngodistal_myopathy"], + "references": ["pmid:39868092", "pmid:38585781", "pmid:38297326", "pmid:40357124", "mondo:0025193"], + "additional_literature": [] +}, +{ + "id": "SCA27B_FGF14", + "disease_id": "SCA27B", + "gene": "FGF14", + "evidence": ["Definitive"], + "chrom": "chr13", + "start_hg38": 102161574, + "stop_hg38": 102161726, + "start_hg19": 102813924, + "stop_hg19": 102814076, + "start_t2t": 101377549, + "stop_t2t": 101377792, + "disease": "Spinocerebellar ataxia 27B", + "inheritance": ["AD"], + "association_type": ["Mendelian", "Risk"], + "disease_description": "Late-onset ataxia, may have episodic onset, downbeat nystagmus, vertigo, dysarthria, visual disturbances, and neuropathy [@pmid:39349043; @pmid:42044943]. Involvement of the superior cerebellar peduncles is frequent and may aid in diagnostic efforts [@pmid:39996128].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Intermediate expansions 1-2% of population, but non-GAA-pure without relation to ataxia [@genereviews:NBK599589]. Found in multiple ethnicities [@pmid:38876750]; diagnosed patients in America, Brazil, Japan, Germany, Spain, Canada, France, Austria, Australia, Italy, and Poland [@genereviews:NBK599589; @pmid:38886208; @pmid:37267898; @pmid:42096001]. Prevalence is population dependent, ranging from 1.83% to 61% of different ataxia cohorts, with specific enrichment in French-Canadian populations [@pmid:36516086; @pmid:42090775].", + "age_onset": "Typical: 42-70; Range: 21-87 [@genereviews:NBK599589; @pmid:39263992].", + "age_onset_min": 21.0, + "age_onset_max": 87.0, + "typ_age_onset_min": 42.0, + "typ_age_onset_max": 70.0, + "details": "Higher repeat size is associated with earlier age of onset [@pmid:39263992]. The 250-300 repeats range is linked to incomplete penetrance and >300 repeats with complete penetrance in some studies and resources [@genereviews:NBK599589; @pmid:37399286; @pmid:39227614]. However, our thresholds are taken from suggestions made by Mohren et al upon evaluation of 169 cases and 802 controls; the authors propose lower thresholds based on pathogenic cases of shorter pure repeats [@pmid:39227614]. Additionally, this study suggests that benign motifs may disrupt the formation of secondary structures in DNA/RNA, leading to reduced pathogenicity. The effects of interruptions on penetrance and onset have been demonstrated in patients, with uninterrupted expansions apparently necessary for disease [@pmid:40007153]. Interruptions of GAG, GAAGGA, GAAGAAAGAA, GAAAAGAAGAAGGAAGAAGGAA, GAAAAGAAGAAGGAA, and GCAGAAGAAGAAGAA have been reported [@pmid:40379261]. Variation in flanking regions appears to correlate with repeat size [@pmid:39227614; @pmid:38937606]. Intermediate alleles may increase ataxia susceptibility in combination with other factors or be associated with a phenotypic spectrum (multiple system atrophy) [@pmid:39227614; @pmid:39604554]. A complex (TTC/TGC) ≥300 repeat expansion has been associated as a risk factor for Parkinson's disease [@pmid:41327893; @pmid:41277530]. Expansions can sometimes present as apparently sporadic adult-onset ataxia despite autosomal dominant inheritance [@pmid:42204984].", + "detection": "Short-read genome and exome sequencing are reported to be inaccurate in detecting these expansions [@genereviews:NBK599589]. Long-range PCR and bidirectional RP-PCR have been used for detection, while long-read sequencing has determined repeat structure and purity [@genereviews:NBK599589; @pmid:36516086].", + "mechanism": "LoF", + "mechanism_detail": "Reduced transcript 2 [@pmid:36516086].", + "year": "2023 [@pmid:36493768]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GAA"], + "pathogenic_motif_reference_orientation": ["GAA"], + "benign_motif_reference_orientation": ["GGA", "GCA"], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["GAG", "GAAGGA", "GAAGAAAGAA", "GAAAAGAAGAAGGAAGAAGGAA", "GAAAAGAAGAAGGAA", "GCAGAAGAAGAAGAA"], + "pathogenic_motif_gene_orientation": ["CTT"], + "benign_motif_gene_orientation": ["CCT", "CTG"], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["CCT", "CCTTCT", "CTTCTTCTTT", "CCTTCTTCCTTCTTCTTTTCTT", "CCTTCTTCTTTTCTT", "CTGCTTCTTCTTCTT"], + "locus_structure": [], + "benign_min": 8, + "benign_max": 179, + "intermediate_min": 180, + "intermediate_max": 319, + "pathogenic_min": 320, + "pathogenic_max": 937, + "motif_len": 3, + "ref_copies": 50.3, + "novel": "ref", + "gard": [], + "genereviews": ["NBK599589"], + "malacard": ["SPN469"], + "medgen": ["1824051"], + "mondo": ["0859340"], + "omim": ["620174"], + "orphanet": ["675216"], + "gnomad": ["FGF14"], + "stripy": ["FGF14"], + "tr_atlas": [], + "webstr_hg38": ["1272528"], + "webstr_hg19": [], + "locus_tags": ["maternal_expansion", "length_affects_onset", "length_affects_penetrance", "motif_affects_penetrance", "length_affects_phenotype"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["genereviews:NBK599589", "pmid:39263992", "pmid:36516086", "pmid:37399286", "pmid:39227614", "pmid:40007153", "pmid:40379261", "pmid:38937606", "pmid:39604554", "pmid:41327893", "pmid:41277530", "pmid:38876750", "pmid:38886208", "pmid:37267898", "pmid:36493768", "pmid:39349043", "pmid:42044943", "doi:10.1212/NXG.0000000000200253"], + "additional_literature": ["pmid:42055934", "pmid:42044943", "pmid:41698164", "pmid:41504274", "pmid:41118032", "pmid:41065930", "pmid:41055766", "pmid:40974444", "pmid:40906330", "pmid:40898875", "pmid:40894141", "pmid:40879304", "pmid:40835733", "pmid:40679574", "pmid:40637932", "pmid:40623333", "pmid:40579842", "pmid:40556471", "pmid:40488180", "pmid:40273470", "pmid:40239008", "pmid:40191983", "pmid:40141365", "pmid:40024931", "pmid:40017559", "pmid:39996128", "pmid:39821862", "pmid:39801711", "pmid:39723156", "pmid:39666057", "pmid:39666053", "pmid:39574782", "pmid:39571249", "pmid:39392764", "pmid:39378335", "pmid:39152783", "pmid:39006414", "pmid:38976084", "pmid:38949032", "pmid:38866925", "pmid:38816190", "pmid:38513302", "pmid:38487929", "pmid:38472396", "pmid:38405699", "pmid:38381176", "pmid:38221848", "pmid:38170134", "pmid:38150853", "pmid:38058854", "pmid:37916889", "pmid:37646005", "pmid:37578187", "pmid:37577458", "pmid:37322040", "pmid:37165652", "pmid:32717741", "pmid:30017992", "pmid:28444220", "pmid:26677414", "pmid:26149656", "pmid:15470364", "pmid:15148151"] +}, +{ + "id": "FXS_FMR1", + "disease_id": "FXS, FXTAS, POF1", + "gene": "FMR1", + "evidence": ["Definitive"], + "chrom": "chrX", + "start_hg38": 147912049, + "stop_hg38": 147912111, + "start_hg19": 146993567, + "stop_hg19": 146993629, + "start_t2t": 146176677, + "stop_t2t": 146176769, + "disease": "Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1", + "inheritance": ["XD"], + "association_type": ["Mendelian"], + "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X messenger ribonucleoprotein 1 (FMR1) protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].", + "hpo_terms": null, + "prevalence": "14/100000", + "prevalence_details": "Incidence of full mutation in males 19/100,000; prevalence 14/100,000 [@genereviews:NBK1384]. Female prevalence 9/100,000 [@pmid:24700618]. Known carrier frequency is approximately 300-500/100,000 but detected was 11/100,000 [@pmid:29100084]. FXS prevalence 1:7000 males, 1:11,000 females; FX premutation carriers 1:290-855 males, 1:148-300 females [@isbn:978-3-031-66932-3]. Found worldwide [@genereviews:NBK1384]. In Thailand, 1 in 600 women carry a premutation, and 1 in 400 carry a 'gray zone' allele [@pmid:39320553].", + "age_onset": "Typical: FXS 1 to 'first several years of life', FXTAS 60-65 [@genereviews:NBK1384]; Range: 0 [@url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents] - 78 [@pmid:17427188]; detailed description of typical symptom onset and diagnosis available from Arnold et al [@isbn:978-3-031-66932-3].", + "age_onset_min": 0.0, + "age_onset_max": 78.0, + "typ_age_onset_min": 1.0, + "typ_age_onset_max": 65.0, + "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108]. Women with the premutation have been reported showing episodic memory deficits, similar to those seen in AD [@pmid:41555826]. AGG interruptions are frequently reported in all associated diseases and appear to stabilize alleles; the length of the longest pure stretch predicts repeat instability [@pmid:7987398]. Elevated POI risk was observed starting at 36 repeats, increasing continuously with repeat length [@pmid:42001465].", + "detection": "Modern PCR techniques detect virtually all FMR1 expansion sizes, while RP-PCR detects AGG interspersions. Southern blotting has been used to approximate size and indicate methylation status [@genereviews:NBK1384]. Long-read sequencing has characterized repeat size, interruptions, methylation, and mosaicism [@pmid:29868108; @pmid:31740840].", + "mechanism": "LoF/GoF", + "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768]. PRKGG appears to modulate neurotoxicity [@pmid:41507195].", + "year": "1992 [@pmid:1605194]; causative gene discovered in 1991 [@pmid:1710175]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CGG"], + "pathogenic_motif_reference_orientation": ["CGG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["AGG", "CTG"], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AGG", "CTG"], + "locus_structure": [], + "benign_min": 5, + "benign_max": 44, + "intermediate_min": 45, + "intermediate_max": 200, + "pathogenic_min": 201, + "pathogenic_max": 2000, + "motif_len": 3, + "ref_copies": 20.6667, + "novel": "ref", + "gard": ["6464", "16806"], + "genereviews": ["NBK1384"], + "malacard": ["FRG001", "FRG008", "PRM405"], + "medgen": ["8912", "1644269", "333403"], + "mondo": ["0010383", "0010706", "0010382"], + "omim": ["300624", "300623"], + "orphanet": ["908", "642691", "93256"], + "gnomad": ["FMR1"], + "stripy": ["FMR1"], + "tr_atlas": ["TR173944"], + "webstr_hg38": ["885222"], + "webstr_hg19": ["Expansion_FXS/FMR1"], + "locus_tags": ["somatic_instability", "anticipation", "maternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability"], + "disease_tags": ["phenotypic_spectrum", "ataxia"], + "references": ["genereviews:NBK1384", "url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents", "pmid:17427188", "isbn:978-3-031-66932-3", "pmid:16205714", "pmid:36169768", "pmid:41507195", "pmid:32463542", "pmid:29868108", "pmid:41555826", "pmid:7987398", "pmid:42001465", "pmid:24700618", "pmid:29100084", "pmid:39320553", "pmid:1605194", "pmid:1710175", "mondo:0010383", "mondo:0010706", "mondo:0010382"], + "additional_literature": ["pmid:42041789", "pmid:42001465", "pmid:41952192", "pmid:41929501", "pmid:41917775", "pmid:41806827", "pmid:41792844", "pmid:41777701", "pmid:41762523", "pmid:41717020", "pmid:41672630", "pmid:41648852", "pmid:41557506", "pmid:41523206", "pmid:41514368", "pmid:41409170", "pmid:41386846", "pmid:41385812", "pmid:41372183", "pmid:41351347", "pmid:41278766", "pmid:41256123", "pmid:41167304", "pmid:41145158", "pmid:41120736", "pmid:41098569", "pmid:41074692", "pmid:41028987", "pmid:41015363", "pmid:40980401", "pmid:40940631", "pmid:40877251", "pmid:40869951", "pmid:40879637", "pmid:40778130", "pmid:40653294", "pmid:40600017", "pmid:40534679", "pmid:40488180", "pmid:40480633", "pmid:40459253", "pmid:40455869", "pmid:40418066", "pmid:40417743", "pmid:40296143", "pmid:40287634", "pmid:40244008", "pmid:40243429", "pmid:40243408", "pmid:40220918", "pmid:40166285", "pmid:40149430", "pmid:40141467", "pmid:40141297", "pmid:39945490", "pmid:39934227", "pmid:39839505", "pmid:39684429", "pmid:39654947", "pmid:39588919", "pmid:39574643", "pmid:39553953", "pmid:39492694", "pmid:39482338", "pmid:39488698", "pmid:39095619", "pmid:38997701", "pmid:38961870", "pmid:38946987", "pmid:38865241", "pmid:38772058", "pmid:38714961", "pmid:38522837", "pmid:38412259", "pmid:38307002", "pmid:38164622", "pmid:38162443", "pmid:38134876", "pmid:37970883", "pmid:37936174", "pmid:37906407", "pmid:37776526", "pmid:37745859", "pmid:37628570", "pmid:37583466", "pmid:37551886", "pmid:37551173", "pmid:37508562", "pmid:37364131", "pmid:37352983", "pmid:37347418", "pmid:37333274", "pmid:37209683", "pmid:37200782", "pmid:37146135", "pmid:37120588", "pmid:36882476", "pmid:36816716", "pmid:36250920", "pmid:36227727", "pmid:36012355", "pmid:35977823", "pmid:35948990", "pmid:35904811", "pmid:35729184", "pmid:35701103", "pmid:35681093", "pmid:35609145", "pmid:35182509", "pmid:35152460", "pmid:35129870", "pmid:35101584", "pmid:35072235", "pmid:35038595", "pmid:35026985", "pmid:34938155", "pmid:34926684", "pmid:34924936", "pmid:34880790", "pmid:34845661", "pmid:34828275", "pmid:34738199", "pmid:34690787", "pmid:34679478", "pmid:34646309", "pmid:34641814", "pmid:34641644", "pmid:34542254", "pmid:34456771", "pmid:34421690", "pmid:34372915", "pmid:34358321", "pmid:34321326", "pmid:34296199", "pmid:34276797", "pmid:34193467", "pmid:34153466", "pmid:34117786", "pmid:34111553", "pmid:34077515", "pmid:34054431", "pmid:34046842", "pmid:33998336", "pmid:33856019", "pmid:33854084", "pmid:33772546", "pmid:33709078", "pmid:33692361", "pmid:33642901", "pmid:33627639", "pmid:33585555", "pmid:33523882", "pmid:33497798", "pmid:33381520", "pmid:33374331", "pmid:33296661", "pmid:33195422", "pmid:33181255", "pmid:33151065", "pmid:33039683", "pmid:33008014", "pmid:33007370", "pmid:32787884", "pmid:32716213", "pmid:32695777", "pmid:32688058", "pmid:32589669", "pmid:32478017", "pmid:32446918", "pmid:32281281", "pmid:32258228", "pmid:32089525", "pmid:32066985", "pmid:32048109", "pmid:32012997", "pmid:31991700", "pmid:31989181", "pmid:31891607", "pmid:31887710", "pmid:31880363", "pmid:31866572", "pmid:31804632", "pmid:31733943", "pmid:31671347", "pmid:31665086", "pmid:31632248", "pmid:31586346", "pmid:31566610", "pmid:31512951", "pmid:31481131", "pmid:31468394", "pmid:31347257", "pmid:31336350", "pmid:31332380", "pmid:31299981", "pmid:31294106", "pmid:31264835", "pmid:31159589", "pmid:31096929", "pmid:31026518", "pmid:30984240", "pmid:30900173", "pmid:30847793", "pmid:30840878", "pmid:30832215", "pmid:30808398", "pmid:30665341", "pmid:30619448", "pmid:30606610", "pmid:30576349", "pmid:30567555", "pmid:30566867", "pmid:30538724", "pmid:30509972", "pmid:30396881", "pmid:30396281", "pmid:30312299", "pmid:30311737", "pmid:30211570", "pmid:30197656", "pmid:30173918", "pmid:30160796", "pmid:30158855", "pmid:30147707", "pmid:30030199", "pmid:29990673", "pmid:29981579", "pmid:29971092", "pmid:29880767", "pmid:29844802", "pmid:29766042", "pmid:29760651", "pmid:29379561", "pmid:29375310", "pmid:29316893", "pmid:29275276", "pmid:29267266", "pmid:29209628", "pmid:29188551", "pmid:28967713", "pmid:28895261", "pmid:28829283", "pmid:28815939", "pmid:28812997", "pmid:28697590", "pmid:28504725", "pmid:28454580", "pmid:28391068", "pmid:28369393", "pmid:28278294", "pmid:28233916", "pmid:28193118", "pmid:28173181", "pmid:28103472", "pmid:28065649", "pmid:28005950", "pmid:27883256", "pmid:27862088", "pmid:27841182", "pmid:27841172", "pmid:27840045", "pmid:27822316", "pmid:27816231", "pmid:27784894", "pmid:27646161", "pmid:27768763", "pmid:27761921", "pmid:27667322", "pmid:27616423", "pmid:27713816", "pmid:27708271", "pmid:27696642", "pmid:27696273", "pmid:27695335", "pmid:27540028", "pmid:27427765", "pmid:27375073", "pmid:27372099", "pmid:27355815", "pmid:27355445", "pmid:27335370", "pmid:27315125", "pmid:27294193", "pmid:27066582", "pmid:27042357", "pmid:27041225", "pmid:27001315", "pmid:26940792", "pmid:26825750", "pmid:26743003", "pmid:26716517", "pmid:26694146", "pmid:26554012", "pmid:26537920", "pmid:26463479", "pmid:26440889", "pmid:26420841", "pmid:26345686", "pmid:26322075", "pmid:26298472", "pmid:26194536", "pmid:26099177", "pmid:26029703", "pmid:25954027", "pmid:25953684", "pmid:25886163", "pmid:25875842", "pmid:25788698", "pmid:25776194", "pmid:25763861", "pmid:25726753", "pmid:25693964", "pmid:25689687", "pmid:25606365", "pmid:25436181", "pmid:25399540", "pmid:25366135", "pmid:25346430", "pmid:25290064", "pmid:25278957", "pmid:25250047", "pmid:25179629", "pmid:25171808", "pmid:25170346", "pmid:25147555", "pmid:25110527", "pmid:25093044", "pmid:25085749", "pmid:25013385", "pmid:24998620", "pmid:24963073", "pmid:24958193", "pmid:24938362", "pmid:24920338", "pmid:24912415", "pmid:24875778", "pmid:24858908", "pmid:24821701", "pmid:24816393", "pmid:24814676", "pmid:24787137", "pmid:24763282", "pmid:24743386", "pmid:24718368", "pmid:24715853", "pmid:24657592", "pmid:24654675", "pmid:24630283", "pmid:24591415", "pmid:24578575", "pmid:24463622", "pmid:24455203", "pmid:24448548", "pmid:24428240", "pmid:24424424", "pmid:24401315", "pmid:24352881", "pmid:24289922", "pmid:24261641", "pmid:24249225", "pmid:24177047", "pmid:24130133", "pmid:23949867", "pmid:23896050", "pmid:23792063", "pmid:23753897", "pmid:23731704", "pmid:23719910", "pmid:23683082", "pmid:23602499", "pmid:23574351", "pmid:23553633", "pmid:23497562", "pmid:23478018", "pmid:23464607", "pmid:23440729", "pmid:23250915", "pmid:23198693", "pmid:23148490", "pmid:23146966", "pmid:23015788", "pmid:22924671", "pmid:22918986", "pmid:22887750", "pmid:22796595", "pmid:22707411", "pmid:22612820", "pmid:22619118", "pmid:22581803", "pmid:22507827", "pmid:22498846", "pmid:22489017", "pmid:22466801", "pmid:22427040", "pmid:22393900", "pmid:22387066", "pmid:22311273", "pmid:22251309", "pmid:22241100", "pmid:22224633", "pmid:22223546", "pmid:22211843", "pmid:22177572", "pmid:22161987", "pmid:22149120", "pmid:22022567", "pmid:22004265", "pmid:21944929", "pmid:21808616", "pmid:21807882", "pmid:21775729", "pmid:21767618", "pmid:21720528", "pmid:21671049", "pmid:21646280", "pmid:21636656", "pmid:21617890", "pmid:21596781", "pmid:21572337", "pmid:21567456", "pmid:21499798", "pmid:21476992", "pmid:21445959", "pmid:21430544", "pmid:21389081", "pmid:21329465", "pmid:21270637", "pmid:21267007", "pmid:21254876", "pmid:21170301", "pmid:21051337", "pmid:20938029", "pmid:20935171", "pmid:20858229", "pmid:20801083", "pmid:20799337", "pmid:20736975", "pmid:20702130", "pmid:20616364", "pmid:20431035", "pmid:20425835", "pmid:20410144", "pmid:20364100", "pmid:20221430", "pmid:20213777", "pmid:20168238", "pmid:20118148", "pmid:20051238", "pmid:20011099", "pmid:20001115", "pmid:19927162", "pmid:19846466", "pmid:19804849", "pmid:19796183", "pmid:19778484", "pmid:19760650", "pmid:19710035", "pmid:19684044", "pmid:19562332", "pmid:19525339", "pmid:19514725", "pmid:19460939", "pmid:19460937", "pmid:19440516", "pmid:19404994", "pmid:19204162", "pmid:19097038", "pmid:19045956", "pmid:19026394", "pmid:19014369", "pmid:18565783", "pmid:18563710", "pmid:18553360", "pmid:18535897", "pmid:18472227", "pmid:18428348", "pmid:18413472", "pmid:18403614", "pmid:18384775", "pmid:18373410", "pmid:18357616", "pmid:18310361", "pmid:18281036", "pmid:18165971", "pmid:18165276", "pmid:18160412", "pmid:18057320", "pmid:17724287", "pmid:17698009", "pmid:17674408", "pmid:17635840", "pmid:17591512", "pmid:17516099", "pmid:17442505", "pmid:17322660", "pmid:17295053", "pmid:17279084", "pmid:17266074", "pmid:17152065", "pmid:17150213", "pmid:17089161", "pmid:17044853", "pmid:16780889", "pmid:16761284", "pmid:16361284", "pmid:16337617", "pmid:16258159", "pmid:16164596", "pmid:16047092", "pmid:15971024", "pmid:15947063", "pmid:15876460", "pmid:15811008", "pmid:15741991", "pmid:15659577", "pmid:15649335", "pmid:15629215", "pmid:15483045", "pmid:15377638", "pmid:15302914", "pmid:15068386", "pmid:14755444", "pmid:14735162", "pmid:14722156", "pmid:14560307", "pmid:14519687", "pmid:14517952", "pmid:12948442", "pmid:12905066", "pmid:12853612", "pmid:12681986", "pmid:12659659", "pmid:12634803", "pmid:12515381", "pmid:12379314", "pmid:12232854", "pmid:12160728", "pmid:12111644", "pmid:11992571", "pmid:11886710", "pmid:11807410", "pmid:11551101", "pmid:11499669", "pmid:11487573", "pmid:11410685", "pmid:11256870", "pmid:11229516", "pmid:11142761", "pmid:11142752", "pmid:11119302", "pmid:11097353", "pmid:11073538", "pmid:11070156", "pmid:11005143", "pmid:10995510", "pmid:10987654", "pmid:10941804", "pmid:10915764", "pmid:10870330", "pmid:10855793", "pmid:10780779", "pmid:10773084", "pmid:10710419", "pmid:10674158", "pmid:10631132", "pmid:10587583", "pmid:10567518", "pmid:10545610", "pmid:10521303", "pmid:10462618", "pmid:10447261", "pmid:10445321", "pmid:10424820", "pmid:10409756", "pmid:10369109", "pmid:10331601", "pmid:10331600", "pmid:10204857", "pmid:9916838", "pmid:9856500", "pmid:9811938", "pmid:9806479", "pmid:9792200", "pmid:9761677", "pmid:9738717", "pmid:9653650", "pmid:9624140", "pmid:9630071", "pmid:9604772", "pmid:9603608", "pmid:9529778", "pmid:9485421", "pmid:9514250", "pmid:9507388", "pmid:9415473", "pmid:9437788", "pmid:9399905", "pmid:9358013", "pmid:9341861", "pmid:9382110", "pmid:9299309", "pmid:9279752", "pmid:9254854", "pmid:9207038", "pmid:9201980", "pmid:9195158", "pmid:9640603", "pmid:9131013", "pmid:8798682", "pmid:8808600", "pmid:8792815", "pmid:8792813", "pmid:8844091", "pmid:8844089", "pmid:8844077", "pmid:8844068", "pmid:8844065", "pmid:8844064", "pmid:8755928", "pmid:8698331", "pmid:8826482", "pmid:8826479", "pmid:8725793", "pmid:8636996", "pmid:8673086", "pmid:8664297", "pmid:8644711", "pmid:8626781", "pmid:8872026", "pmid:8800930", "pmid:8519769", "pmid:8634688", "pmid:7499428", "pmid:8589687", "pmid:7581460", "pmid:8593539", "pmid:8579216", "pmid:8559749", "pmid:7541938", "pmid:7761473", "pmid:7758107", "pmid:7732383", "pmid:7783163", "pmid:8750357", "pmid:7825564", "pmid:7717734", "pmid:7881407", "pmid:7864047", "pmid:7927336", "pmid:7849707", "pmid:8023854", "pmid:8197163", "pmid:8162055", "pmid:8275089", "pmid:8244331", "pmid:8237919", "pmid:7902319", "pmid:7692601", "pmid:8242066", "pmid:8334699", "pmid:1642231", "pmid:1605199"] +}, +{ + "id": "BPES_FOXL2", + "disease_id": "BPES", + "gene": "FOXL2", + "evidence": ["Definitive"], + "chrom": "chr3", + "start_hg38": 138946019, + "stop_hg38": 138946062, + "start_hg19": 138664861, + "stop_hg19": 138664904, + "start_t2t": 141687011, + "stop_t2t": 141687054, + "disease": "Blepharophimosis, epicanthus inversus, and ptosis", + "inheritance": ["AD", "AR"], + "association_type": ["Mendelian"], + "disease_description": "Blepharophimosis, Ptosis, and Epicanthus Inversus syndrome (BPES) is an ophthalmic disorder characterized by blepharophimosis, ptosis, epicanthus inversus, and telecanthus, that can appear associated with (type I) or without premature ovarian failure (POF) (type II) [@mondo:0007201].", + "hpo_terms": null, + "prevalence": "0.3/50000", + "prevalence_details": "1 in 50,000 births globally for all BPES, with FOXL2 expansions ~30% of pathogenic variants [@genereviews:NBK1441; @genereviews:NBK535148; @pmid:12529855]. Found worldwide, without differences in prevalence based on sex/ethnicity [@genereviews:NBK1441].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": 0.0, + "typ_age_onset_max": 0.0, + "details": "14 repeats appears highly constrained in humans: homozygous expansions from 14 polyalanines to 19 leads to disease, which can be limited to isolated palpebral defects [@pmid:15591279]. Heterozygous expansions to 24 polyalanines also lead to disease [@pmid:15591279]. Locus start can differ between catalogs, which can affect genotyping.", + "detection": null, + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyalanine expansion leads to haploinsufficiency, likely due to decreased protein availability due to mislocalization following nuclear inclusion [@genereviews:NBK1441; @pmid:15591279]", + "year": "2003 [@pmid:12529855]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 14, + "benign_max": 14, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 15, + "pathogenic_max": 24, + "motif_len": 3, + "ref_copies": 14.0, + "novel": "ref", + "gard": ["23"], + "genereviews": ["NBK1441"], + "malacard": ["BLP046"], + "medgen": ["66312"], + "mondo": ["0007201"], + "omim": ["110100"], + "orphanet": ["126"], + "gnomad": ["FOXL2"], + "stripy": ["FOXL2"], + "tr_atlas": ["TR36092"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["genereviews:NBK1441", "pmid:15591279", "genereviews:NBK535148", "pmid:12529855", "mondo:0007201"], + "additional_literature": ["pmid:22926839", "pmid:18158309", "pmid:17089161", "pmid:7633459"] +}, +{ + "id": "FRDA_FXN", + "disease_id": "FRDA", + "gene": "FXN", + "evidence": ["Definitive"], + "chrom": "chr9", + "start_hg38": 69037286, + "stop_hg38": 69037304, + "start_hg19": 71652202, + "stop_hg19": 71652220, + "start_t2t": 81210834, + "stop_t2t": 81210861, + "disease": "Friedreich ataxia", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", + "hpo_terms": null, + "prevalence": "1/50000", + "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", + "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", + "age_onset_min": 2.0, + "age_onset_max": 80.0, + "typ_age_onset_min": 10.0, + "typ_age_onset_max": 15.0, + "details": "96% of FA patients have biallelic GAA expansions in intron 1 (compared to compound heterozygous with another mutation type), in which the reference allele is conventionally 5-33 repeats [@genereviews:NBK1281]. Intermediate alleles (34-55) are associated with premutations, but may lead to disease as exact pathogenicity/penetrance thresholds have not been demarcated [@genereviews:NBK1281]. The expanded repeats can be interrupted with GAAGAG, GAAGGA, or GAAGAAAA sequences, leading to differential phenotypes [@pmid:11748752]. Allele size is correlated with disease severity and inversely correlated to age of onset, and expansions can reach 1700 repeats [@pmid:8815938].", + "detection": "RP-PCR and long-range PCR have been used to detect expansions [@pmid:35595154]. Long-read sequencing has sized large alleles and resolved sequence organization [@pmid:35595154].", + "mechanism": "LoF", + "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", + "year": "1996 [@pmid:8596916]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GAA"], + "pathogenic_motif_reference_orientation": ["GAA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AAG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "DMD_DMD", - "disease_id": "DMD", - "gene": "DMD", - "evidence": [ - "Refuted" - ], - "chrom": "chrX", - "start_hg38": 31284557, - "stop_hg38": 31284605, - "start_hg19": 31302674, - "stop_hg19": 31302722, - "start_t2t": 30882677, - "stop_t2t": 30882743, - "disease": "Duchenne muscular dystrophy", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Duchenne muscular dystrophy (DMD) is a neuromuscular disease characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle [@mondo:0010679].", - "hpo_terms": null, - "prevalence": "4.8/100000", - "prevalence_details": "Believed to be 0 for disease specific to STR expansion. 1/3500-4700 male births (incidence) for overall DMD (one of the most common and severe congenital myopathies) [@genereviews:NBK1119]. 4.8/100,000 prevalence [@pmid:35168641]. DMD repeat locus expansion only identified in one Greek family [@pmid:27417533].", - "age_onset": "Typical: 6-7 (usual disease is 0-3) [@pmid:27417533].", - "age_onset_min": 6, - "age_onset_max": 7, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "There is conflicting evidence for the association between this repeat expansion and Duchenne muscular dystrophy. The association was reported in a single family, from which the benign and pathogenic ranges were inferred from affected and unaffected family members [@pmid:27417533]. The population frequency of the proposed pathogenic allele is much higher than expected for a highly penetrant early-onset condition.", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Functional defect in dystrophin/dystroglycan [@pmid:16969582].", - "year": "2016 [@pmid:27417533]", - "location_in_gene": "Intron 62", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "TTC" - ], - "pathogenic_motif_reference_orientation": [ - "TTC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AAG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "TTC", - "count": null, - "type": "pathogenic_repeat" - }, - { - "motif": "T", - "count": 8, - "type": "flank_repeat" - } - ], - "benign_min": 16, - "benign_max": 33, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 59, - "pathogenic_max": 82, - "motif_len": 3, - "ref_copies": 16.7, - "novel": "ref", - "gard": [ - "6291" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "MSC157" - ], - "medgen": [ - "3925" - ], - "mondo": [ - "0010679" - ], - "omim": [ - "310200" - ], - "orphanet": [ - "98896" - ], - "gnomad": [ - "DMD" - ], - "stripy": [ - "DMD" - ], - "tr_atlas": [ - "TR167703" - ], - "webstr_hg38": [], - "webstr_hg19": [ - "STR_1545664" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:27417533", - "pmid:16969582", - "genereviews:NBK1119", - "pmid:35168641", - "mondo:0010679" - ], - "additional_literature": [ - "pmid:41906116", - "pmid:41691287", - "pmid:41244984", - "pmid:41173008", - "pmid:39874107", - "pmid:39803454", - "pmid:39713478", - "pmid:39251998", - "pmid:38290145", - "pmid:37829280", - "pmid:37270548", - "pmid:37090938", - "pmid:36975100", - "pmid:36048237", - "pmid:35615378", - "pmid:35093299", - "pmid:34371182", - "pmid:34238289", - "pmid:33349121", - "pmid:30914715", - "pmid:30349485", - "pmid:29687370", - "pmid:27924830", - "pmid:27178005", - "pmid:27529242", - "pmid:27276190", - "pmid:24411039", - "pmid:25804023", - "pmid:24191945", - "pmid:23894429", - "pmid:23695957", - "pmid:23659897", - "pmid:23574351", - "pmid:23538453", - "pmid:21901138", - "pmid:21305566", - "pmid:22830166", - "pmid:19927354", - "pmid:19907931", - "pmid:19309270", - "pmid:19158820", - "pmid:19108751", - "pmid:18393226", - "pmid:18359022", - "pmid:17439955", - "pmid:16553208", - "pmid:16415967", - "pmid:12132577", - "pmid:11807410", - "pmid:11593558", - "pmid:11280167", - "pmid:11185740", - "pmid:10445321", - "pmid:9894797", - "pmid:8588583", - "pmid:7633442", - "pmid:7705851" - ] + "motif": "A", + "count": 16, + "type": "flank_repeat" }, { - "id": "DM1_DMPK", - "disease_id": "DM1", - "gene": "DMPK", - "evidence": [ - "Definitive" - ], - "chrom": "chr19", - "start_hg38": 45770204, - "stop_hg38": 45770266, - "start_hg19": 46273462, - "stop_hg19": 46273524, - "start_t2t": 48597739, - "stop_t2t": 48597756, - "disease": "Myotonic dystrophy type 1", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Steinert disease, also known as myotonic dystrophy type 1, is a muscle disease characterized by myotonia and by multiorgan damage that combines various degrees of muscle weakness, arrhythmia and/or cardiac conduction disorders, cataract, endocrine damage, sleep disorders and baldness [@mondo:0008056]. It has also been linked to Autism and related traits, especially in individuals with earlier onset [@pmid:40259070; @pmid:29361396; @pmid:8810716; @pmid:27695335; @pmid:29871899; @pmid:37209486].", - "hpo_terms": null, - "prevalence": "9.27/100000", - "prevalence_details": "5-20/100,000 [@genereviews:NBK1165]. 0.5-18.1/100,000 [@pmid:29100084]; 6.5/100,000 [@pmid:31159885]. 9.27 cases (95% CI: 4.73-15.21) per 100,000, ranging from 0.37 to 36.29 cases per 100,000 [@pmid:35483324]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1165].", - "age_onset": "Typical: 10-30 [@genereviews:NBK1165]; Range: 0-74 [@pmid:38454488].", - "age_onset_min": 0, - "age_onset_max": 74, - "typ_age_onset_min": 10, - "typ_age_onset_max": 30, - "details": "Intermediate alleles (35-49) associated with premutation [@genereviews:NBK1165]. 3%-8% of DM1 expansions contain interrupting variant repeats such as CCG and CGG, associated with later onset and milder phenotype; the variant repeat GCGGCA has also been reported [@pmid:32851192; @pmid:39710066]. In another study, interruptions of the CTG repeat with CCG, GGC, CTC or CAG motifs are estimated to occur in 3-11% of DM1 patients [@pmid:35741732]. Expansions within gene ZNF850 may function as DM1 modifiers [@pmid:39679849].", - "detection": "Flanking PCR has detected alleles up to ~150 repeats, while RP-PCR may detect missed expanded alleles [@genereviews:NBK1165; @pmid:24795756]. Southern blotting has approximated the size of large expansions [@pmid:22643181], while long-read sequencing has resolved repeat size and structure [@pmid:41974889].", - "mechanism": "GoF", - "mechanism_detail": "RNA gain-of-function: RNA gelation leading to misregulation of alternative splicing [@pmid:36169768]. Expanded DMPK r(CUG)n RNA forms a hairpin containing periodic 1*1 U/U internal loops that engage/sequester MBNL family RNA-binding proteins, especially MBNL1 [@pmid:42182465], disrupting pre mRNA processing and contributing to cardiac phenotypes [@pmid:39932794]. Loss of MBNL proteins has been linked to mis-splicing of Autism spectrum-risk genes such as SCN2A, ANK2, and SHANK2, possibly leading to Autism-related traits [@pmid:40259070]. Evidence suggests that disulfide bond-dependent MBNL1/MBNL2 dimerization maintains toxic RNA foci [@pmid:41929128].", - "year": "1992 [@pmid:1310900]", - "location_in_gene": "3' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CTG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 34, - "intermediate_min": 35, - "intermediate_max": 49, - "pathogenic_min": 50, - "pathogenic_max": 4000, - "motif_len": 3, - "ref_copies": 20.7, - "novel": "ref", - "gard": [ - "8310" - ], - "genereviews": [ - "NBK1165" - ], - "malacard": [ - "MYT021" - ], - "medgen": [ - "886881" - ], - "mondo": [ - "0008056" - ], - "omim": [ - "160900" - ], - "orphanet": [ - "273" - ], - "gnomad": [ - "DMPK" - ], - "stripy": [ - "DMPK" - ], - "tr_atlas": [ - "TR156684" - ], - "webstr_hg38": [ - "5650727" - ], - "webstr_hg19": [ - "Expansion_DM1/DMPK" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "maternal_expansion", - "length_affects_onset", - "length_affects_phenotype", - "length_affects_severity", - "motif_affects_instability", - "motif_affects_onset", - "motif_affects_phenotype", - "motif_affects_severity" - ], - "disease_tags": [ - "myotonic_dystrophy" - ], - "references": [ - "genereviews:NBK1165", - "pmid:38454488", - "pmid:36169768", - "pmid:39932794", - "pmid:40259070", - "pmid:41929128", - "pmid:39643839", - "pmid:32851192", - "doi:10.1016/j.mcp.2024.102005", - "pmid:35741732", - "doi:10.1093/hmg/ddae186", - "pmid:29100084", - "pmid:31159885", - "pmid:35483324", - "pmid:1310900", - "mondo:0008056", - "pmid:29361396", - "pmid:8810716", - "pmid:27695335", - "pmid:29871899", - "pmid:37209486" - ], - "additional_literature": [ - "pmid:41996006", - "pmid:41974889", - "pmid:41951733", - "pmid:41946260", - "pmid:41855125", - "pmid:41848171", - "pmid:41766784", - "pmid:41762523", - "pmid:41722569", - "pmid:41710065", - "pmid:41707138", - "pmid:41672630", - "pmid:41610137", - "pmid:41533635", - "pmid:41379996", - "pmid:41260620", - "pmid:41250834", - "pmid:41226829", - "pmid:41212113", - "pmid:41161721", - "pmid:41074692", - "pmid:40903903", - "pmid:40896579", - "pmid:40879030", - "pmid:40712995", - "pmid:40606545", - "pmid:40599975", - "pmid:40417743", - "pmid:40296143", - "pmid:40113266", - "pmid:40092662", - "pmid:40004498", - "pmid:39710066", - "pmid:39679849", - "pmid:39492694", - "pmid:39433769", - "pmid:39415708", - "pmid:39391712", - "pmid:39383229", - "pmid:39278936", - "pmid:39267217", - "pmid:39273681", - "pmid:39232665", - "pmid:39180495", - "pmid:39126705", - "pmid:38709060", - "pmid:38704930", - "pmid:38490135", - "pmid:38314057", - "pmid:37829280", - "pmid:37744174", - "pmid:37645891", - "pmid:37638448", - "pmid:37521782", - "pmid:37397246", - "pmid:37373276", - "pmid:37352653", - "pmid:37200862", - "pmid:37146135", - "pmid:37143315", - "pmid:36892629", - "pmid:36778282", - "pmid:36701310", - "pmid:36627397", - "pmid:36352383", - "pmid:36230978", - "pmid:36222125", - "pmid:36099027", - "pmid:36084803", - "pmid:36011377", - "pmid:35770133", - "pmid:35767654", - "pmid:35567413", - "pmid:35328504", - "pmid:35243403", - "pmid:35182509", - "pmid:34976437", - "pmid:34915310", - "pmid:34513303", - "pmid:34472530", - "pmid:34432028", - "pmid:34386887", - "pmid:34372915", - "pmid:34371182", - "pmid:34262431", - "pmid:34114350", - "pmid:34025359", - "pmid:33682722", - "pmid:33624941", - "pmid:33575482", - "pmid:33526774", - "pmid:33497365", - "pmid:33363709", - "pmid:33362853", - "pmid:33235377", - "pmid:32929188", - "pmid:32823742", - "pmid:32717741", - "pmid:32656337", - "pmid:32607474", - "pmid:32350131", - "pmid:32203199", - "pmid:32109384", - "pmid:32063450", - "pmid:31996899", - "pmid:31873063", - "pmid:31759551", - "pmid:31649961", - "pmid:31624084", - "pmid:31570586", - "pmid:31395669", - "pmid:31334355", - "pmid:31316546", - "pmid:31253581", - "pmid:31227653", - "pmid:31220271", - "pmid:31164682", - "pmid:31027145", - "pmid:30891637", - "pmid:30700578", - "pmid:30615214", - "pmid:30546383", - "pmid:30425655", - "pmid:30304901", - "pmid:30216892", - "pmid:30140252", - "pmid:29967337", - "pmid:29947794", - "pmid:29592894", - "pmid:29551391", - "pmid:29381654", - "pmid:29334465", - "pmid:29274549", - "pmid:29246312", - "pmid:29114849", - "pmid:28942489", - "pmid:28886202", - "pmid:28810563", - "pmid:28782311", - "pmid:28623239", - "pmid:28435090", - "pmid:28363916", - "pmid:28211918", - "pmid:28129118", - "pmid:28102759", - "pmid:27854230", - "pmid:27727437", - "pmid:27358583", - "pmid:27245480", - "pmid:27222292", - "pmid:26708183", - "pmid:26640575", - "pmid:26586700", - "pmid:26498872", - "pmid:26190529", - "pmid:25958258", - "pmid:25712547", - "pmid:25655594", - "pmid:25606394", - "pmid:25307018", - "pmid:25303993", - "pmid:25168381", - "pmid:24824895", - "pmid:24795756", - "pmid:24781112", - "pmid:24715907", - "pmid:24705798", - "pmid:24455202", - "pmid:24269018", - "pmid:24196578", - "pmid:24092878", - "pmid:23811192", - "pmid:23570879", - "pmid:23308382", - "pmid:26317000", - "pmid:23263591", - "pmid:23209425", - "pmid:23183533", - "pmid:23161457", - "pmid:23159592", - "pmid:23139243", - "pmid:22643181", - "pmid:22595968", - "pmid:22459146", - "pmid:22427994", - "pmid:22078098", - "pmid:22062891", - "pmid:21971425", - "pmid:21949239", - "pmid:21511730", - "pmid:21303839", - "pmid:21245981", - "pmid:21204798", - "pmid:21103235", - "pmid:20801043", - "pmid:20635151", - "pmid:20603324", - "pmid:20346670", - "pmid:20228473", - "pmid:20179953", - "pmid:20171614", - "pmid:20074967", - "pmid:19946639", - "pmid:19715468", - "pmid:19632331", - "pmid:19516957", - "pmid:19470458", - "pmid:18798829", - "pmid:18729234", - "pmid:18611984", - "pmid:18563724", - "pmid:18561181", - "pmid:18559347", - "pmid:18299519", - "pmid:18228241", - "pmid:18213375", - "pmid:17987120", - "pmid:17950578", - "pmid:17877752", - "pmid:17728322", - "pmid:17487865", - "pmid:17158949", - "pmid:17150182", - "pmid:17145685", - "pmid:17114933", - "pmid:16978612", - "pmid:16927100", - "pmid:16716318", - "pmid:16624843", - "pmid:16401743", - "pmid:16376058", - "pmid:16193250", - "pmid:16027111", - "pmid:15972723", - "pmid:15961406", - "pmid:15750273", - "pmid:15684391", - "pmid:15576360", - "pmid:15489504", - "pmid:15462191", - "pmid:15459182", - "pmid:15336691", - "pmid:15215218", - "pmid:15114529", - "pmid:15019706", - "pmid:14734627", - "pmid:14597103", - "pmid:12970845", - "pmid:12630069", - "pmid:12614928", - "pmid:12427866", - "pmid:11978764", - "pmid:11809728", - "pmid:11793472", - "pmid:11726559", - "pmid:11686919", - "pmid:11592825", - "pmid:11590133", - "pmid:11555624", - "pmid:11526199", - "pmid:11260612", - "pmid:11124939", - "pmid:11013451", - "pmid:11001736", - "pmid:10970838", - "pmid:10958655", - "pmid:10951446", - "pmid:10909850", - "pmid:10802668", - "pmid:10802667", - "pmid:10767343", - "pmid:10699184", - "pmid:10668800", - "pmid:10480373", - "pmid:10454725", - "pmid:10435210", - "pmid:10332037", - "pmid:10332033", - "pmid:9950368", - "pmid:9887331", - "pmid:9858828", - "pmid:9668171", - "pmid:9537423", - "pmid:9402536", - "pmid:9401353", - "pmid:9371827", - "pmid:9294109", - "pmid:9241283", - "pmid:9241282", - "pmid:9207101", - "pmid:8948631", - "pmid:8923304", - "pmid:8673131", - "pmid:8659513", - "pmid:8784809", - "pmid:8595416", - "pmid:7626046", - "pmid:7590731", - "pmid:7726160", - "pmid:7896884", - "pmid:8288237" - ] - }, + "motif": "GAA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 5, + "benign_max": 33, + "intermediate_min": 34, + "intermediate_max": 55, + "pathogenic_min": 56, + "pathogenic_max": 1700, + "motif_len": 3, + "ref_copies": 6.0, + "novel": "ref", + "gard": ["6468"], + "genereviews": ["NBK1281"], + "malacard": ["FRD001"], + "medgen": ["383962"], + "mondo": ["0100340"], + "omim": ["229300"], + "orphanet": ["95"], + "gnomad": ["FXN"], + "stripy": ["FXN"], + "tr_atlas": ["TR93516"], + "webstr_hg38": ["1509872"], + "webstr_hg19": [], + "locus_tags": ["somatic_instability", "maternal_expansion", "length_affects_onset", "length_affects_phenotype", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance"], + "disease_tags": ["ataxia"], + "references": ["genereviews:NBK1281", "pmid:16205714", "pmid:36169768", "pmid:11748752", "pmid:8815938", "omim:229300", "pmid:29100084", "pmid:8596916"], + "additional_literature": ["pmid:42134333", "pmid:42094143", "pmid:42018061", "pmid:41954755", "pmid:41919005", "pmid:41890103", "pmid:41640354", "pmid:41432640", "pmid:41426430", "pmid:41318543", "pmid:41301739", "pmid:41278766", "pmid:41176519", "pmid:41137390", "pmid:41074692", "pmid:41014100", "pmid:40994821", "pmid:40970480", "pmid:40898875", "pmid:40880907", "pmid:40507780", "pmid:40488180", "pmid:40419681", "pmid:40404357", "pmid:40296143", "pmid:40141365", "pmid:39812846", "pmid:39810753", "pmid:39574782", "pmid:39571249", "pmid:39519164", "pmid:39496895", "pmid:39324476", "pmid:39235665", "pmid:39219417", "pmid:39062522", "pmid:38936158", "pmid:38495102", "pmid:38484450", "pmid:38396238", "pmid:38367363", "pmid:38352270", "pmid:38141359", "pmid:38063871", "pmid:38014032", "pmid:37891254", "pmid:37585105", "pmid:37006329", "pmid:36928898", "pmid:36800320", "pmid:36780807", "pmid:36777637", "pmid:36638893", "pmid:36635061", "pmid:36618024", "pmid:36511872", "pmid:36369844", "pmid:36133907", "pmid:36036008", "pmid:35850241", "pmid:35708503", "pmid:35595154", "pmid:35301072", "pmid:35182509", "pmid:34920960", "pmid:34849883", "pmid:34786480", "pmid:34747814", "pmid:34687355", "pmid:34643298", "pmid:34600502", "pmid:34408077", "pmid:34372915", "pmid:34299126", "pmid:34214898", "pmid:33820410", "pmid:33629768", "pmid:33624863", "pmid:33599954", "pmid:33592237", "pmid:33529321", "pmid:33354116", "pmid:33151022", "pmid:33028632", "pmid:32746884", "pmid:32744307", "pmid:32717741", "pmid:32608417", "pmid:32586831", "pmid:32582297", "pmid:32481586", "pmid:32385683", "pmid:32291635", "pmid:31911468", "pmid:31904895", "pmid:31877117", "pmid:31673878", "pmid:31650522", "pmid:31446150", "pmid:31279523", "pmid:30874991", "pmid:30828501", "pmid:30761510", "pmid:30635474", "pmid:30596685", "pmid:30590615", "pmid:30552117", "pmid:30519163", "pmid:30464193", "pmid:30425621", "pmid:30358880", "pmid:30237783", "pmid:30159187", "pmid:30097477", "pmid:30076049", "pmid:30065630", "pmid:29666341", "pmid:29529236", "pmid:29261783", "pmid:29125828", "pmid:29070698", "pmid:28904984", "pmid:28812047", "pmid:28716278", "pmid:28451558", "pmid:28282710", "pmid:28109580", "pmid:27518705", "pmid:27668106", "pmid:27648458", "pmid:27644330", "pmid:27522354", "pmid:27425605", "pmid:27386501", "pmid:27228352", "pmid:27206881", "pmid:27142428", "pmid:26906906", "pmid:26896803", "pmid:28392990", "pmid:26704351", "pmid:26414159", "pmid:26401053", "pmid:26393353", "pmid:26379101", "pmid:26339677", "pmid:26338206", "pmid:26301374", "pmid:26149656", "pmid:26099177", "pmid:25845763", "pmid:25831023", "pmid:25814655", "pmid:25758173", "pmid:25685137", "pmid:25681319", "pmid:25616511", "pmid:25207996", "pmid:25198290", "pmid:25112975", "pmid:25022367", "pmid:24971578", "pmid:24962209", "pmid:24858524", "pmid:24819921", "pmid:24816001", "pmid:24787137", "pmid:24714088", "pmid:24691413", "pmid:24667739", "pmid:24665325", "pmid:24613765", "pmid:24586819", "pmid:24455203", "pmid:24371004", "pmid:24327207", "pmid:24209901", "pmid:24023969", "pmid:23996585", "pmid:23943791", "pmid:23925595", "pmid:23922695", "pmid:23879205", "pmid:23838345", "pmid:23775342", "pmid:23691127", "pmid:23640016", "pmid:23625326", "pmid:23474817", "pmid:23418481", "pmid:23382970", "pmid:23280845", "pmid:25499576", "pmid:23269675", "pmid:23242090", "pmid:23071719", "pmid:22798143", "pmid:22787155", "pmid:22764244", "pmid:22752483", "pmid:22691228", "pmid:22447512", "pmid:22414340", "pmid:22409940", "pmid:22289650", "pmid:22262734", "pmid:21830088", "pmid:21776984", "pmid:21745819", "pmid:21652007", "pmid:21486239", "pmid:21397024", "pmid:21181307", "pmid:21127046", "pmid:21051337", "pmid:21040903", "pmid:20675166", "pmid:20559546", "pmid:20506029", "pmid:20373285", "pmid:20098685", "pmid:20090835", "pmid:19956589", "pmid:19876374", "pmid:19733517", "pmid:19485941", "pmid:19370769", "pmid:19259763", "pmid:19043662", "pmid:18820300", "pmid:18697824", "pmid:18597733", "pmid:18045775", "pmid:17703324", "pmid:17498922", "pmid:28182935", "pmid:17262846", "pmid:17235301", "pmid:17024371", "pmid:16989817", "pmid:16919418", "pmid:16857735", "pmid:16764889", "pmid:16644517", "pmid:16120311", "pmid:15376485", "pmid:15340363", "pmid:15233994", "pmid:15201464", "pmid:15180699", "pmid:14978261", "pmid:14962663", "pmid:12516053", "pmid:12112211", "pmid:11939898", "pmid:11843702", "pmid:11809170", "pmid:11428460", "pmid:11340071", "pmid:11325966", "pmid:11240567", "pmid:11071107", "pmid:11054139", "pmid:10982543", "pmid:10982187", "pmid:10969848", "pmid:10896266", "pmid:10732799", "pmid:10681084", "pmid:10556290", "pmid:10230399", "pmid:10102712", "pmid:10077729", "pmid:9811933", "pmid:9779809", "pmid:9737785", "pmid:9667602", "pmid:9577387", "pmid:9443873", "pmid:9486868", "pmid:9448568", "pmid:9416816", "pmid:9409356", "pmid:9326946", "pmid:9339708", "pmid:9339680", "pmid:9270667", "pmid:9270608", "pmid:9241271", "pmid:9177790", "pmid:9153531", "pmid:9153129", "pmid:10464657", "pmid:9331900", "pmid:8751856"] +}, +{ + "id": "OPDM2_GIPC1", + "disease_id": "OPDM2", + "gene": "GIPC1", + "evidence": ["Definitive"], + "chrom": "chr19", + "start_hg38": 14496041, + "stop_hg38": 14496075, + "start_hg19": 14606853, + "stop_hg19": 14606887, + "start_t2t": 14622655, + "stop_t2t": 14622692, + "disease": "Oculopharyngodistal myopathy type 2", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750]; Slowly progressive distal weakness, ophthalmoplegia, facial and bulbar weakness [@pmid:39349043]. Two probands presented with ataxia and mild cognitive impairment [@pmid:41975469].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Population dependent; presumed rare. Predominantly found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 20-34 [@pmid:32413282]; Range: 2 [@pmid:41975469] - 70 [@pmid:33374016].", + "age_onset_min": 2.0, + "age_onset_max": 70.0, + "typ_age_onset_min": 20.0, + "typ_age_onset_max": 34.0, + "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Findings suggest that alternative initiation sites and an upstream CTG codon serve as the initiation site for RAN translation [@pmid:41121761]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784]. One proband with ataxia and repeat size 11/112 had an asymptomatic father with 650 repeats and higher methylation [@pmid:41975469].", + "detection": "Short-read WGS or exome sequencing have been reported to be inaccurate in detecting these expansions [@pmid:32413282]. RP-PCR has detected most repeats, while long-read sequencing accurately resolved size and structure [@pmid:32413282].", + "mechanism": "LoF/GoF?", + "mechanism_detail": "Findings suggest that the mechanism is likely not LoF, but the mechanism is otherwise unknown [@pmid:41121761]. This expansion appears to be predominantly RAN translated into a toxic protein [@pmid:41121761]. This protein has been reported to impair cell proliferation, induce cytotoxicity and apoptosis in multiple cell lines, and caused phenotypic defects in a zebrafish model [@pmid:41121761].", + "year": "2020 [@pmid:32413282]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CCG"], + "pathogenic_motif_reference_orientation": ["CCG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 0, + "benign_max": 32, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 73, + "pathogenic_max": 164, + "motif_len": 3, + "ref_copies": 14.7, + "novel": "ref", + "gard": ["16397"], + "genereviews": ["NBK535148"], + "malacard": ["OCL080"], + "medgen": ["1718769"], + "mondo": ["0030134"], + "omim": ["618940"], + "orphanet": [], + "gnomad": ["GIPC1"], + "stripy": ["GIPC1"], + "tr_atlas": ["TR154638"], + "webstr_hg38": ["5626440"], + "webstr_hg19": ["STR_668861"], + "locus_tags": ["length_affects_onset", "length_affects_severity"], + "disease_tags": ["oculopharyngodistal_myopathy", "ataxia"], + "references": ["pmid:32413282", "pmid:41975469", "pmid:33374016", "pmid:41121761", "gnomad:GIPC1", "genereviews:NBK535148", "pmid:38876750", "pmid:35245110", "pmid:38467784", "pmid:39349043"], + "additional_literature": ["pmid:42057638", "pmid:41888971", "pmid:41792844", "pmid:41555317", "pmid:40645757", "pmid:40084170", "pmid:39936620", "pmid:39492694", "pmid:39418922", "pmid:39013564", "pmid:38871700", "pmid:37923380", "pmid:37550168", "pmid:36108428", "pmid:36055118", "pmid:35700120", "pmid:35521937", "pmid:35314910", "pmid:35152460", "pmid:35148830", "pmid:34927285", "pmid:33693509", "pmid:33239111", "pmid:22521844"] +}, +{ + "id": "GDPAG_GLS", + "disease_id": "GDPAG", + "gene": "GLS", + "evidence": ["Definitive"], + "chrom": "chr2", + "start_hg38": 190880872, + "stop_hg38": 190880920, + "start_hg19": 191745598, + "stop_hg19": 191745646, + "start_t2t": 191369982, + "stop_t2t": 191370024, + "disease": "Glutaminase deficiency", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Glutaminase deficiency is characterized by refractory seizures, respiratory failure, brain abnormalities and death in the neonatal period, though milder cases with spastic ataxia-dysarthria have also been reported. This condition is caused by mutations in the glutaminase (GLS) gene [@mondo:0600001].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "As of 2019, only 7 cases total of GLS deficiency, including non-repeat. Identified unrelated patients have been Canadian [@pmid:30970188], Kurdish (Turkey) [@pmid:35913761], and US-American (Northern European/Native American descent) [@pmid:35913761].", + "age_onset": "Early childhood (2-4) [@pmid:30970188; @pmid:35913761].", + "age_onset_min": 2.0, + "age_onset_max": 4.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Pathogenic range from 3 unrelated probands; benign range inferred from mutation data [@genereviews:NBK535148]. Disease cases can be caused by homozygosity or compound heterozygotes [@omim:618412].", + "detection": "Exome sequencing does not reliably detect these expansions. Short-read sequencing has flagged expanded alleles while RP-PCR has confirmed them. Complex alleles may require optical genome mapping or long-read sequencing to resolve size and structure [@pmid:30970188; @pmid:35913761].", + "mechanism": "LoF", + "mechanism_detail": "Change in histone modification decreases transcription [@omim:618412].", + "year": "2019 [@pmid:30970188]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCA"], + "pathogenic_motif_reference_orientation": ["GCA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 38, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 680, + "pathogenic_max": 1500, + "motif_len": 3, + "ref_copies": 16.0, + "novel": "ref", + "gard": [], + "genereviews": ["NBK535148"], + "malacard": ["SPS235"], + "medgen": ["987241"], + "mondo": ["0600001"], + "omim": ["618412"], + "orphanet": ["557056"], + "gnomad": ["GLS"], + "stripy": ["GLS"], + "tr_atlas": ["TR24838"], + "webstr_hg38": ["333878", "5494902"], + "webstr_hg19": ["STR_803303"], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:30970188", "pmid:35913761", "omim:618412", "genereviews:NBK535148", "mondo:0600001"], + "additional_literature": ["pmid:41501457", "pmid:40488180", "pmid:40417743", "pmid:39699045", "pmid:39651202", "pmid:38877099", "pmid:38871700", "pmid:38260514", "pmid:34285061", "pmid:34013182", "pmid:33691262", "pmid:33413375", "pmid:14510958", "pmid:7729621"] +}, +{ + "id": "aFTLD-U_GOLGA8A", + "disease_id": "aFTLD-U", + "gene": "GOLGA8A", + "evidence": ["Provisional"], + "chrom": "chr15", + "start_hg38": 34419425, + "stop_hg38": 34419451, + "start_hg19": 34711626, + "stop_hg19": 34711652, + "start_t2t": 32225152, + "stop_t2t": 32225178, + "disease": "Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U)", + "inheritance": [], + "association_type": ["Risk"], + "disease_description": "A rare subtype of Frontotemporal Lobar Degeneration with FET protein inclusions (FTLD-FET). Categorized clinically by behavioral variant frontotemporal dementia (bvFTD) with TAF15/FUS/EWSR1 positive inclusions. Associated with psychiatric symptoms and frontal/striatal atrophy [@pmid:41820575].", + "hpo_terms": ["HP:0002145 Frontotemporal dementia"], + "prevalence": null, + "prevalence_details": "FTLD-FET makes up ~5–10% of FTLD, and aFTLD-U is the most common FTLD-FET subtype. Prevalence estimates are challenging because diagnosis typically requires neuropathology at autopsy. Risk haplotypes are enriched in Amish and non-Finnish europeans [@pmid:41820575].", + "age_onset": "Typical: 34-55; Range: 21-72 [@pmid:41820575].", + "age_onset_min": 21.0, + "age_onset_max": 72.0, + "typ_age_onset_min": 34.0, + "typ_age_onset_max": 55.0, + "details": "Variation in repeat length, motif length, and motif sequence, with long CT-dimer expansions strongly associated with aFTLD-U risk. CCTT and CCCTCT motif expansions have been observed in unaffected individuals. CCCCT repeats were present in one aFTLD-U case. Proposed risk-associated expansions are typically >450 bp with >80% CT content and/or contain >190 CT dimers, though unaffected carriers have also been observed. Although the functional consequence of this repeat remains unknown, its presence in nearly 60% of aFTLD-U cases points to a major role in disease pathogenesis [@pmid:41820575].", + "detection": null, + "mechanism": "Unknown [@pmid:41820575].", + "mechanism_detail": null, + "year": "2026 [@pmid:41820575]", + "location_in_gene": null, + "gene_strand": "-", + "reference_motif_reference_orientation": ["TTTC"], + "pathogenic_motif_reference_orientation": ["CT"], + "benign_motif_reference_orientation": ["CCTT", "CCCTCT"], + "unknown_motif_reference_orientation": ["CCCCT"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AG"], + "benign_motif_gene_orientation": ["AAGG", "AGAGGG"], + "unknown_motif_gene_orientation": ["AGGGG"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "RCPS_EIF4A3", - "disease_id": "RCPS", - "gene": "EIF4A3", - "evidence": [ - "Definitive" - ], - "chrom": "chr17", - "start_hg38": 80147009, - "stop_hg38": 80147139, - "start_hg19": 78120808, - "stop_hg19": 78120938, - "start_t2t": 81047404, - "stop_t2t": 81047534, - "disease": "Richieri-Costa-Pereira syndrome", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Richieri Costa-Pereira syndrome is characterized by short stature, Robin sequence, cleft mandible, pre/postaxial hand anomalies (including hypoplastic thumbs), and clubfoot. It has been described in 14 Brazilian families and in one unrelated French patient. Prominent low set ears and a highly arched palate were also observed. Transmission is autosomal recessive [@mondo:0009998].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "49 cases as of Nov 2023 [@doi:10.1016/j.omsc.2023.100340]. Found in Brazilian families and one unrelated French patient [@mondo:0009998].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": 0, - "typ_age_onset_max": 0, - "details": "Complex repeat of 18-20 nucleotides expands to cause disease: disease is found in individuals with 14-16 repeats [@pmid:24360810], while controls have typically 3-12 repeats with as low as 1 repeat [@genereviews:NBK535148; @gnomad:EIF4A3]. Significance of intermediate alleles is unknown [@pmid:29112243].", - "detection": "Short-read sequencing and exome sequencing do not reliably detect this expansion. Targeted 5′ UTR PCR with Sanger sequencing is the common detection methodology [@pmid:29112243; @pmid:24360810].", - "mechanism": "LoF", - "mechanism_detail": "LoF from a hypomorphic allele [@pmid:24360810].", - "year": "2014 [@pmid:24360810]; syndrome described in 1992 [@pmid:1632438]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CCTCGCTGTGCCGCTGCCGA" - ], - "pathogenic_motif_reference_orientation": [ - "CCTCGCTGTGCCGCTGCCGA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ACAGCGAGGTCGGCAGCGGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 1, - "benign_max": 12, - "intermediate_min": 13, - "intermediate_max": 13, - "pathogenic_min": 14, - "pathogenic_max": 16, - "motif_len": 20, - "ref_copies": null, - "novel": "ref", - "gard": [ - "4718" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "RBN014" - ], - "medgen": [ - "336581" - ], - "mondo": [ - "0009998" - ], - "omim": [ - "268305" - ], - "orphanet": [ - "3102" - ], - "gnomad": [ - "EIF4A3" - ], - "stripy": [], - "tr_atlas": [ - "TR148462" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:24360810", - "genereviews:NBK535148", - "gnomad:EIF4A3", - "pmid:29112243", - "doi:10.1016/j.omsc.2023.100340", - "mondo:0009998", - "pmid:1632438" - ], - "additional_literature": [] - }, + "motif": "CT", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 190, + "pathogenic_max": 600, + "motif_len": 2, + "ref_copies": 6.75, + "novel": "novel", + "gard": ["8436"], + "genereviews": [], + "malacard": ["FRN066"], + "medgen": ["83266"], + "mondo": [], + "omim": ["616180"], + "orphanet": [], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": ["STR_459855"], + "locus_tags": ["somatic_instability"], + "disease_tags": [], + "references": ["pmid:41820575"], + "additional_literature": [] +}, +{ + "id": "HFG_HOXA13-I", + "disease_id": "HFG-I", + "gene": "HOXA13", + "evidence": ["Limited"], + "chrom": "chr7", + "start_hg38": 27199924, + "stop_hg38": 27199966, + "start_hg19": 27239543, + "stop_hg19": 27239585, + "start_t2t": 27335912, + "stop_t2t": 27335954, + "disease": "Hand-foot-genital syndrome 1", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", + "detection": "PCR amplification of tract I, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short-read sequencing may miss expanded repeats [@genereviews:NBK1423].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", + "year": "2004 [@pmid:15385446]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 14, + "benign_max": 14, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 22, + "motif_len": 3, + "ref_copies": 14.0, + "novel": "ref", + "gard": ["2594"], + "genereviews": ["NBK1423"], + "malacard": ["HND004"], + "medgen": ["331103"], + "mondo": ["0007698"], + "omim": ["140000"], + "orphanet": ["2438"], + "gnomad": ["HOXA13_1"], + "stripy": ["HOXA13_1"], + "tr_atlas": ["TR74138"], + "webstr_hg38": ["5679832"], + "webstr_hg19": ["STR_1311037"], + "locus_tags": [], + "disease_tags": ["hand_foot_genital_syndrome"], + "references": ["genereviews:NBK1423", "pmid:15385446", "pmid:17935235", "mondo:0007698"], + "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] +}, +{ + "id": "HFG_HOXA13-II", + "disease_id": "HFG-II", + "gene": "HOXA13", + "evidence": ["Limited"], + "chrom": "chr7", + "start_hg38": 27199825, + "stop_hg38": 27199861, + "start_hg19": 27239444, + "stop_hg19": 27239480, + "start_t2t": 27335813, + "stop_t2t": 27335849, + "disease": "Hand-foot-genital syndrome 2", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", + "detection": "PCR amplification of tract II, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", + "year": "2003 [@pmid:12676922]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 12, + "benign_max": 12, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 18, + "pathogenic_max": 18, + "motif_len": 3, + "ref_copies": 12.0, + "novel": "ref", + "gard": ["2594"], + "genereviews": ["NBK1423"], + "malacard": ["HND004"], + "medgen": ["331103"], + "mondo": ["0007698"], + "omim": ["140000"], + "orphanet": ["2438"], + "gnomad": ["HOXA13_2"], + "stripy": ["HOXA13_2"], + "tr_atlas": ["TR74137"], + "webstr_hg38": ["5679831"], + "webstr_hg19": ["STR_1311036"], + "locus_tags": [], + "disease_tags": ["hand_foot_genital_syndrome"], + "references": ["genereviews:NBK1423", "pmid:15385446", "pmid:17935235", "pmid:12676922", "mondo:0007698"], + "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] +}, +{ + "id": "HFG_HOXA13-III", + "disease_id": "HFG-III", + "gene": "HOXA13", + "evidence": ["Limited"], + "chrom": "chr7", + "start_hg38": 27199678, + "stop_hg38": 27199732, + "start_hg19": 27239297, + "stop_hg19": 27239351, + "start_t2t": 27335684, + "stop_t2t": 27335720, + "disease": "Hand-foot-genital syndrome 3", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Anticipation does not occur, and expansions appear fully penetrant; it is unknown if contractions also lead to phenotypic variation [@genereviews:NBK1423].", + "detection": "PCR amplification of tract III, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", + "year": "2000 [@pmid:10839976]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 8, + "benign_max": 18, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 32, + "motif_len": 3, + "ref_copies": 18.0, + "novel": "ref", + "gard": ["2594"], + "genereviews": ["NBK1423"], + "malacard": ["HND004"], + "medgen": ["331103"], + "mondo": ["0007698"], + "omim": ["140000"], + "orphanet": ["2438"], + "gnomad": ["HOXA13_3"], + "stripy": ["HOXA13_3"], + "tr_atlas": ["TR74136"], + "webstr_hg38": ["1365344"], + "webstr_hg19": ["STR_1311035"], + "locus_tags": [], + "disease_tags": ["hand_foot_genital_syndrome"], + "references": ["genereviews:NBK1423", "pmid:15385446", "pmid:17935235", "pmid:10839976", "mondo:0007698"], + "additional_literature": ["pmid:32386547", "pmid:23532960", "pmid:19591980", "pmid:12414828", "pmid:11543619"] +}, +{ + "id": "SD5_HOXD13", + "disease_id": "SD5", + "gene": "HOXD13", + "evidence": ["Definitive"], + "chrom": "chr2", + "start_hg38": 176093058, + "stop_hg38": 176093103, + "start_hg19": 176957786, + "stop_hg19": 176957831, + "start_t2t": 176581179, + "stop_t2t": 176581224, + "disease": "Syndactyly", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Synpolydactyly (SPD), or syndactyly type II, is defined as a connection between the middle and ring fingers and fourth and fifth toes, variably associated with postaxial polydactyly in the same digits. Minor local anomalies and various metacarpal or metatarsal abnormalities may be present [@omim:186000].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Syndactyly is found across dozens of unrelated families worldwide [@pmid:24038517]. However, syndactyly-5 specific to STR expansion has been found in 3 individuals [@genereviews:NBK535148].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign alleles are highly conserved to be 15 repeats, with disease observed in individuals with 22-23 repeats [@pmid:8614804; @pmid:22406499] as well as in individuals with 8-11 repeats [@genereviews:NBK535148].", + "detection": "Targeted PCR across exon 1 has detected expansions, and subcloning with Sanger sequencing has characterized them [@pmid:9223304].", + "mechanism": "GoF", + "mechanism_detail": "Polyalanine expansion leading to GoF [@pmid:38467784]", + "year": "1996 [@pmid:8614804]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 23, + "motif_len": 3, + "ref_copies": 14.0, + "novel": "ref", + "gard": ["17358"], + "genereviews": ["NBK535148"], + "malacard": ["SYN084"], + "medgen": ["1809573"], + "mondo": ["0008513"], + "omim": ["186000"], + "orphanet": ["295195"], + "gnomad": ["HOXD13"], + "stripy": ["HOXD13"], + "tr_atlas": ["TR24032"], + "webstr_hg38": ["5486677"], + "webstr_hg19": ["STR_796395"], + "locus_tags": ["contraction"], + "disease_tags": [], + "references": ["pmid:38467784", "pmid:8614804", "pmid:22406499", "genereviews:NBK535148", "pmid:24038517", "omim:186000"], + "additional_literature": ["pmid:34159400", "pmid:32652111", "pmid:32386547", "pmid:19841179", "pmid:19546318", "pmid:17935235", "pmid:12414828", "pmid:12116248", "pmid:11543619"] +}, +{ + "id": "HD_HTT", + "disease_id": "HD", + "gene": "HTT", + "evidence": ["Definitive"], + "chrom": "chr4", + "start_hg38": 3074876, + "stop_hg38": 3074933, + "start_hg19": 3076603, + "stop_hg19": 3076660, + "start_t2t": 3073603, + "stop_t2t": 3073687, + "disease": "Huntington disease", + "inheritance": ["AD"], + "association_type": ["Mendelian", "Risk"], + "disease_description": "Huntington disease (HD) is a rare neurodegenerative disorder of the central nervous system characterized by unwanted choreatic movements, behavioral and psychiatric disturbances and dementia [@mondo:0007739].", + "hpo_terms": null, + "prevalence": "1/10000", + "prevalence_details": "6.5-15/100,000 [@pmid:29100084]. 9.71-17:100,000 (European) vs. 0.1-2/100,000 (African), as many as 1 in 400 have reduced penetrance (0.2-2% for 36-38 CAG) HTT alleles [@genereviews:NBK1305]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1305].", + "age_onset": "Typical: 35-44 [@genereviews:NBK1305]; Range: 1-85 [@pmid:39441074; @pmid:21171977].", + "age_onset_min": 1.0, + "age_onset_max": 85.0, + "typ_age_onset_min": 35.0, + "typ_age_onset_max": 44.0, + "details": "27-35 motifs are unstable/premutations, while 36-39 motifs are associated with reduced penetrance and mild phenotypes [@pmid:39572770], and alleles over 40 repeats are typically fully penetrant [@genereviews:NBK1305]. >60 motifs associated with onset age <20 years [@genereviews:NBK1305]. Only CAG expansions are considered pathogenic, but interruptions impact pathogenicity (CAA) [@pmid:35245110; @pmid:39673793]. Only fathers with premutations are considered at risk of transmitting pathogenic alleles [@pmid:19507258]. CAG repeat size 21-35 may continuously modulate brain structure and psychiatric disease risk in an age-dependent manner [@pmid:39572770] [@doi:https://doi.org/10.64898/2026.05.08.26352223]. Somatic expansion of HTT CAG repeats in vulnerable tissues is proposed to contribute to age-dependent onset and neurodegeneration, with greater repeat instability associated with earlier disease onset [@pmid:41926793; @pmid:39824182]. Undiagnosed carriers of premutation and pathogenic HTT expansions, exhibit reduced striatal brain volumes and elevated neurofilament light chain levels before clinical diagnosis, consistent with findings observed across other loci [@pmid:41951733].", + "detection": "PCR methods have reliably detected expansions up to ~115 repeats, but very large expansions may require Southern blotting [@genereviews:NBK1305]. Long-read sequencing has resolved interruptions and validated sizing [@pmid:41512049].", + "mechanism": "GoF/LoF", + "mechanism_detail": "While the primary pathogenic mechanism is gain of function of the protein product, pathogenesis is complex and multifactorial [@pmid:27940602]. Reduced SCN4B expression in striatal neurons has been implicated as a modifier of HD-associated phenotype severity, potentially contributing to dysfunction in motor associated striatal neuronal populations [@pmid:41959367].", + "year": "1993 [@pmid:8458085]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["CAA"], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AAC"], + "locus_structure": [ { - "id": "OPDM_FAM193B", - "disease_id": "OPDM", - "gene": "FAM193B", - "evidence": [ - "Provisional" - ], - "chrom": "chr5", - "start_hg38": 177554489, - "stop_hg38": 177554531, - "start_hg19": 176981490, - "stop_hg19": 176981532, - "start_t2t": 178096748, - "stop_t2t": 178096792, - "disease": "Oculopharyngodistal myopathy", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "This is a newly proposed locus for OPDM, it does not have a type number yet and has not been validated. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in two siblings in a UDN family [@pmid:38297326; @pmid:40357124].", - "age_onset": "49-51 based on two siblings [@pmid:39868092].", - "age_onset_min": 49, - "age_onset_max": 51, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (<50) inferred from cohort data, but exact upper bound was not reported. Two affected patients had repeat lengths of 194 and 198, with an unaffected parent with a repeat length of 158 [@pmid:39868092]. The unaffected parent makes the inheritance pattern uncertain, but it appears to be autosomal dominant.", - "detection": null, - "mechanism": null, - "mechanism_detail": "Accumulation of toxic RAN proteins is a proposed mechanism [@pmid:38585781]", - "year": "2026 [@pmid:39868092]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 0, - "benign_max": 50, - "intermediate_min": 158, - "intermediate_max": 158, - "pathogenic_min": 194, - "pathogenic_max": 198, - "motif_len": 3, - "ref_copies": null, - "novel": "ref", - "gard": [ - "12592" - ], - "genereviews": [], - "malacard": [], - "medgen": [ - "320250" - ], - "mondo": [], - "omim": [ - "615813" - ], - "orphanet": [ - "98897" - ], - "gnomad": [ - "FAM193B" - ], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [ - "oculopharyngodistal_myopathy" - ], - "references": [ - "pmid:39868092", - "pmid:38585781", - "pmid:38297326", - "pmid:40357124", - "mondo:0025193" - ], - "additional_literature": [] + "motif": "CAG", + "count": null, + "type": "pathogenic_repeat" }, { - "id": "SCA27B_FGF14", - "disease_id": "SCA27B", - "gene": "FGF14", - "evidence": [ - "Definitive" - ], - "chrom": "chr13", - "start_hg38": 102161574, - "stop_hg38": 102161726, - "start_hg19": 102813924, - "stop_hg19": 102814076, - "start_t2t": 101377549, - "stop_t2t": 101377792, - "disease": "Spinocerebellar ataxia 27B", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian", - "Risk" - ], - "disease_description": "Late-onset ataxia, may have episodic onset, downbeat nystagmus, vertigo, dysarthria, visual disturbances, and neuropathy [@pmid:39349043; @pmid:42044943]. Involvement of the superior cerebellar peduncles is frequent and may aid in diagnostic efforts [@pmid:39996128].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Intermediate expansions 1-2% of population, but non-GAA-pure without relation to ataxia [@genereviews:NBK599589]. Found in multiple ethnicities [@pmid:38876750]; diagnosed patients in America, Brazil, Japan, Germany, Spain, Canada, France, Austria, Australia, Italy, and Poland [@genereviews:NBK599589; @pmid:38886208; @pmid:37267898; @pmid:42096001]. Prevalence is population dependent, ranging from 1.83% to 61% of different ataxia cohorts, with specific enrichment in French-Canadian populations [@pmid:36516086; @pmid:42090775].", - "age_onset": "Typical: 42-70; Range: 21-87 [@genereviews:NBK599589; @pmid:39263992].", - "age_onset_min": 21, - "age_onset_max": 87, - "typ_age_onset_min": 42, - "typ_age_onset_max": 70, - "details": "Higher repeat size is associated with earlier age of onset [@pmid:39263992]. The 250-300 repeats range is linked to incomplete penetrance and >300 repeats with complete penetrance in some studies and resources [@genereviews:NBK599589; @pmid:37399286; @pmid:39227614]. However, our thresholds are taken from suggestions made by Mohren et al upon evaluation of 169 cases and 802 controls; the authors propose lower thresholds based on pathogenic cases of shorter pure repeats [@pmid:39227614]. Additionally, this study suggests that benign motifs may disrupt the formation of secondary structures in DNA/RNA, leading to reduced pathogenicity. The effects of interruptions on penetrance and onset have been demonstrated in patients, with uninterrupted expansions apparently necessary for disease [@pmid:40007153]. Interruptions of GAG, GAAGGA, GAAGAAAGAA, GAAAAGAAGAAGGAAGAAGGAA, GAAAAGAAGAAGGAA, and GCAGAAGAAGAAGAA have been reported [@pmid:40379261]. Variation in flanking regions appears to correlate with repeat size [@pmid:39227614; @pmid:38937606]. Intermediate alleles may increase ataxia susceptibility in combination with other factors or be associated with a phenotypic spectrum (multiple system atrophy) [@pmid:39227614; @pmid:39604554]. A complex (TTC/TGC) ≥300 repeat expansion has been associated as a risk factor for Parkinson's disease [@pmid:41327893; @pmid:41277530]. Expansions can sometimes present as apparently sporadic adult-onset ataxia despite autosomal dominant inheritance [@pmid:42204984].", - "detection": "Short-read genome and exome sequencing are reported to be inaccurate in detecting these expansions [@genereviews:NBK599589]. Long-range PCR and bidirectional RP-PCR have been used for detection, while long-read sequencing has determined repeat structure and purity [@genereviews:NBK599589; @pmid:36516086].", - "mechanism": "LoF", - "mechanism_detail": "Reduced transcript 2 [@pmid:36516086].", - "year": "2023 [@pmid:36493768]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GAA" - ], - "pathogenic_motif_reference_orientation": [ - "GAA" - ], - "benign_motif_reference_orientation": [ - "GGA", - "GCA" - ], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "GAG", - "GAAGGA", - "GAAGAAAGAA", - "GAAAAGAAGAAGGAAGAAGGAA", - "GAAAAGAAGAAGGAA", - "GCAGAAGAAGAAGAA" - ], - "pathogenic_motif_gene_orientation": [ - "CTT" - ], - "benign_motif_gene_orientation": [ - "CCT", - "CTG" - ], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "CCT", - "CCTTCT", - "CTTCTTCTTT", - "CCTTCTTCCTTCTTCTTTTCTT", - "CCTTCTTCTTTTCTT", - "CTGCTTCTTCTTCTT" - ], - "locus_structure": [], - "benign_min": 8, - "benign_max": 179, - "intermediate_min": 180, - "intermediate_max": 319, - "pathogenic_min": 320, - "pathogenic_max": 937, - "motif_len": 3, - "ref_copies": 50.3, - "novel": "ref", - "gard": [], - "genereviews": [ - "NBK599589" - ], - "malacard": [ - "SPN469" - ], - "medgen": [ - "1824051" - ], - "mondo": [ - "0859340" - ], - "omim": [ - "620174" - ], - "orphanet": [ - "675216" - ], - "gnomad": [ - "FGF14" - ], - "stripy": [ - "FGF14" - ], - "tr_atlas": [], - "webstr_hg38": [ - "1272528" - ], - "webstr_hg19": [], - "locus_tags": [ - "maternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "motif_affects_penetrance", - "length_affects_phenotype" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "genereviews:NBK599589", - "pmid:39263992", - "pmid:36516086", - "pmid:37399286", - "pmid:39227614", - "pmid:40007153", - "pmid:40379261", - "pmid:38937606", - "pmid:39604554", - "pmid:41327893", - "pmid:41277530", - "pmid:38876750", - "pmid:38886208", - "pmid:37267898", - "pmid:36493768", - "pmid:39349043", - "pmid:42044943", - "doi:10.1212/NXG.0000000000200253" - ], - "additional_literature": [ - "pmid:42055934", - "pmid:42044943", - "pmid:41698164", - "pmid:41504274", - "pmid:41118032", - "pmid:41065930", - "pmid:41055766", - "pmid:40974444", - "pmid:40906330", - "pmid:40898875", - "pmid:40894141", - "pmid:40879304", - "pmid:40835733", - "pmid:40679574", - "pmid:40637932", - "pmid:40623333", - "pmid:40579842", - "pmid:40556471", - "pmid:40488180", - "pmid:40273470", - "pmid:40239008", - "pmid:40191983", - "pmid:40141365", - "pmid:40024931", - "pmid:40017559", - "pmid:39996128", - "pmid:39821862", - "pmid:39801711", - "pmid:39723156", - "pmid:39666057", - "pmid:39666053", - "pmid:39574782", - "pmid:39571249", - "pmid:39392764", - "pmid:39378335", - "pmid:39152783", - "pmid:39006414", - "pmid:38976084", - "pmid:38949032", - "pmid:38866925", - "pmid:38816190", - "pmid:38513302", - "pmid:38487929", - "pmid:38472396", - "pmid:38405699", - "pmid:38381176", - "pmid:38221848", - "pmid:38170134", - "pmid:38150853", - "pmid:38058854", - "pmid:37916889", - "pmid:37646005", - "pmid:37578187", - "pmid:37577458", - "pmid:37322040", - "pmid:37165652", - "pmid:32717741", - "pmid:30017992", - "pmid:28444220", - "pmid:26677414", - "pmid:26149656", - "pmid:15470364", - "pmid:15148151" - ] + "motif": "CAACAG", + "count": 1, + "type": "interruption" }, { - "id": "FXS_FMR1", - "disease_id": "FXS, FXTAS, POF1", - "gene": "FMR1", - "evidence": [ - "Definitive" - ], - "chrom": "chrX", - "start_hg38": 147912049, - "stop_hg38": 147912111, - "start_hg19": 146993567, - "stop_hg19": 146993629, - "start_t2t": 146176677, - "stop_t2t": 146176769, - "disease": "Fragile X syndrome (FXS), fragile X-associated tremor/ataxia syndrome (FXTAS), and fragile X-associated primary ovarian insufficiency FXPOI/POF1", - "inheritance": [ - "XD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A genetic syndrome caused by mutations in the FMR1 gene which is responsible for the expression of the fragile X messenger ribonucleoprotein 1 (FMR1) protein. This protein participates in neural development. This syndrome is manifested with mental, emotional, behavioral, physical, and learning disabilities.; Any primary ovarian failure in which the cause of the disease is a mutation in the FMR1 gene.; Fragile X-associated tremor/ataxia syndrome (FXTAS) is a rare neurodegenerative disorder characterized by adult-onset progressive intention tremor and gait ataxia [@mondo:0010383; @mondo:0010706; @mondo:0010382].", - "hpo_terms": null, - "prevalence": "14/100000", - "prevalence_details": "Incidence of full mutation in males 19/100,000; prevalence 14/100,000 [@genereviews:NBK1384]. Female prevalence 9/100,000 [@pmid:24700618]. Known carrier frequency is approximately 300-500/100,000 but detected was 11/100,000 [@pmid:29100084]. FXS prevalence 1:7000 males, 1:11,000 females; FX premutation carriers 1:290-855 males, 1:148-300 females [@isbn:978-3-031-66932-3]. Found worldwide [@genereviews:NBK1384]. In Thailand, 1 in 600 women carry a premutation, and 1 in 400 carry a 'gray zone' allele [@pmid:39320553].", - "age_onset": "Typical: FXS 1 to 'first several years of life', FXTAS 60-65 [@genereviews:NBK1384]; Range: 0 [@url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents] - 78 [@pmid:17427188]; detailed description of typical symptom onset and diagnosis available from Arnold et al [@isbn:978-3-031-66932-3].", - "age_onset_min": 0, - "age_onset_max": 78, - "typ_age_onset_min": 1, - "typ_age_onset_max": 65, - "details": "Intermediate or 'gray zone' occur at 45-54 alleles and may be unstable enough to expand into the premutation range, as well as associate with parkinsonism [@pmid:32463542; @genereviews:NBK1384]. FXTAS/POI occurs at 55-200 repeats, FXS >200, late onset; AGG and CTG interruptions documented [@genereviews:NBK1384; @pmid:29868108]. Women with the premutation have been reported showing episodic memory deficits, similar to those seen in AD [@pmid:41555826]. AGG interruptions are frequently reported in all associated diseases and appear to stabilize alleles; the length of the longest pure stretch predicts repeat instability [@pmid:7987398]. Elevated POI risk was observed starting at 36 repeats, increasing continuously with repeat length [@pmid:42001465].", - "detection": "Modern PCR techniques detect virtually all FMR1 expansion sizes, while RP-PCR detects AGG interspersions. Southern blotting has been used to approximate size and indicate methylation status [@genereviews:NBK1384]. Long-read sequencing has characterized repeat size, interruptions, methylation, and mosaicism [@pmid:29868108; @pmid:31740840].", - "mechanism": "LoF/GoF", - "mechanism_detail": "Loss of function via transcriptional silencing in FXS, RNA gain of function in FXTAS/FXPOI [@pmid:16205714; @pmid:36169768]. PRKGG appears to modulate neurotoxicity [@pmid:41507195].", - "year": "1992 [@pmid:1605194]; causative gene discovered in 1991 [@pmid:1710175]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CGG" - ], - "pathogenic_motif_reference_orientation": [ - "CGG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "AGG", - "CTG" - ], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AGG", - "CTG" - ], - "locus_structure": [], - "benign_min": 5, - "benign_max": 44, - "intermediate_min": 45, - "intermediate_max": 200, - "pathogenic_min": 201, - "pathogenic_max": 2000, - "motif_len": 3, - "ref_copies": 20.6667, - "novel": "ref", - "gard": [ - "6464", - "16806" - ], - "genereviews": [ - "NBK1384" - ], - "malacard": [ - "FRG001", - "FRG008", - "PRM405" - ], - "medgen": [ - "8912", - "1644269", - "333403" - ], - "mondo": [ - "0010383", - "0010706", - "0010382" - ], - "omim": [ - "300624", - "300623" - ], - "orphanet": [ - "908", - "642691", - "93256" - ], - "gnomad": [ - "FMR1" - ], - "stripy": [ - "FMR1" - ], - "tr_atlas": [ - "TR173944" - ], - "webstr_hg38": [ - "885222" - ], - "webstr_hg19": [ - "Expansion_FXS/FMR1" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "maternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_phenotype", - "length_affects_severity", - "motif_affects_instability" - ], - "disease_tags": [ - "phenotypic_spectrum", - "ataxia" - ], - "references": [ - "genereviews:NBK1384", - "url:https://www.uptodate.com/contents/fragile-x-syndrome-clinical-features-and-diagnosis-in-children-and-adolescents", - "pmid:17427188", - "isbn:978-3-031-66932-3", - "pmid:16205714", - "pmid:36169768", - "pmid:41507195", - "pmid:32463542", - "pmid:29868108", - "pmid:41555826", - "pmid:7987398", - "pmid:42001465", - "pmid:24700618", - "pmid:29100084", - "pmid:39320553", - "pmid:1605194", - "pmid:1710175", - "mondo:0010383", - "mondo:0010706", - "mondo:0010382" - ], - "additional_literature": [ - "pmid:42041789", - "pmid:42001465", - "pmid:41952192", - "pmid:41929501", - "pmid:41917775", - "pmid:41806827", - "pmid:41792844", - "pmid:41777701", - "pmid:41762523", - "pmid:41717020", - "pmid:41672630", - "pmid:41648852", - "pmid:41557506", - "pmid:41523206", - "pmid:41514368", - "pmid:41409170", - "pmid:41386846", - "pmid:41385812", - "pmid:41372183", - "pmid:41351347", - "pmid:41278766", - "pmid:41256123", - "pmid:41167304", - "pmid:41145158", - "pmid:41120736", - "pmid:41098569", - "pmid:41074692", - "pmid:41028987", - "pmid:41015363", - "pmid:40980401", - "pmid:40940631", - "pmid:40877251", - "pmid:40869951", - "pmid:40879637", - "pmid:40778130", - "pmid:40653294", - "pmid:40600017", - "pmid:40534679", - "pmid:40488180", - "pmid:40480633", - "pmid:40459253", - "pmid:40455869", - "pmid:40418066", - "pmid:40417743", - "pmid:40296143", - "pmid:40287634", - "pmid:40244008", - "pmid:40243429", - "pmid:40243408", - "pmid:40220918", - "pmid:40166285", - "pmid:40149430", - "pmid:40141467", - "pmid:40141297", - "pmid:39945490", - "pmid:39934227", - "pmid:39839505", - "pmid:39684429", - "pmid:39654947", - "pmid:39588919", - "pmid:39574643", - "pmid:39553953", - "pmid:39492694", - "pmid:39482338", - "pmid:39488698", - "pmid:39095619", - "pmid:38997701", - "pmid:38961870", - "pmid:38946987", - "pmid:38865241", - "pmid:38772058", - "pmid:38714961", - "pmid:38522837", - "pmid:38412259", - "pmid:38307002", - "pmid:38164622", - "pmid:38162443", - "pmid:38134876", - "pmid:37970883", - "pmid:37936174", - "pmid:37906407", - "pmid:37776526", - "pmid:37745859", - "pmid:37628570", - "pmid:37583466", - "pmid:37551886", - "pmid:37551173", - "pmid:37508562", - "pmid:37364131", - "pmid:37352983", - "pmid:37347418", - "pmid:37333274", - "pmid:37209683", - "pmid:37200782", - "pmid:37146135", - "pmid:37120588", - "pmid:36882476", - "pmid:36816716", - "pmid:36250920", - "pmid:36227727", - "pmid:36012355", - "pmid:35977823", - "pmid:35948990", - "pmid:35904811", - "pmid:35729184", - "pmid:35701103", - "pmid:35681093", - "pmid:35609145", - "pmid:35182509", - "pmid:35152460", - "pmid:35129870", - "pmid:35101584", - "pmid:35072235", - "pmid:35038595", - "pmid:35026985", - "pmid:34938155", - "pmid:34926684", - "pmid:34924936", - "pmid:34880790", - "pmid:34845661", - "pmid:34828275", - "pmid:34738199", - "pmid:34690787", - "pmid:34679478", - "pmid:34646309", - "pmid:34641814", - "pmid:34641644", - "pmid:34542254", - "pmid:34456771", - "pmid:34421690", - "pmid:34372915", - "pmid:34358321", - "pmid:34321326", - "pmid:34296199", - "pmid:34276797", - "pmid:34193467", - "pmid:34153466", - "pmid:34117786", - "pmid:34111553", - "pmid:34077515", - "pmid:34054431", - "pmid:34046842", - "pmid:33998336", - "pmid:33856019", - "pmid:33854084", - "pmid:33772546", - "pmid:33709078", - "pmid:33692361", - "pmid:33642901", - "pmid:33627639", - "pmid:33585555", - "pmid:33523882", - "pmid:33497798", - "pmid:33381520", - "pmid:33374331", - "pmid:33296661", - "pmid:33195422", - "pmid:33181255", - "pmid:33151065", - "pmid:33039683", - "pmid:33008014", - "pmid:33007370", - "pmid:32787884", - "pmid:32716213", - "pmid:32695777", - "pmid:32688058", - "pmid:32589669", - "pmid:32478017", - "pmid:32446918", - "pmid:32281281", - "pmid:32258228", - "pmid:32089525", - "pmid:32066985", - "pmid:32048109", - "pmid:32012997", - "pmid:31991700", - "pmid:31989181", - "pmid:31891607", - "pmid:31887710", - "pmid:31880363", - "pmid:31866572", - "pmid:31804632", - "pmid:31733943", - "pmid:31671347", - "pmid:31665086", - "pmid:31632248", - "pmid:31586346", - "pmid:31566610", - "pmid:31512951", - "pmid:31481131", - "pmid:31468394", - "pmid:31347257", - "pmid:31336350", - "pmid:31332380", - "pmid:31299981", - "pmid:31294106", - "pmid:31264835", - "pmid:31159589", - "pmid:31096929", - "pmid:31026518", - "pmid:30984240", - "pmid:30900173", - "pmid:30847793", - "pmid:30840878", - "pmid:30832215", - "pmid:30808398", - "pmid:30665341", - "pmid:30619448", - "pmid:30606610", - "pmid:30576349", - "pmid:30567555", - "pmid:30566867", - "pmid:30538724", - "pmid:30509972", - "pmid:30396881", - "pmid:30396281", - "pmid:30312299", - "pmid:30311737", - "pmid:30211570", - "pmid:30197656", - "pmid:30173918", - "pmid:30160796", - "pmid:30158855", - "pmid:30147707", - "pmid:30030199", - "pmid:29990673", - "pmid:29981579", - "pmid:29971092", - "pmid:29880767", - "pmid:29844802", - "pmid:29766042", - "pmid:29760651", - "pmid:29379561", - "pmid:29375310", - "pmid:29316893", - "pmid:29275276", - "pmid:29267266", - "pmid:29209628", - "pmid:29188551", - "pmid:28967713", - "pmid:28895261", - "pmid:28829283", - "pmid:28815939", - "pmid:28812997", - "pmid:28697590", - "pmid:28504725", - "pmid:28454580", - "pmid:28391068", - "pmid:28369393", - "pmid:28278294", - "pmid:28233916", - "pmid:28193118", - "pmid:28173181", - "pmid:28103472", - "pmid:28065649", - "pmid:28005950", - "pmid:27883256", - "pmid:27862088", - "pmid:27841182", - "pmid:27841172", - "pmid:27840045", - "pmid:27822316", - "pmid:27816231", - "pmid:27784894", - "pmid:27646161", - "pmid:27768763", - "pmid:27761921", - "pmid:27667322", - "pmid:27616423", - "pmid:27713816", - "pmid:27708271", - "pmid:27696642", - "pmid:27696273", - "pmid:27695335", - "pmid:27540028", - "pmid:27427765", - "pmid:27375073", - "pmid:27372099", - "pmid:27355815", - "pmid:27355445", - "pmid:27335370", - "pmid:27315125", - "pmid:27294193", - "pmid:27066582", - "pmid:27042357", - "pmid:27041225", - "pmid:27001315", - "pmid:26940792", - "pmid:26825750", - "pmid:26743003", - "pmid:26716517", - "pmid:26694146", - "pmid:26554012", - "pmid:26537920", - "pmid:26463479", - "pmid:26440889", - "pmid:26420841", - "pmid:26345686", - "pmid:26322075", - "pmid:26298472", - "pmid:26194536", - "pmid:26099177", - "pmid:26029703", - "pmid:25954027", - "pmid:25953684", - "pmid:25886163", - "pmid:25875842", - "pmid:25788698", - "pmid:25776194", - "pmid:25763861", - "pmid:25726753", - "pmid:25693964", - "pmid:25689687", - "pmid:25606365", - "pmid:25436181", - "pmid:25399540", - "pmid:25366135", - "pmid:25346430", - "pmid:25290064", - "pmid:25278957", - "pmid:25250047", - "pmid:25179629", - "pmid:25171808", - "pmid:25170346", - "pmid:25147555", - "pmid:25110527", - "pmid:25093044", - "pmid:25085749", - "pmid:25013385", - "pmid:24998620", - "pmid:24963073", - "pmid:24958193", - "pmid:24938362", - "pmid:24920338", - "pmid:24912415", - "pmid:24875778", - "pmid:24858908", - "pmid:24821701", - "pmid:24816393", - "pmid:24814676", - "pmid:24787137", - "pmid:24763282", - "pmid:24743386", - "pmid:24718368", - "pmid:24715853", - "pmid:24657592", - "pmid:24654675", - "pmid:24630283", - "pmid:24591415", - "pmid:24578575", - "pmid:24463622", - "pmid:24455203", - "pmid:24448548", - "pmid:24428240", - "pmid:24424424", - "pmid:24401315", - "pmid:24352881", - "pmid:24289922", - "pmid:24261641", - "pmid:24249225", - "pmid:24177047", - "pmid:24130133", - "pmid:23949867", - "pmid:23896050", - "pmid:23792063", - "pmid:23753897", - "pmid:23731704", - "pmid:23719910", - "pmid:23683082", - "pmid:23602499", - "pmid:23574351", - "pmid:23553633", - "pmid:23497562", - "pmid:23478018", - "pmid:23464607", - "pmid:23440729", - "pmid:23250915", - "pmid:23198693", - "pmid:23148490", - "pmid:23146966", - "pmid:23015788", - "pmid:22924671", - "pmid:22918986", - "pmid:22887750", - "pmid:22796595", - "pmid:22707411", - "pmid:22612820", - "pmid:22619118", - "pmid:22581803", - "pmid:22507827", - "pmid:22498846", - "pmid:22489017", - "pmid:22466801", - "pmid:22427040", - "pmid:22393900", - "pmid:22387066", - "pmid:22311273", - "pmid:22251309", - "pmid:22241100", - "pmid:22224633", - "pmid:22223546", - "pmid:22211843", - "pmid:22177572", - "pmid:22161987", - "pmid:22149120", - "pmid:22022567", - "pmid:22004265", - "pmid:21944929", - "pmid:21808616", - "pmid:21807882", - "pmid:21775729", - "pmid:21767618", - "pmid:21720528", - "pmid:21671049", - "pmid:21646280", - "pmid:21636656", - "pmid:21617890", - "pmid:21596781", - "pmid:21572337", - "pmid:21567456", - "pmid:21499798", - "pmid:21476992", - "pmid:21445959", - "pmid:21430544", - "pmid:21389081", - "pmid:21329465", - "pmid:21270637", - "pmid:21267007", - "pmid:21254876", - "pmid:21170301", - "pmid:21051337", - "pmid:20938029", - "pmid:20935171", - "pmid:20858229", - "pmid:20801083", - "pmid:20799337", - "pmid:20736975", - "pmid:20702130", - "pmid:20616364", - "pmid:20431035", - "pmid:20425835", - "pmid:20410144", - "pmid:20364100", - "pmid:20221430", - "pmid:20213777", - "pmid:20168238", - "pmid:20118148", - "pmid:20051238", - "pmid:20011099", - "pmid:20001115", - "pmid:19927162", - "pmid:19846466", - "pmid:19804849", - "pmid:19796183", - "pmid:19778484", - "pmid:19760650", - "pmid:19710035", - "pmid:19684044", - "pmid:19562332", - "pmid:19525339", - "pmid:19514725", - "pmid:19460939", - "pmid:19460937", - "pmid:19440516", - "pmid:19404994", - "pmid:19204162", - "pmid:19097038", - "pmid:19045956", - "pmid:19026394", - "pmid:19014369", - "pmid:18565783", - "pmid:18563710", - "pmid:18553360", - "pmid:18535897", - "pmid:18472227", - "pmid:18428348", - "pmid:18413472", - "pmid:18403614", - "pmid:18384775", - "pmid:18373410", - "pmid:18357616", - "pmid:18310361", - "pmid:18281036", - "pmid:18165971", - "pmid:18165276", - "pmid:18160412", - "pmid:18057320", - "pmid:17724287", - "pmid:17698009", - "pmid:17674408", - "pmid:17635840", - "pmid:17591512", - "pmid:17516099", - "pmid:17442505", - "pmid:17322660", - "pmid:17295053", - "pmid:17279084", - "pmid:17266074", - "pmid:17152065", - "pmid:17150213", - "pmid:17089161", - "pmid:17044853", - "pmid:16780889", - "pmid:16761284", - "pmid:16361284", - "pmid:16337617", - "pmid:16258159", - "pmid:16164596", - "pmid:16047092", - "pmid:15971024", - "pmid:15947063", - "pmid:15876460", - "pmid:15811008", - "pmid:15741991", - "pmid:15659577", - "pmid:15649335", - "pmid:15629215", - "pmid:15483045", - "pmid:15377638", - "pmid:15302914", - "pmid:15068386", - "pmid:14755444", - "pmid:14735162", - "pmid:14722156", - "pmid:14560307", - "pmid:14519687", - "pmid:14517952", - "pmid:12948442", - "pmid:12905066", - "pmid:12853612", - "pmid:12681986", - "pmid:12659659", - "pmid:12634803", - "pmid:12515381", - "pmid:12379314", - "pmid:12232854", - "pmid:12160728", - "pmid:12111644", - "pmid:11992571", - "pmid:11886710", - "pmid:11807410", - "pmid:11551101", - "pmid:11499669", - "pmid:11487573", - "pmid:11410685", - "pmid:11256870", - "pmid:11229516", - "pmid:11142761", - "pmid:11142752", - "pmid:11119302", - "pmid:11097353", - "pmid:11073538", - "pmid:11070156", - "pmid:11005143", - "pmid:10995510", - "pmid:10987654", - "pmid:10941804", - "pmid:10915764", - "pmid:10870330", - "pmid:10855793", - "pmid:10780779", - "pmid:10773084", - "pmid:10710419", - "pmid:10674158", - "pmid:10631132", - "pmid:10587583", - "pmid:10567518", - "pmid:10545610", - "pmid:10521303", - "pmid:10462618", - "pmid:10447261", - "pmid:10445321", - "pmid:10424820", - "pmid:10409756", - "pmid:10369109", - "pmid:10331601", - "pmid:10331600", - "pmid:10204857", - "pmid:9916838", - "pmid:9856500", - "pmid:9811938", - "pmid:9806479", - "pmid:9792200", - "pmid:9761677", - "pmid:9738717", - "pmid:9653650", - "pmid:9624140", - "pmid:9630071", - "pmid:9604772", - "pmid:9603608", - "pmid:9529778", - "pmid:9485421", - "pmid:9514250", - "pmid:9507388", - "pmid:9415473", - "pmid:9437788", - "pmid:9399905", - "pmid:9358013", - "pmid:9341861", - "pmid:9382110", - "pmid:9299309", - "pmid:9279752", - "pmid:9254854", - "pmid:9207038", - "pmid:9201980", - "pmid:9195158", - "pmid:9640603", - "pmid:9131013", - "pmid:8798682", - "pmid:8808600", - "pmid:8792815", - "pmid:8792813", - "pmid:8844091", - "pmid:8844089", - "pmid:8844077", - "pmid:8844068", - "pmid:8844065", - "pmid:8844064", - "pmid:8755928", - "pmid:8698331", - "pmid:8826482", - "pmid:8826479", - "pmid:8725793", - "pmid:8636996", - "pmid:8673086", - "pmid:8664297", - "pmid:8644711", - "pmid:8626781", - "pmid:8872026", - "pmid:8800930", - "pmid:8519769", - "pmid:8634688", - "pmid:7499428", - "pmid:8589687", - "pmid:7581460", - "pmid:8593539", - "pmid:8579216", - "pmid:8559749", - "pmid:7541938", - "pmid:7761473", - "pmid:7758107", - "pmid:7732383", - "pmid:7783163", - "pmid:8750357", - "pmid:7825564", - "pmid:7717734", - "pmid:7881407", - "pmid:7864047", - "pmid:7927336", - "pmid:7849707", - "pmid:8023854", - "pmid:8197163", - "pmid:8162055", - "pmid:8275089", - "pmid:8244331", - "pmid:8237919", - "pmid:7902319", - "pmid:7692601", - "pmid:8242066", - "pmid:8334699", - "pmid:1642231", - "pmid:1605199" - ] - }, + "motif": "CCG", + "count": 12, + "type": "flank_repeat" + }], + "benign_min": 6, + "benign_max": 26, + "intermediate_min": 27, + "intermediate_max": 35, + "pathogenic_min": 36, + "pathogenic_max": 250, + "motif_len": 3, + "ref_copies": 21.3, + "novel": "ref", + "gard": ["6677"], + "genereviews": ["NBK1305"], + "malacard": ["HNT016"], + "medgen": ["5654"], + "mondo": ["0007739"], + "omim": ["143100"], + "orphanet": ["399"], + "gnomad": ["HTT"], + "stripy": ["HTT"], + "tr_atlas": ["TR40017", "TR40018"], + "webstr_hg38": ["4701738", "86468", "86467"], + "webstr_hg19": ["Expansion_HD/HTT"], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "length_affects_severity", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance", "proposed_modifier"], + "disease_tags": [], + "references": ["genereviews:NBK1305", "pmid:39441074", "pmid:21171977", "pmid:27940602", "pmid:41959367", "pmid:39572770", "pmid:35245110", "pmid:39673793", "pmid:19507258", "doi:https://doi.org/10.64898/2026.05.08.26352223", "pmid:41926793", "pmid:39824182", "pmid:41951733", "pmid:29100084", "pmid:8458085", "mondo:0007739"], + "additional_literature": ["pmid:42210302", "pmid:42202221", "pmid:42196324", "pmid:42185880", "pmid:42183198", "pmid:42182232", "pmid:42181265", "pmid:42152675", "pmid:42109206", "pmid:42091595", "pmid:42007924", "pmid:41957010", "pmid:41916314", "pmid:41906693", "pmid:41884622", "pmid:41883719", "pmid:41850723", "pmid:41849610", "pmid:41849583", "pmid:41841355", "pmid:41838909", "pmid:41828602", "pmid:41786746", "pmid:41770933", "pmid:41762523", "pmid:41741274", "pmid:41736717", "pmid:41736445", "pmid:41697960", "pmid:41640354", "pmid:41622913", "pmid:41620818", "pmid:41612618", "pmid:41557250", "pmid:41545439", "pmid:41520110", "pmid:41462929", "pmid:41427302", "pmid:41426430", "pmid:41424860", "pmid:41418088", "pmid:41389205", "pmid:41361856", "pmid:41358280", "pmid:41346861", "pmid:41332649", "pmid:41279265", "pmid:41256123", "pmid:41254939", "pmid:41240184", "pmid:41239019", "pmid:41147028", "pmid:41139934", "pmid:41126427", "pmid:41095675", "pmid:41095094", "pmid:41084658", "pmid:41074680", "pmid:41030958", "pmid:41003760", "pmid:40985165", "pmid:40945646", "pmid:40926977", "pmid:40905034", "pmid:40898018", "pmid:40844528", "pmid:40838126", "pmid:40801627", "pmid:40796049", "pmid:40791503", "pmid:40777434", "pmid:40777236", "pmid:40752726", "pmid:40748251", "pmid:40748199", "pmid:40746751", "pmid:40702881", "pmid:40702852", "pmid:40667291", "pmid:40662609", "pmid:40643497", "pmid:40626527", "pmid:40620227", "pmid:40585812", "pmid:40563832", "pmid:40560365", "pmid:40559333", "pmid:40546037", "pmid:40520366", "pmid:40501897", "pmid:40501854", "pmid:40490511", "pmid:40450087", "pmid:40443124", "pmid:40429681", "pmid:40426848", "pmid:40419681", "pmid:40417743", "pmid:40369544", "pmid:40330856", "pmid:40319093", "pmid:40300581", "pmid:40267238", "pmid:40258535", "pmid:40221975", "pmid:40161725", "pmid:40081335", "pmid:40060574", "pmid:40055280", "pmid:40040448", "pmid:40004498", "pmid:40002561", "pmid:39984289", "pmid:39973385", "pmid:39938516", "pmid:39937881", "pmid:39923663", "pmid:39897579", "pmid:39849121", "pmid:39843658", "pmid:39825149", "pmid:39812810", "pmid:39803497", "pmid:39801710", "pmid:39772743", "pmid:39768315", "pmid:39763784", "pmid:39762660", "pmid:39713241", "pmid:39669608", "pmid:39666103", "pmid:39662690", "pmid:39651202", "pmid:39627841", "pmid:39621338", "pmid:39617003", "pmid:39614274", "pmid:39592326", "pmid:39574844", "pmid:39473968", "pmid:39457479", "pmid:39331414", "pmid:39309355", "pmid:39298485", "pmid:39270726", "pmid:39250876", "pmid:39242198", "pmid:39229124", "pmid:39185703", "pmid:39155290", "pmid:39155061", "pmid:39153206", "pmid:39115048", "pmid:39112488", "pmid:39096606", "pmid:39026894", "pmid:39023561", "pmid:38977715", "pmid:38974999", "pmid:38948755", "pmid:38931834", "pmid:38897956", "pmid:38895438", "pmid:38869243", "pmid:38841617", "pmid:38803421", "pmid:38786052", "pmid:38774633", "pmid:38749429", "pmid:38744826", "pmid:38734203", "pmid:38660915", "pmid:38627751", "pmid:38609352", "pmid:38595854", "pmid:38585669", "pmid:38544341", "pmid:38459427", "pmid:38449714", "pmid:38418081", "pmid:38416505", "pmid:38383663", "pmid:38379425", "pmid:38352602", "pmid:38291334", "pmid:38280392", "pmid:38267530", "pmid:38237588", "pmid:38195181", "pmid:38137557", "pmid:38092667", "pmid:38035176", "pmid:38007671", "pmid:38003344", "pmid:37993517", "pmid:37992538", "pmid:37961595", "pmid:37961108", "pmid:37855597", "pmid:37840138", "pmid:37831730", "pmid:37830620", "pmid:37827155", "pmid:37761940", "pmid:37751638", "pmid:37745577", "pmid:37744022", "pmid:37727506", "pmid:37716514", "pmid:37700320", "pmid:37582307", "pmid:37547003", "pmid:37535888", "pmid:37501188", "pmid:37481821", "pmid:37407555", "pmid:37379724", "pmid:37333326", "pmid:37315918", "pmid:37315450", "pmid:37306313", "pmid:37302585", "pmid:37288993", "pmid:37231148", "pmid:37199581", "pmid:37177784", "pmid:37162872", "pmid:37148558", "pmid:37146135", "pmid:37117485", "pmid:37005488", "pmid:36994811", "pmid:36958627", "pmid:36902304", "pmid:36839842", "pmid:36825038", "pmid:36797418", "pmid:36793800", "pmid:36711022", "pmid:36691277", "pmid:36658243", "pmid:36599645", "pmid:36599142", "pmid:36585400", "pmid:36550260", "pmid:36458209", "pmid:36427954", "pmid:36352624", "pmid:36344508", "pmid:36335527", "pmid:36335491", "pmid:36285345", "pmid:36262216", "pmid:36252286", "pmid:36220612", "pmid:36179426", "pmid:36130218", "pmid:36099320", "pmid:36098485", "pmid:36087538", "pmid:36075537", "pmid:36066723", "pmid:36064847", "pmid:36063627", "pmid:36009409", "pmid:35997316", "pmid:35935919", "pmid:35928225", "pmid:35926480", "pmid:35915275", "pmid:35914128", "pmid:35852957", "pmid:35803234", "pmid:35793238", "pmid:35661131", "pmid:35659303", "pmid:35628406", "pmid:35580427", "pmid:35440014", "pmid:35395816", "pmid:35379994", "pmid:35370826", "pmid:35357736", "pmid:35275350", "pmid:35241644", "pmid:35224162", "pmid:35182509", "pmid:35146388", "pmid:35143966", "pmid:35114102", "pmid:35099257", "pmid:35095420", "pmid:35058188", "pmid:35055435", "pmid:35046408", "pmid:35036881", "pmid:38835439", "pmid:34948242", "pmid:34942093", "pmid:34884469", "pmid:34880419", "pmid:34851867", "pmid:34829752", "pmid:34806402", "pmid:34800149", "pmid:34747792", "pmid:34718701", "pmid:34681268", "pmid:34663519", "pmid:34659371", "pmid:34658796", "pmid:34631219", "pmid:34608934", "pmid:34539331", "pmid:34536046", "pmid:34520257", "pmid:34504195", "pmid:34492254", "pmid:34473992", "pmid:34469738", "pmid:34423286", "pmid:34423068", "pmid:34390268", "pmid:34389718", "pmid:34376056", "pmid:34372915", "pmid:34366363", "pmid:34330701", "pmid:34301881", "pmid:34296279", "pmid:34200421", "pmid:34183222", "pmid:34180418", "pmid:34115782", "pmid:34093422", "pmid:34077591", "pmid:34071882", "pmid:34028139", "pmid:34003958", "pmid:33989290", "pmid:33983118", "pmid:33949657", "pmid:33918672", "pmid:33909994", "pmid:33907289", "pmid:33892278", "pmid:33824468", "pmid:33805940", "pmid:33766994", "pmid:33751106", "pmid:33731741", "pmid:33722743", "pmid:33710799", "pmid:33692166", "pmid:33684424", "pmid:33681777", "pmid:33675499", "pmid:33611676", "pmid:33606279", "pmid:33602179", "pmid:33581487", "pmid:33579864", "pmid:33576024", "pmid:33567536", "pmid:33556538", "pmid:33547932", "pmid:33521985", "pmid:33517535", "pmid:33500176", "pmid:33487499", "pmid:33376800", "pmid:33329316", "pmid:33310753", "pmid:33250715", "pmid:33249136", "pmid:33247537", "pmid:33242422", "pmid:33228555", "pmid:33209959", "pmid:33159825", "pmid:33108594", "pmid:33106889", "pmid:33105495", "pmid:33044188", "pmid:32979842", "pmid:32979507", "pmid:32975927", "pmid:32956974", "pmid:32954323", "pmid:32898862", "pmid:32876667", "pmid:32825467", "pmid:32807001", "pmid:32784364", "pmid:32761094", "pmid:32741964", "pmid:32702387", "pmid:32696070", "pmid:32675418", "pmid:32668197", "pmid:32661355", "pmid:32656337", "pmid:32612964", "pmid:32589923", "pmid:32580238", "pmid:32555394", "pmid:32548276", "pmid:32533168", "pmid:32500377", "pmid:32469433", "pmid:32439598", "pmid:32424160", "pmid:32339315", "pmid:32329133", "pmid:32260409", "pmid:32240172", "pmid:32189861", "pmid:32179492", "pmid:32164608", "pmid:32124191", "pmid:32102602", "pmid:32093602", "pmid:32077165", "pmid:32060489", "pmid:32043503", "pmid:31985471", "pmid:31940111", "pmid:31922295", "pmid:31893246", "pmid:31844074", "pmid:31828084", "pmid:31820322", "pmid:31810584", "pmid:31796991", "pmid:31785809", "pmid:31728006", "pmid:31725947", "pmid:31722751", "pmid:31712634", "pmid:31695145", "pmid:31614197", "pmid:31607598", "pmid:31599037", "pmid:31595198", "pmid:31586340", "pmid:31561381", "pmid:31546689", "pmid:31522753", "pmid:31491822", "pmid:31465962", "pmid:31403680", "pmid:31398342", "pmid:31379510", "pmid:31326748", "pmid:31302194", "pmid:31184975", "pmid:31114543", "pmid:31108174", "pmid:31104771", "pmid:31103960", "pmid:31086827", "pmid:31079989", "pmid:31059641", "pmid:30984798", "pmid:30961637", "pmid:30891880", "pmid:30887245", "pmid:30867264", "pmid:30850442", "pmid:30838312", "pmid:30811996", "pmid:30788902", "pmid:30726572", "pmid:30689590", "pmid:30682531", "pmid:30672003", "pmid:30631090", "pmid:30624705", "pmid:30618600", "pmid:30618191", "pmid:30615214", "pmid:30576007", "pmid:30550751", "pmid:30523767", "pmid:30396032", "pmid:30376191", "pmid:30358836", "pmid:30354976", "pmid:30336474", "pmid:30314815", "pmid:30262848", "pmid:30256717", "pmid:30239724", "pmid:30194983", "pmid:30194046", "pmid:30185623", "pmid:30171891", "pmid:30149534", "pmid:30126429", "pmid:30122542", "pmid:30120431", "pmid:30103339", "pmid:30103338", "pmid:30028085", "pmid:30007561", "pmid:29984244", "pmid:29945620", "pmid:29932473", "pmid:29925548", "pmid:29902468", "pmid:29881950", "pmid:29858077", "pmid:29813067", "pmid:29804730", "pmid:29801887", "pmid:29791508", "pmid:29743609", "pmid:29738460", "pmid:29715545", "pmid:29694882", "pmid:29687370", "pmid:29685790", "pmid:29682858", "pmid:29670796", "pmid:29660633", "pmid:29619771", "pmid:29581148", "pmid:29564144", "pmid:29535594", "pmid:29513687", "pmid:29494703", "pmid:29491012", "pmid:29480209", "pmid:29480205", "pmid:29480204", "pmid:29466333", "pmid:29462355", "pmid:29460498", "pmid:29459817", "pmid:29451775", "pmid:29441485", "pmid:29440125", "pmid:29378824", "pmid:29375575", "pmid:29367444", "pmid:29346421", "pmid:29324753", "pmid:29291624", "pmid:29264979", "pmid:29253686", "pmid:29249939", "pmid:29230030", "pmid:29229845", "pmid:29212711", "pmid:29172480", "pmid:29160844", "pmid:29066237", "pmid:29046994", "pmid:29043641", "pmid:29036832", "pmid:28986324", "pmid:28984613", "pmid:28971447", "pmid:28843844", "pmid:28743452", "pmid:28729730", "pmid:28715425", "pmid:28698602", "pmid:28661018", "pmid:28657159", "pmid:28653853", "pmid:28652746", "pmid:28642124", "pmid:28621522", "pmid:28585930", "pmid:28582868", "pmid:28536578", "pmid:28494017", "pmid:28465506", "pmid:28412438", "pmid:28406926", "pmid:28400517", "pmid:28359739", "pmid:28339398", "pmid:28270748", "pmid:28266655", "pmid:28238795", "pmid:28205498", "pmid:28202696", "pmid:28165127", "pmid:28153533", "pmid:28129107", "pmid:28096892", "pmid:28000697", "pmid:27983559", "pmid:27913616", "pmid:27870408", "pmid:27868347", "pmid:27818324", "pmid:27681197", "pmid:27774050", "pmid:27740685", "pmid:27714917", "pmid:27689620", "pmid:27677791", "pmid:27662335", "pmid:27658206", "pmid:27639545", "pmid:27611938", "pmid:27540492", "pmid:27481337", "pmid:27479945", "pmid:27477323", "pmid:27400454", "pmid:27376585", "pmid:27335115", "pmid:27335079", "pmid:27318215", "pmid:27288455", "pmid:27271685", "pmid:27221610", "pmid:27207688", "pmid:27182645", "pmid:27170315", "pmid:27085395", "pmid:27080129", "pmid:27031731", "pmid:27014581", "pmid:27003665", "pmid:27003663", "pmid:27002149", "pmid:26982737", "pmid:26958025", "pmid:26951563", "pmid:26900923", "pmid:26874369", "pmid:26864449", "pmid:26849111", "pmid:26846325", "pmid:26702360", "pmid:26682993", "pmid:26651603", "pmid:26642438", "pmid:26621114", "pmid:26615955", "pmid:26557176", "pmid:26490331", "pmid:26439718", "pmid:26428929", "pmid:26410751", "pmid:26397897", "pmid:26397895", "pmid:26378991", "pmid:26375764", "pmid:26333255", "pmid:26320893", "pmid:26247199", "pmid:26232222", "pmid:26219658", "pmid:26218986", "pmid:26201449", "pmid:26195796", "pmid:26148071", "pmid:26148061", "pmid:26100538", "pmid:26081309", "pmid:26079385", "pmid:25993131", "pmid:25990798", "pmid:25972145", "pmid:25953777", "pmid:25934536", "pmid:25928884", "pmid:25889241", "pmid:25876513", "pmid:25871323", "pmid:25859666", "pmid:25850430", "pmid:25849618", "pmid:25800750", "pmid:25767004", "pmid:25732261", "pmid:25703232", "pmid:25687118", "pmid:25678252", "pmid:25662336", "pmid:25642374", "pmid:25606985", "pmid:25574027", "pmid:25562842", "pmid:25466405", "pmid:25464109", "pmid:25453459", "pmid:25447230", "pmid:25385587", "pmid:25380582", "pmid:25358814", "pmid:25322077", "pmid:25316307", "pmid:25300333", "pmid:25300330", "pmid:25248608", "pmid:25246229", "pmid:25207939", "pmid:25136821", "pmid:25101541", "pmid:25099302", "pmid:25088714", "pmid:25062863", "pmid:25062764", "pmid:25035419", "pmid:25034271", "pmid:25026978", "pmid:24972706", "pmid:24951540", "pmid:24938402", "pmid:24921664", "pmid:24911443", "pmid:24841383", "pmid:24825316", "pmid:24816393", "pmid:24788406", "pmid:24784230", "pmid:24751919", "pmid:24728353", "pmid:24706734", "pmid:24633813", "pmid:24566949", "pmid:24564568", "pmid:24534762", "pmid:24465260", "pmid:24462335", "pmid:24459609", "pmid:24459107", "pmid:24452335", "pmid:24405816", "pmid:24390280", "pmid:24389360", "pmid:24380395", "pmid:24363131", "pmid:24359926", "pmid:24314096", "pmid:24292706", "pmid:24286237", "pmid:24270512", "pmid:24192302", "pmid:24047873", "pmid:24041806", "pmid:24038471", "pmid:24027120", "pmid:24022020", "pmid:24019913", "pmid:24000094", "pmid:23974869", "pmid:23963702", "pmid:23946314", "pmid:23933208", "pmid:23906595", "pmid:23896435", "pmid:23894380", "pmid:23847583", "pmid:23775678", "pmid:23765727", "pmid:23732677", "pmid:23664844", "pmid:23644918", "pmid:23624566", "pmid:23595883", "pmid:23576953", "pmid:23557875", "pmid:23525903", "pmid:23494654", "pmid:23480802", "pmid:23443539", "pmid:23440000", "pmid:23437422", "pmid:23419892", "pmid:23416527", "pmid:23398026", "pmid:23372043", "pmid:23346156", "pmid:23341618", "pmid:23300918", "pmid:23284626", "pmid:23277128", "pmid:25063431", "pmid:23157165", "pmid:23083689", "pmid:23054839", "pmid:23051704", "pmid:23042244", "pmid:23008174", "pmid:22993450", "pmid:22985800", "pmid:22974690", "pmid:22914735", "pmid:22833283", "pmid:22814437", "pmid:22803944", "pmid:22786682", "pmid:22748968", "pmid:22720673", "pmid:22674458", "pmid:22668780", "pmid:22649062", "pmid:22623107", "pmid:22613578", "pmid:22589249", "pmid:22583646", "pmid:22580959", "pmid:22580459", "pmid:22542623", "pmid:22537721", "pmid:22526956", "pmid:22497302", "pmid:26307259", "pmid:22454241", "pmid:22425717", "pmid:22409360", "pmid:22387017", "pmid:22383888", "pmid:22367996", "pmid:22359536", "pmid:22323755", "pmid:22306231", "pmid:22297462", "pmid:22274789", "pmid:22237433", "pmid:22235343", "pmid:22219281", "pmid:22216210", "pmid:22210241", "pmid:24353748", "pmid:23925262", "pmid:23476655", "pmid:22179316", "pmid:22178474", "pmid:22124413", "pmid:22072510", "pmid:22011578", "pmid:21989477", "pmid:21962718", "pmid:21951270", "pmid:21915913", "pmid:21909428", "pmid:21907324", "pmid:21897851", "pmid:21896309", "pmid:21858921", "pmid:21672921", "pmid:21566259", "pmid:21555070", "pmid:21540131", "pmid:21519949", "pmid:21509658", "pmid:21507249", "pmid:21432905", "pmid:21427085", "pmid:21370269", "pmid:21347256", "pmid:21334439", "pmid:21322024", "pmid:21297956", "pmid:21247881", "pmid:21211002", "pmid:21192926", "pmid:22832606", "pmid:22453877", "pmid:21177255", "pmid:21170307", "pmid:21147489", "pmid:21108634", "pmid:21106039", "pmid:21068430", "pmid:21037797", "pmid:21037796", "pmid:21028906", "pmid:20935170", "pmid:20919768", "pmid:24868381", "pmid:20877453", "pmid:20864123", "pmid:20697744", "pmid:20688164", "pmid:20655708", "pmid:20645403", "pmid:20629137", "pmid:20585470", "pmid:20569486", "pmid:20552561", "pmid:20457230", "pmid:20385209", "pmid:20360314", "pmid:20217280", "pmid:20190273", "pmid:20145031", "pmid:22353486", "pmid:20001119", "pmid:19997493", "pmid:19956633", "pmid:19895335", "pmid:19882735", "pmid:19857538", "pmid:19823894", "pmid:19810823", "pmid:19776381", "pmid:19652143", "pmid:19649213", "pmid:19621255", "pmid:19607813", "pmid:19595623", "pmid:19586540", "pmid:19573560", "pmid:19573298", "pmid:21048629", "pmid:19484127", "pmid:19465745", "pmid:19455596", "pmid:19412185", "pmid:19270701", "pmid:19266143", "pmid:19250382", "pmid:19249009", "pmid:21415933", "pmid:19243073", "pmid:19210789", "pmid:19200948", "pmid:19200361", "pmid:19193881", "pmid:19133136", "pmid:19130884", "pmid:19064745", "pmid:19059613", "pmid:19014073", "pmid:19012814", "pmid:18986359", "pmid:18981372", "pmid:18931668", "pmid:18930824", "pmid:18854207", "pmid:18844975", "pmid:18754766", "pmid:18688140", "pmid:18640989", "pmid:18608348", "pmid:18512767", "pmid:18502655", "pmid:18481795", "pmid:18441666", "pmid:18430257", "pmid:18413470", "pmid:18403212", "pmid:18403126", "pmid:18398004", "pmid:18387780", "pmid:18380486", "pmid:18373410", "pmid:18349696", "pmid:18314311", "pmid:18307262", "pmid:18299573", "pmid:18298206", "pmid:18231868", "pmid:18204817", "pmid:18192679", "pmid:19378429", "pmid:18158109", "pmid:18157708", "pmid:18096682", "pmid:18091069", "pmid:18077673", "pmid:18068007", "pmid:18067195", "pmid:18057558", "pmid:18004675", "pmid:17952586", "pmid:17947312", "pmid:17726644", "pmid:17707354", "pmid:17687393", "pmid:17665004", "pmid:17660463", "pmid:17653603", "pmid:17653274", "pmid:17653262", "pmid:17627386", "pmid:17615168", "pmid:17610899", "pmid:17584778", "pmid:17569088", "pmid:17562929", "pmid:17557337", "pmid:17548158", "pmid:17516481", "pmid:17493035", "pmid:17478887", "pmid:17427191", "pmid:17409200", "pmid:17383831", "pmid:17363167", "pmid:17356014", "pmid:17352933", "pmid:17352932", "pmid:17352931", "pmid:17352930", "pmid:17307423", "pmid:17299512", "pmid:17293170", "pmid:17291464", "pmid:17183717", "pmid:17181545", "pmid:17174018", "pmid:17115386", "pmid:17096834", "pmid:17055784", "pmid:17040921", "pmid:17018562", "pmid:17018277", "pmid:16987871", "pmid:16981596", "pmid:16980414", "pmid:16973440", "pmid:16925544", "pmid:16918952", "pmid:16914060", "pmid:16858508", "pmid:16772714", "pmid:16769871", "pmid:16751280", "pmid:16690085", "pmid:16687439", "pmid:16626669", "pmid:16606912", "pmid:16600988", "pmid:16570300", "pmid:16564426", "pmid:16526033", "pmid:16515395", "pmid:16461334", "pmid:16434483", "pmid:16395126", "pmid:16372906", "pmid:16321399", "pmid:16261565", "pmid:16221531", "pmid:16159402", "pmid:16135087", "pmid:16125146", "pmid:16111888", "pmid:16096998", "pmid:16082690", "pmid:16040812", "pmid:16033418", "pmid:16007623", "pmid:15986189", "pmid:15954918", "pmid:15906159", "pmid:15850737", "pmid:15848234", "pmid:15843398", "pmid:15832309", "pmid:15811941", "pmid:15764008", "pmid:15758168", "pmid:15742215", "pmid:15722951", "pmid:15716522", "pmid:15704211", "pmid:15635668", "pmid:15531095", "pmid:15496672", "pmid:15496421", "pmid:15468075", "pmid:15372528", "pmid:15365789", "pmid:15361494", "pmid:15354395", "pmid:15345132", "pmid:15254954", "pmid:15229244", "pmid:15211622", "pmid:15201464", "pmid:15201455", "pmid:15193429", "pmid:15147313", "pmid:15094787", "pmid:15076735", "pmid:15040808", "pmid:15025718", "pmid:14999077", "pmid:14993615", "pmid:14713958", "pmid:14708029", "pmid:14688268", "pmid:14673581", "pmid:14625278", "pmid:14625025", "pmid:14581669", "pmid:14570710", "pmid:12966525", "pmid:12926013", "pmid:12895502", "pmid:12886033", "pmid:12850791", "pmid:12824708", "pmid:12805114", "pmid:12797118", "pmid:12791042", "pmid:12783847", "pmid:12782968", "pmid:12700167", "pmid:12599191", "pmid:12576549", "pmid:12554681", "pmid:12460551", "pmid:12438470", "pmid:12405543", "pmid:12393802", "pmid:12354780", "pmid:12226089", "pmid:12223581", "pmid:12221159", "pmid:12218657", "pmid:12208565", "pmid:12177311", "pmid:12123845", "pmid:12097805", "pmid:11979062", "pmid:11978769", "pmid:11920857", "pmid:11914418", "pmid:11807410", "pmid:11782460", "pmid:11761463", "pmid:11741397", "pmid:11704263", "pmid:11689489", "pmid:11607033", "pmid:11593450", "pmid:11592850", "pmid:11558794", "pmid:11552131", "pmid:11532992", "pmid:11524486", "pmid:11520890", "pmid:11494364", "pmid:11483245", "pmid:11386982", "pmid:11409734", "pmid:11406606", "pmid:11340249", "pmid:11331615", "pmid:11317220", "pmid:11279522", "pmid:11260214", "pmid:22034471", "pmid:11225602", "pmid:11172033", "pmid:11152661", "pmid:11106399", "pmid:11105061", "pmid:11063736", "pmid:11040449", "pmid:11030759", "pmid:11021756", "pmid:11013077", "pmid:11009201", "pmid:10980573", "pmid:10964480", "pmid:10880387", "pmid:10860124", "pmid:10814708", "pmid:10794362", "pmid:10780268", "pmid:10770860", "pmid:10766906", "pmid:10717003", "pmid:10712225", "pmid:10677504", "pmid:10666223", "pmid:10631644", "pmid:10611371", "pmid:10581038", "pmid:10574348", "pmid:10564878", "pmid:10533044", "pmid:10522893", "pmid:10502848", "pmid:10502825", "pmid:10489045", "pmid:10486315", "pmid:10478585", "pmid:10441327", "pmid:10441201", "pmid:10434306", "pmid:10434303", "pmid:10434297", "pmid:10434295", "pmid:10405095", "pmid:10398087", "pmid:10334474", "pmid:10333377", "pmid:10206229", "pmid:10197541", "pmid:10196370", "pmid:10196365", "pmid:10098889", "pmid:10091627", "pmid:10090478", "pmid:10082833", "pmid:10052816", "pmid:10051007", "pmid:10023115", "pmid:9949443", "pmid:9949199", "pmid:9932964", "pmid:9887339", "pmid:9818876", "pmid:9806905", "pmid:9792871", "pmid:9768849", "pmid:9684917", "pmid:9674805", "pmid:9666478", "pmid:9647305", "pmid:9626775", "pmid:9611675", "pmid:9527890", "pmid:9536082", "pmid:9536081", "pmid:9536080", "pmid:9595987", "pmid:9577843", "pmid:9514585", "pmid:9514579", "pmid:9361024", "pmid:9485067", "pmid:9462548", "pmid:9415475", "pmid:23604331", "pmid:9399688", "pmid:9398841", "pmid:9388503", "pmid:9339688", "pmid:9299885", "pmid:9299309", "pmid:9267034", "pmid:9267033", "pmid:9152833", "pmid:9150744", "pmid:9150168", "pmid:9108071", "pmid:9106534", "pmid:9143014", "pmid:10462592", "pmid:9020849", "pmid:9401013", "pmid:9219003", "pmid:9002673", "pmid:9384710", "pmid:8931689", "pmid:8898202", "pmid:8855141", "pmid:8912795", "pmid:8751857", "pmid:8659522", "pmid:8735227", "pmid:8643525", "pmid:8678115", "pmid:8606810", "pmid:8714530", "pmid:8614526", "pmid:8985734", "pmid:8954302", "pmid:8840396", "pmid:8766138", "pmid:8572659", "pmid:8557266", "pmid:7477379", "pmid:8804464", "pmid:7576661", "pmid:7568002", "pmid:8544189", "pmid:8541834", "pmid:7668287", "pmid:7668260", "pmid:7639626", "pmid:7484060", "pmid:7480359", "pmid:7774020", "pmid:7675777", "pmid:7898693", "pmid:7868117", "pmid:7634532", "pmid:7757069", "pmid:9173995", "pmid:7881406", "pmid:7969980", "pmid:7959696", "pmid:7853373", "pmid:7915776", "pmid:7815437", "pmid:8208412", "pmid:8178825", "pmid:8064815", "pmid:7909529", "pmid:8162059", "pmid:8162055", "pmid:8162053", "pmid:8044653", "pmid:7888133", "pmid:7865169", "pmid:8133511", "pmid:8133510", "pmid:8133508", "pmid:8133495", "pmid:8111374", "pmid:8087617", "pmid:8105214", "pmid:8268906", "pmid:8252042", "pmid:8242074", "pmid:8401589", "pmid:8401588", "pmid:8401587", "pmid:2521771", "pmid:2971929", "pmid:3131233"] +}, +{ + "id": "HDL2_JPH3", + "disease_id": "HDL2", + "gene": "JPH3", + "evidence": ["Definitive"], + "chrom": "chr16", + "start_hg38": 87604282, + "stop_hg38": 87604329, + "start_hg19": 87637888, + "stop_hg19": 87637935, + "start_t2t": 93675723, + "stop_t2t": 93675776, + "disease": "Huntington disease-like 2", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Huntington disease-like 2 (HDL2) is a severe neurodegenerative disorder considered part of the neuroacanthocytosis syndromes characterized by a triad of movement, psychiatric, and cognitive abnormalities [@mondo:0011671].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "<1/1,000,000 [@orphanet:98934]. Largely in individuals of African ancestry [@genereviews:NBK1529], where a possible JPH3 founder mutation has been identified [@pmid:40187026].", + "age_onset": "Typical: 30-52; Range: 12-66 [@genereviews:NBK1529].", + "age_onset_min": 12.0, + "age_onset_max": 66.0, + "typ_age_onset_min": 30.0, + "typ_age_onset_max": 52.0, + "details": "Intermediate alleles (29-39) may either be premutations or associated with reduced penetrance; the longest pathogenic expansion (40+ motifs) to date is 60 repeats [@genereviews:NBK1529]", + "detection": null, + "mechanism": "LoF/GoF", + "mechanism_detail": "Non-mutually exclusive mechanisms include loss of function from RNA sequestration and gain of function from toxic transcripts and increased protein expression [@genereviews:NBK1529]", + "year": "2001 [@pmid:11694876]", + "location_in_gene": "Coding Exon 2", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CTG"], + "pathogenic_motif_reference_orientation": ["CTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CTG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 28, + "intermediate_min": 29, + "intermediate_max": 39, + "pathogenic_min": 40, + "pathogenic_max": 60, + "motif_len": 3, + "ref_copies": 15.6667, + "novel": "ref", + "gard": ["16874"], + "genereviews": ["NBK1529"], + "malacard": ["HNT004"], + "medgen": ["341120"], + "mondo": ["0011671"], + "omim": ["606438"], + "orphanet": ["98934"], + "gnomad": ["JPH3"], + "stripy": ["JPH3"], + "tr_atlas": ["TR143309"], + "webstr_hg38": ["828516", "5987878"], + "webstr_hg19": ["Expansion_HDL2/JPH3"], + "locus_tags": ["somatic_instability", "length_affects_phenotype", "length_affects_onset", "length_affects_penetrance", "length_affects_severity"], + "disease_tags": [], + "references": ["genereviews:NBK1529", "orphanet:98934", "pmid:40187026", "pmid:11694876", "mondo:0011671"], + "additional_literature": ["pmid:41957010", "pmid:41074680", "pmid:40914005", "pmid:38948793", "pmid:38725192", "pmid:38617831", "pmid:37379724", "pmid:35926480", "pmid:33824468", "pmid:33044188", "pmid:32675418", "pmid:32028232", "pmid:30682531", "pmid:30615214", "pmid:29801887", "pmid:29208631", "pmid:29066237", "pmid:27400454", "pmid:27288455", "pmid:26079385", "pmid:24269018", "pmid:22447335", "pmid:22367996", "pmid:22297462", "pmid:21555070", "pmid:17516481", "pmid:16858508", "pmid:15764008", "pmid:15468075", "pmid:14557581", "pmid:12805114", "pmid:11906164"] +}, +{ + "id": "OPDM1_LRP12", + "disease_id": "OPDM1", + "gene": "LRP12", + "evidence": ["Strong"], + "chrom": "chr8", + "start_hg38": 104588970, + "stop_hg38": 104588999, + "start_hg19": 105601198, + "stop_hg19": 105601227, + "start_t2t": 105716409, + "stop_t2t": 105716441, + "disease": "Oculopharyngodistal myopathy type 1", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Adult-onset ptosis, dysphagia [@pmid:39349043]; External ophthalmoplegia, facial weakness, pharyngeal, and distal limb weakness [@pmid:38876750]; May be slight male predominance [@pmid:34047774].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Population dependent; unknown percentage of LRP12 pathogenic variants. Typically East Asian ancestry [@pmid:38876750]; potentially most frequent cause of OPDM in Japan [@pmid:34047774].", + "age_onset": "Typical: 31-51 [@pmid:34047774]; Range: 7-66 [@pmid:2124290].", + "age_onset_min": 7.0, + "age_onset_max": 66.0, + "typ_age_onset_min": 31.0, + "typ_age_onset_max": 51.0, + "details": "Benign range (13-45) inferred from cohort data, but pathogenic range isn't yet fully understood [@genereviews:NBK535148]. In a cohort of 65 patients from 59 families, alleles ranged from 85-289 repeats, with an inverse relationship between size and age of onset [@pmid:34047774]. Inherited peripheral neuropathy (IPN) may be associated with shorter expansions [@pmid:39013564]. Interruptions seen: ACG, CCA [@pmid:35245110].", + "detection": "Short-read sequencing has been reported to be unreliable at detecting large expansions [@pmid:40858832]. RP-PCR followed by long-read sequencing is commonly used for characterization [@pmid:39013564].", + "mechanism": "GoF?", + "mechanism_detail": "RNA mediated toxicity hypothesized [@omim:164310]; may involve RAN translation [@pmid:38467784]. Somatic mosaicism and hypermethylation have also been reported [@pmid:41131788].", + "year": "2019 [@pmid:31332380]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CGC"], + "pathogenic_motif_reference_orientation": ["CGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 13, + "benign_max": 45, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 85, + "pathogenic_max": 289, + "motif_len": 3, + "ref_copies": 11.7, + "novel": "ref", + "gard": ["15097"], + "genereviews": ["NBK535148"], + "malacard": ["OCL076"], + "medgen": ["1684682"], + "mondo": ["0020793"], + "omim": ["164310"], + "orphanet": ["98897"], + "gnomad": ["LRP12"], + "stripy": ["LRP12"], + "tr_atlas": ["TR88348"], + "webstr_hg38": ["1082178", "4874587"], + "webstr_hg19": ["STR_1441036"], + "locus_tags": ["somatic_instability", "anticipation", "length_affects_onset"], + "disease_tags": ["oculopharyngodistal_myopathy"], + "references": ["pmid:34047774", "pmid:2124290", "omim:164310", "pmid:38467784", "pmid:41131788", "genereviews:NBK535148", "pmid:39013564", "pmid:35245110", "pmid:38876750", "pmid:31332380", "pmid:39349043"], + "additional_literature": ["pmid:41888971", "pmid:41792844", "pmid:41125376", "pmid:40645757", "pmid:40417202", "pmid:40084170", "pmid:38726482", "pmid:37923380", "pmid:37864208", "pmid:37339631", "pmid:36052448", "pmid:35700120", "pmid:35314910", "pmid:35152460", "pmid:35148830", "pmid:34927285", "pmid:33693509", "pmid:33374016", "pmid:33239111", "pmid:32493488", "pmid:27072820"] +}, +{ + "id": "FAME3_MARCHF6", + "disease_id": "FAME3", + "gene": "MARCHF6", + "evidence": ["Definitive"], + "chrom": "chr5", + "start_hg38": 10356343, + "stop_hg38": 10356411, + "start_hg19": 10356455, + "stop_hg19": 10356523, + "start_t2t": 10295525, + "stop_t2t": 10295593, + "disease": "Familial adult myoclonic epilepsy type 3", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical tremor with epilepsy [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Overall FAME prevalence is < 1/35,000; MARCHF6-caused much smaller. Most cases have European ancestry [@pmid:38876750].", + "age_onset": "Typical: 24-41 based on one 76 member pedigree [@pmid:19616813]; Range: 10 [@omim:613608] - 50 [@pmid:40788430].", + "age_onset_min": 10.0, + "age_onset_max": 50.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Healthy controls do not have pathogenic allele (TTTCA), but do have 9-20 benign motifs (TTTTA) [@genereviews:NBK535148]. Total allele size in probands spanned from 650-1035 repeats; an inverse relationship between allele size and age of onset was noted [@pmid:31664039, @pmid:40788430]. In one study it was proposed that pathogenicity only occurs when TTTCA is expanded [@pmid:40788430]. RP-PCR can detect the pathogenic TTTCA insertion motif but does not adequately resolve complex TTTTA/TTTCA architecture [@pmid:41268177].", + "detection": "Long-range PCR followed by long-read sequencing has been used to size and determine structure [@pmid:40200849].", + "mechanism": "Unknown", + "mechanism_detail": "Noted as unknown in literature [@omim:613608].", + "year": "2019 [@pmid:31664039]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["TTTTA"], + "pathogenic_motif_reference_orientation": ["TTTCA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["ATGTT", "TAGTT", "TTTTG", "TTTTT"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["ATGTT", "AGTTT", "GTTTT", "TTTTT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "BPES_FOXL2", - "disease_id": "BPES", - "gene": "FOXL2", - "evidence": [ - "Definitive" - ], - "chrom": "chr3", - "start_hg38": 138946019, - "stop_hg38": 138946062, - "start_hg19": 138664861, - "stop_hg19": 138664904, - "start_t2t": 141687011, - "stop_t2t": 141687054, - "disease": "Blepharophimosis, epicanthus inversus, and ptosis", - "inheritance": [ - "AD", - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Blepharophimosis, Ptosis, and Epicanthus Inversus syndrome (BPES) is an ophthalmic disorder characterized by blepharophimosis, ptosis, epicanthus inversus, and telecanthus, that can appear associated with (type I) or without premature ovarian failure (POF) (type II) [@mondo:0007201].", - "hpo_terms": null, - "prevalence": "0.3/50000", - "prevalence_details": "1 in 50,000 births globally for all BPES, with FOXL2 expansions ~30% of pathogenic variants [@genereviews:NBK1441; @genereviews:NBK535148; @pmid:12529855]. Found worldwide, without differences in prevalence based on sex/ethnicity [@genereviews:NBK1441].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": 0, - "typ_age_onset_max": 0, - "details": "14 repeats appears highly constrained in humans: homozygous expansions from 14 polyalanines to 19 leads to disease, which can be limited to isolated palpebral defects [@pmid:15591279]. Heterozygous expansions to 24 polyalanines also lead to disease [@pmid:15591279]. Locus start can differ between catalogs, which can affect genotyping.", - "detection": null, - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyalanine expansion leads to haploinsufficiency, likely due to decreased protein availability due to mislocalization following nuclear inclusion [@genereviews:NBK1441; @pmid:15591279]", - "year": "2003 [@pmid:12529855]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 14, - "benign_max": 14, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 15, - "pathogenic_max": 24, - "motif_len": 3, - "ref_copies": 14, - "novel": "ref", - "gard": [ - "23" - ], - "genereviews": [ - "NBK1441" - ], - "malacard": [ - "BLP046" - ], - "medgen": [ - "66312" - ], - "mondo": [ - "0007201" - ], - "omim": [ - "110100" - ], - "orphanet": [ - "126" - ], - "gnomad": [ - "FOXL2" - ], - "stripy": [ - "FOXL2" - ], - "tr_atlas": [ - "TR36092" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "genereviews:NBK1441", - "pmid:15591279", - "genereviews:NBK535148", - "pmid:12529855", - "mondo:0007201" - ], - "additional_literature": [ - "pmid:22926839", - "pmid:18158309", - "pmid:17089161", - "pmid:7633459" - ] + "motif": "TTTTA", + "count": 12, + "type": "internal_repeat" }, { - "id": "FRDA_FXN", - "disease_id": "FRDA", - "gene": "FXN", - "evidence": [ - "Definitive" - ], - "chrom": "chr9", - "start_hg38": 69037286, - "stop_hg38": 69037304, - "start_hg19": 71652202, - "stop_hg19": 71652220, - "start_t2t": 81210834, - "stop_t2t": 81210861, - "disease": "Friedreich ataxia", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Friedreich ataxia (FRDA) is an autosomal recessive neurodegenerative disorder characterized by progressive gait and limb ataxia with associated limb muscle weakness, absent lower limb reflexes, extensor plantar responses, dysarthria, and decreased vibratory sense and proprioception. Onset is usually in the first or second decade, before the end of puberty [@omim:229300].", - "hpo_terms": null, - "prevalence": "1/50000", - "prevalence_details": "1/50,000 [@omim:229300; @pmid:29100084]: Known carrier frequency 1000/100,000; observed 421/100,000. Most common inherited ataxia in Europe, the Middle East, India, and North Africa; not documented in Southeast Asia, in sub-Saharan Africa, or among Native Americans [@genereviews:NBK1281].", - "age_onset": "Typical: 10-15; Range: 2-80 [@genereviews:NBK1281].", - "age_onset_min": 2, - "age_onset_max": 80, - "typ_age_onset_min": 10, - "typ_age_onset_max": 15, - "details": "96% of FA patients have biallelic GAA expansions in intron 1 (compared to compound heterozygous with another mutation type), in which the reference allele is conventionally 5-33 repeats [@genereviews:NBK1281]. Intermediate alleles (34-55) are associated with premutations, but may lead to disease as exact pathogenicity/penetrance thresholds have not been demarcated [@genereviews:NBK1281]. The expanded repeats can be interrupted with GAAGAG, GAAGGA, or GAAGAAAA sequences, leading to differential phenotypes [@pmid:11748752]. Allele size is correlated with disease severity and inversely correlated to age of onset, and expansions can reach 1700 repeats [@pmid:8815938].", - "detection": "RP-PCR and long-range PCR have been used to detect expansions [@pmid:35595154]. Long-read sequencing has sized large alleles and resolved sequence organization [@pmid:35595154].", - "mechanism": "LoF", - "mechanism_detail": "Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768].", - "year": "1996 [@pmid:8596916]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GAA" - ], - "pathogenic_motif_reference_orientation": [ - "GAA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AAG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "A", - "count": 16, - "type": "flank_repeat" - }, - { - "motif": "GAA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 5, - "benign_max": 33, - "intermediate_min": 34, - "intermediate_max": 55, - "pathogenic_min": 56, - "pathogenic_max": 1700, - "motif_len": 3, - "ref_copies": 6, - "novel": "ref", - "gard": [ - "6468" - ], - "genereviews": [ - "NBK1281" - ], - "malacard": [ - "FRD001" - ], - "medgen": [ - "383962" - ], - "mondo": [ - "0100340" - ], - "omim": [ - "229300" - ], - "orphanet": [ - "95" - ], - "gnomad": [ - "FXN" - ], - "stripy": [ - "FXN" - ], - "tr_atlas": [ - "TR93516" - ], - "webstr_hg38": [ - "1509872" - ], - "webstr_hg19": [], - "locus_tags": [ - "somatic_instability", - "maternal_expansion", - "length_affects_onset", - "length_affects_phenotype", - "motif_affects_instability", - "motif_affects_onset", - "motif_affects_penetrance" - ], - "disease_tags": [ - "ataxia" - ], - "references": [ - "genereviews:NBK1281", - "pmid:16205714", - "pmid:36169768", - "pmid:11748752", - "pmid:8815938", - "omim:229300", - "pmid:29100084", - "pmid:8596916" - ], - "additional_literature": [ - "pmid:42134333", - "pmid:42094143", - "pmid:42018061", - "pmid:41954755", - "pmid:41919005", - "pmid:41890103", - "pmid:41640354", - "pmid:41432640", - "pmid:41426430", - "pmid:41318543", - "pmid:41301739", - "pmid:41278766", - "pmid:41176519", - "pmid:41137390", - "pmid:41074692", - "pmid:41014100", - "pmid:40994821", - "pmid:40970480", - "pmid:40898875", - "pmid:40880907", - "pmid:40507780", - "pmid:40488180", - "pmid:40419681", - "pmid:40404357", - "pmid:40296143", - "pmid:40141365", - "pmid:39812846", - "pmid:39810753", - "pmid:39574782", - "pmid:39571249", - "pmid:39519164", - "pmid:39496895", - "pmid:39324476", - "pmid:39235665", - "pmid:39219417", - "pmid:39062522", - "pmid:38936158", - "pmid:38495102", - "pmid:38484450", - "pmid:38396238", - "pmid:38367363", - "pmid:38352270", - "pmid:38141359", - "pmid:38063871", - "pmid:38014032", - "pmid:37891254", - "pmid:37585105", - "pmid:37006329", - "pmid:36928898", - "pmid:36800320", - "pmid:36780807", - "pmid:36777637", - "pmid:36638893", - "pmid:36635061", - "pmid:36618024", - "pmid:36511872", - "pmid:36369844", - "pmid:36133907", - "pmid:36036008", - "pmid:35850241", - "pmid:35708503", - "pmid:35595154", - "pmid:35301072", - "pmid:35182509", - "pmid:34920960", - "pmid:34849883", - "pmid:34786480", - "pmid:34747814", - "pmid:34687355", - "pmid:34643298", - "pmid:34600502", - "pmid:34408077", - "pmid:34372915", - "pmid:34299126", - "pmid:34214898", - "pmid:33820410", - "pmid:33629768", - "pmid:33624863", - "pmid:33599954", - "pmid:33592237", - "pmid:33529321", - "pmid:33354116", - "pmid:33151022", - "pmid:33028632", - "pmid:32746884", - "pmid:32744307", - "pmid:32717741", - "pmid:32608417", - "pmid:32586831", - "pmid:32582297", - "pmid:32481586", - "pmid:32385683", - "pmid:32291635", - "pmid:31911468", - "pmid:31904895", - "pmid:31877117", - "pmid:31673878", - "pmid:31650522", - "pmid:31446150", - "pmid:31279523", - "pmid:30874991", - "pmid:30828501", - "pmid:30761510", - "pmid:30635474", - "pmid:30596685", - "pmid:30590615", - "pmid:30552117", - "pmid:30519163", - "pmid:30464193", - "pmid:30425621", - "pmid:30358880", - "pmid:30237783", - "pmid:30159187", - "pmid:30097477", - "pmid:30076049", - "pmid:30065630", - "pmid:29666341", - "pmid:29529236", - "pmid:29261783", - "pmid:29125828", - "pmid:29070698", - "pmid:28904984", - "pmid:28812047", - "pmid:28716278", - "pmid:28451558", - "pmid:28282710", - "pmid:28109580", - "pmid:27518705", - "pmid:27668106", - "pmid:27648458", - "pmid:27644330", - "pmid:27522354", - "pmid:27425605", - "pmid:27386501", - "pmid:27228352", - "pmid:27206881", - "pmid:27142428", - "pmid:26906906", - "pmid:26896803", - "pmid:28392990", - "pmid:26704351", - "pmid:26414159", - "pmid:26401053", - "pmid:26393353", - "pmid:26379101", - "pmid:26339677", - "pmid:26338206", - "pmid:26301374", - "pmid:26149656", - "pmid:26099177", - "pmid:25845763", - "pmid:25831023", - "pmid:25814655", - "pmid:25758173", - "pmid:25685137", - "pmid:25681319", - "pmid:25616511", - "pmid:25207996", - "pmid:25198290", - "pmid:25112975", - "pmid:25022367", - "pmid:24971578", - "pmid:24962209", - "pmid:24858524", - "pmid:24819921", - "pmid:24816001", - "pmid:24787137", - "pmid:24714088", - "pmid:24691413", - "pmid:24667739", - "pmid:24665325", - "pmid:24613765", - "pmid:24586819", - "pmid:24455203", - "pmid:24371004", - "pmid:24327207", - "pmid:24209901", - "pmid:24023969", - "pmid:23996585", - "pmid:23943791", - "pmid:23925595", - "pmid:23922695", - "pmid:23879205", - "pmid:23838345", - "pmid:23775342", - "pmid:23691127", - "pmid:23640016", - "pmid:23625326", - "pmid:23474817", - "pmid:23418481", - "pmid:23382970", - "pmid:23280845", - "pmid:25499576", - "pmid:23269675", - "pmid:23242090", - "pmid:23071719", - "pmid:22798143", - "pmid:22787155", - "pmid:22764244", - "pmid:22752483", - "pmid:22691228", - "pmid:22447512", - "pmid:22414340", - "pmid:22409940", - "pmid:22289650", - "pmid:22262734", - "pmid:21830088", - "pmid:21776984", - "pmid:21745819", - "pmid:21652007", - "pmid:21486239", - "pmid:21397024", - "pmid:21181307", - "pmid:21127046", - "pmid:21051337", - "pmid:21040903", - "pmid:20675166", - "pmid:20559546", - "pmid:20506029", - "pmid:20373285", - "pmid:20098685", - "pmid:20090835", - "pmid:19956589", - "pmid:19876374", - "pmid:19733517", - "pmid:19485941", - "pmid:19370769", - "pmid:19259763", - "pmid:19043662", - "pmid:18820300", - "pmid:18697824", - "pmid:18597733", - "pmid:18045775", - "pmid:17703324", - "pmid:17498922", - "pmid:28182935", - "pmid:17262846", - "pmid:17235301", - "pmid:17024371", - "pmid:16989817", - "pmid:16919418", - "pmid:16857735", - "pmid:16764889", - "pmid:16644517", - "pmid:16120311", - "pmid:15376485", - "pmid:15340363", - "pmid:15233994", - "pmid:15201464", - "pmid:15180699", - "pmid:14978261", - "pmid:14962663", - "pmid:12516053", - "pmid:12112211", - "pmid:11939898", - "pmid:11843702", - "pmid:11809170", - "pmid:11428460", - "pmid:11340071", - "pmid:11325966", - "pmid:11240567", - "pmid:11071107", - "pmid:11054139", - "pmid:10982543", - "pmid:10982187", - "pmid:10969848", - "pmid:10896266", - "pmid:10732799", - "pmid:10681084", - "pmid:10556290", - "pmid:10230399", - "pmid:10102712", - "pmid:10077729", - "pmid:9811933", - "pmid:9779809", - "pmid:9737785", - "pmid:9667602", - "pmid:9577387", - "pmid:9443873", - "pmid:9486868", - "pmid:9448568", - "pmid:9416816", - "pmid:9409356", - "pmid:9326946", - "pmid:9339708", - "pmid:9339680", - "pmid:9270667", - "pmid:9270608", - "pmid:9241271", - "pmid:9177790", - "pmid:9153531", - "pmid:9153129", - "pmid:10464657", - "pmid:9331900", - "pmid:8751856" - ] - }, + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 650, + "pathogenic_max": 1035, + "motif_len": 5, + "ref_copies": 13.6, + "novel": "novel", + "gard": ["18084"], + "genereviews": ["NBK535148"], + "malacard": ["EPL053"], + "medgen": ["462210"], + "mondo": ["0013322"], + "omim": ["613608"], + "orphanet": ["86814"], + "gnomad": ["MARCHF6"], + "stripy": ["MARCHF6"], + "tr_atlas": ["TR51895"], + "webstr_hg38": ["5994579"], + "webstr_hg19": ["STR_1116660"], + "locus_tags": ["somatic_instability", "motif_affects_onset", "motif_affects_penetrance", "motif_affects_severity"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:19616813", "omim:613608", "pmid:40788430", "genereviews:NBK535148", "pmid:31664039", "pmid:38876750", "pmid:39349043"], + "additional_literature": ["pmid:41268177", "pmid:41219789", "pmid:40417743", "pmid:40200849", "pmid:33040085"] +}, +{ + "id": "CHNG3_MIR7-2", + "disease_id": "CHNG3", + "gene": "MIR7-2", + "evidence": ["Strong"], + "chrom": "chr15", + "start_hg38": 88569433, + "stop_hg38": 88569452, + "start_hg19": 89112664, + "stop_hg19": 89112683, + "start_t2t": 86324038, + "stop_t2t": 86324057, + "disease": "Nongoitrous congenital hypothyroidism-3", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Nongoitrous congenital hypothyroidism-3 (CHNG3) is characterized by infantile-onset clinical and subclinical hypothyroidism associated with a small thyroid gland, high circulating TSH, normal free T4 levels, and normal or mildly increased serum thyroglobulin. Untreated patients or patients who discontinue treatment show a characteristic transition to multinodular goiter (MNG) with age [@omim:609893].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in 12 families, with ancestry including: Irish, White European, French (Normandie), Ashkenazi, French Canadian, Danish/White European, Welsh, Scottish, Italian, British/White European, Italian/Turkish/Lebanese, German/Palestinian, and South Chinese [@pmid:38714868].", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Deletion of one repeat (4 to 3 repeats) found in 10 unrelated families with unsolved disease [@pmid:38714869]; a heterozygous T-to-G transversion in the third repeat can also lead to disease [@pmid:38714868].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Activates a thyroid-specific enhancer [@pmid:38714868; @pmid:38714869].", + "year": "2024 [@pmid:38714869]", + "location_in_gene": "Non-coding", + "gene_strand": "-", + "reference_motif_reference_orientation": ["TTTG"], + "pathogenic_motif_reference_orientation": ["TTTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AAAC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 4, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 3, + "pathogenic_max": 3, + "motif_len": 4, + "ref_copies": null, + "novel": "ref", + "gard": ["1487"], + "genereviews": [], + "malacard": ["HYP355"], + "medgen": ["424853"], + "mondo": ["0012360"], + "omim": ["609893"], + "orphanet": [], + "gnomad": ["PRE-MIR7-2"], + "stripy": [], + "tr_atlas": ["TR192005"], + "webstr_hg38": ["5177365"], + "webstr_hg19": ["STR_492924"], + "locus_tags": ["contraction"], + "disease_tags": [], + "references": ["pmid:38714868", "pmid:38714869", "omim:609893"], + "additional_literature": [] +}, +{ + "id": "ADTKD_MUC1", + "disease_id": "ADTKD", + "gene": "MUC1", + "evidence": ["Definitive"], + "chrom": "chr1", + "start_hg38": 155188505, + "stop_hg38": 155192239, + "start_hg19": 155160981, + "stop_hg19": 155162030, + "start_t2t": 154328121, + "stop_t2t": 154330802, + "disease": "Autosomal dominant tubulointerstitial kidney disease", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function [@mondo:0020726].", + "hpo_terms": null, + "prevalence": "2.5/1000000", + "prevalence_details": "Disease is affected 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease [@genereviews:NBK153723]", + "age_onset": "Age of onset for end-stage renal disease (the only systemic manifestation) ranges from 16 [@pmid:41000883]-70 [@genereviews:NBK153723].", + "age_onset_min": 16.0, + "age_onset_max": 70.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family [@genereviews:NBK535148]. NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif.", + "detection": "This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475]. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40–83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant [@pmid:41285770]. Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants [@genereviews:NBK153723]. Instead, they are commonly detected by a VNTR assay, or resolved with long-read sequencing [@genereviews:NBK153723; @pmid:29520014].", + "mechanism": "GoF", + "mechanism_detail": "Toxic protein product accumulates in kidneys [@genereviews:NBK153723]", + "year": "2013 [@pmid:23396133]", + "location_in_gene": "Coding Exon 2", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG"], + "pathogenic_motif_reference_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA"], + "benign_motif_reference_orientation": ["GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA"], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG"], + "benign_motif_gene_orientation": ["ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG"], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": null, + "pathogenic_max": null, + "motif_len": 1, + "ref_copies": null, + "novel": "ref", + "gard": ["7002"], + "genereviews": ["NBK153723"], + "malacard": ["TBL032"], + "medgen": ["358137"], + "mondo": ["0020726"], + "omim": ["174000"], + "orphanet": ["88949"], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:41000883", "genereviews:NBK153723", "genereviews:NBK535148", "pmid:23396133", "pmid:39781475", "doi:10.1101/2025.03.31.646505", "mondo:0020726"], + "additional_literature": ["pmid:41961547", "pmid:41832605", "pmid:41345522", "pmid:40244446", "pmid:39848530", "pmid:39576755", "pmid:39325540", "pmid:39314239", "pmid:38605207", "pmid:37547453", "pmid:37456840", "pmid:37316299", "pmid:35982790", "pmid:35497811", "pmid:34641504", "pmid:34452200", "pmid:33672244", "pmid:33001366", "pmid:32451462", "pmid:32293552", "pmid:31213370", "pmid:30593830", "pmid:29520014", "pmid:29328069", "pmid:29217307", "pmid:29156055", "pmid:29052568", "pmid:28581490", "pmid:28407289", "pmid:27957769", "pmid:27036738", "pmid:27367740", "pmid:27340743", "pmid:27157321", "pmid:26943180", "pmid:26838233", "pmid:26693201", "pmid:26692014", "pmid:26498650", "pmid:25753030", "pmid:24718884", "pmid:24509297", "pmid:24416403", "pmid:24246952", "pmid:24233342", "pmid:23778023", "pmid:23770070", "pmid:23652307", "pmid:23317217", "pmid:23259747", "pmid:22970023", "pmid:21998660", "pmid:21385452", "pmid:20876819", "pmid:20562098", "pmid:20470225", "pmid:21637607", "pmid:19811637", "pmid:19625949", "pmid:19534821", "pmid:18619437", "pmid:18094420", "pmid:18021186", "pmid:17974963", "pmid:17694298", "pmid:17581677", "pmid:17203187", "pmid:17050588", "pmid:16711252", "pmid:16631167", "pmid:16302687", "pmid:16101182", "pmid:15991935", "pmid:15944787", "pmid:15814824", "pmid:15729696", "pmid:15604091", "pmid:15387710", "pmid:15115750", "pmid:15041735", "pmid:14871854", "pmid:14707484", "pmid:12747745", "pmid:12646731", "pmid:12626424", "pmid:12090474", "pmid:11923240", "pmid:11445551", "pmid:11391628", "pmid:11358826", "pmid:11295060", "pmid:11169964", "pmid:10797294", "pmid:10741704", "pmid:10653872", "pmid:10652432", "pmid:10541345", "pmid:10430099", "pmid:10389761", "pmid:10383817", "pmid:10235488", "pmid:10206297", "pmid:10052816", "pmid:10024673", "pmid:10022471", "pmid:9935162", "pmid:9823312", "pmid:9755875", "pmid:9727561", "pmid:9690452", "pmid:9591045", "pmid:9579805", "pmid:9575675", "pmid:9551361", "pmid:9427605", "pmid:9419405", "pmid:8967520", "pmid:8643693", "pmid:7594478", "pmid:8579785", "pmid:8567787", "pmid:8519447", "pmid:7628867", "pmid:7816840", "pmid:7946402", "pmid:7514493", "pmid:7690213", "pmid:7685318"] +}, +{ + "id": "NME_NAXE", + "disease_id": "NME", + "gene": "NAXE", + "evidence": ["Limited"], + "chrom": "chr1", + "start_hg38": 156591765, + "stop_hg38": 156591783, + "start_hg19": 156561557, + "stop_hg19": 156561575, + "start_t2t": 155728131, + "stop_t2t": 155728159, + "disease": "NAXE-related mitochondrial encephalopathy", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Patients with NAXE-related mitochondrial encephalopathy exhibit developmental delay, cognitive regression, altered consciousness, abnormalities in eye movement (including nystagmus), muscle weakness, respiratory failure, seizure, ataxia, and gait disturbance at the age of 1 to 2 years. The disease is characterized by fluctuating symptoms over time, often exacerbated by febrile illness; it is progressive and fatal in the long term [@pmid:39455596].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Single proband found in Japanese cohort [@pmid:39455596].", + "age_onset": "Single repeat expansion case had onset at 13 months, while NAXE-related mitochondrial encephalopathy more generally has predominately infantile onset, extending to 20y or older [@pmid:39455596].", + "age_onset_min": 1.0, + "age_onset_max": 1.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (2-7) alleles established by 484 control alleles and validated with orthogonal databases, while single proband had expansion of ~200 repeats inherited from mother via uniparental disomy [@pmid:39455596]. While the repeat expansion is newly reported, other variants in the NAXE gene have previously been associated with mitochondrial encephalopathy.", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Reduced NAXE expression from expansion in promoter; hypermethylation was detected at and downstream of the repeat sequence in the proband as well as the maternal copy of the expanded allele, which was not present in the maternal normal range allele nor in the controls [@pmid:39455596]", + "year": "2024 [@pmid:39455596]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGGCC"], + "pathogenic_motif_reference_orientation": ["GGGCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCGGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 7, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 200, + "pathogenic_max": 200, + "motif_len": 5, + "ref_copies": null, + "novel": "ref", + "gard": ["17991"], + "genereviews": [], + "malacard": ["ENC069"], + "medgen": ["934642"], + "mondo": ["0020781"], + "omim": ["617186"], + "orphanet": ["555407"], + "gnomad": ["NAXE"], + "stripy": [], + "tr_atlas": ["TR7952"], + "webstr_hg38": ["1184343", "6351240"], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:39455596"], + "additional_literature": ["pmid:41091881"] +}, +{ + "id": "ALS1_NIPA1", + "disease_id": "ALS1", + "gene": "NIPA1", + "evidence": ["Disputed"], + "chrom": "chr15", + "start_hg38": 22786677, + "stop_hg38": 22786703, + "start_hg19": 23086363, + "stop_hg19": 23086389, + "start_t2t": 20458510, + "stop_t2t": 20458536, + "disease": "Amyotrophic lateral sclerosis", + "inheritance": ["AD"], + "association_type": ["Modifier"], + "disease_description": "Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life [@omim:105400].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "2.7-7.4/100,000 for all cases of ALS, NIPA1 + C9orf72 is 0.37% of ALS patients; frequency of NIPA1 expansion in controls is 3.74% [@pmid:31286297]. The NIPA1 expansion is associated with disease globally [@pmid:30342764], but likely unassociated in African probands [@pmid:34179866].", + "age_onset": "Typical: 44-60 [@pmid:26777436]; Range: 25 [@pmid:22378146] - 77 [@pmid:26777436].", + "age_onset_min": 25.0, + "age_onset_max": 77.0, + "typ_age_onset_min": 44.0, + "typ_age_onset_max": 60.0, + "details": "Allelic ranges taken from STRipy based on primary literature [@stripy:NIPA1]. Currently proposed as a modifier for ALS [@pmid:31286297]. Note: the motif for this locus is CGG in hg38 and T2T reference genomes, while in hg19, the motif is the reverse complement CCG because it is on the negative strand. GCA, GCT, and GCC interruptions have been reported [@pmid:40585427].", + "detection": null, + "mechanism": null, + "mechanism_detail": null, + "year": "2019 [@pmid:30342764]", + "location_in_gene": "Coding Exon 1/Intron 1 depending on transcript", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCG"], + "pathogenic_motif_reference_orientation": ["GCG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["GCA", "GCT", "GCC"], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AGC", "CTG", "CCG"], + "locus_structure": [], + "benign_min": 6, + "benign_max": 10, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 11, + "pathogenic_max": 56, + "motif_len": 3, + "ref_copies": 10.7, + "novel": "ref", + "gard": ["5786"], + "genereviews": [], + "malacard": ["FRN044"], + "medgen": ["400169"], + "mondo": ["0007103"], + "omim": ["105400"], + "orphanet": ["282", "803"], + "gnomad": ["NIPA1"], + "stripy": ["NIPA1"], + "tr_atlas": ["TR133649"], + "webstr_hg38": ["5135087"], + "webstr_hg19": [], + "locus_tags": ["proposed_modifier"], + "disease_tags": [], + "references": ["pmid:26777436", "pmid:22378146", "stripy:NIPA1", "pmid:31286297", "pmid:40585427", "pmid:30342764", "pmid:34179866", "omim:105400"], + "additional_literature": ["pmid:41426430", "pmid:38667292", "pmid:37043475", "pmid:35869263", "pmid:33414559", "pmid:32954321", "pmid:24866401", "pmid:21419568", "pmid:11839840", "pmid:10987648", "pmid:9736780"] +}, +{ + "id": "SCA36_NOP56", + "disease_id": "SCA36", + "gene": "NOP56", + "evidence": ["Definitive"], + "chrom": "chr20", + "start_hg38": 2652732, + "stop_hg38": 2652757, + "start_hg19": 2633378, + "stop_hg19": 2633403, + "start_t2t": 2683189, + "stop_t2t": 2683230, + "disease": "Spinocerebellar ataxia type 36", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 36 (SCA36) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1) characterized by gait and limb ataxia, lower limb spasticity, dysarthria, muscle fasciculations, tongue atrophy and hyperreflexia [@mondo:0013594].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Western Japan: 3.6% of all SCA; Costa da Morte region of Spain: 6.3% of all SCA [@pmid:37332636]; US: 0.7% of large undiagnosed ataxia cohort [@pmid:28761930]. Found across ancestries/ethnicities [@omim:614153].", + "age_onset": "Typical: 40-60 [@pmid:25101480]; Range: 28 [@pmid:37810464] - 67 [@pmid:37332636].", + "age_onset_min": 28.0, + "age_onset_max": 67.0, + "typ_age_onset_min": 40.0, + "typ_age_onset_max": 60.0, + "details": "Benign alleles range from 3-14 repeats and pathogenic alleles (650+ repeats) appear fully penetrant; the significance of intermediate alleles has yet to be elucidated [@pmid:25101480]. Interruptions documented: GGCTG, GGCCCTG, GGCCG, and GGCCTTG [@pmid:37051597].", + "detection": "RP-PCR with fragment analysis has been used to detect these expansions [@pmid:21683323]. Long-read sequencing has accurately sized alleles [@pmid:37051597].", + "mechanism": "GoF", + "mechanism_detail": "Toxic protein gain-of-function, RAN translation [@omim:614153].", + "year": "2011 [@pmid:21683323]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGCCTG"], + "pathogenic_motif_reference_orientation": ["GGCCTG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["GGCTG", "GGCCCTG", "GGCCG", "GGCCTT"], + "pathogenic_motif_gene_orientation": ["CCTGGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["CTGGG", "CCCTGGG", "CCGGG", "CCTTGG"], + "locus_structure": [ { - "id": "OPDM2_GIPC1", - "disease_id": "OPDM2", - "gene": "GIPC1", - "evidence": [ - "Definitive" - ], - "chrom": "chr19", - "start_hg38": 14496041, - "stop_hg38": 14496075, - "start_hg19": 14606853, - "stop_hg19": 14606887, - "start_t2t": 14622655, - "stop_t2t": 14622692, - "disease": "Oculopharyngodistal myopathy type 2", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750]; Slowly progressive distal weakness, ophthalmoplegia, facial and bulbar weakness [@pmid:39349043]. Two probands presented with ataxia and mild cognitive impairment [@pmid:41975469].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Population dependent; presumed rare. Predominantly found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 20-34 [@pmid:32413282]; Range: 2 [@pmid:41975469] - 70 [@pmid:33374016].", - "age_onset_min": 2, - "age_onset_max": 70, - "typ_age_onset_min": 20, - "typ_age_onset_max": 34, - "details": "Benign repeats range from absent [@gnomad:GIPC1] to 32 [@genereviews:NBK535148], while pathogenic alleles range from 73-164 repeats [@pmid:38876750; @genereviews:NBK535148]. Findings suggest that alternative initiation sites and an upstream CTG codon serve as the initiation site for RAN translation [@pmid:41121761]. Intermediate alleles have undetermined significance but may represent a phenotypic spectrum [@pmid:32413282]. Interruptions documented: CGA [@pmid:35245110]. Interruptions proposed but not confirmed in primary literature: TCG/CCT/TTG [@pmid:38467784]. One proband with ataxia and repeat size 11/112 had an asymptomatic father with 650 repeats and higher methylation [@pmid:41975469].", - "detection": "Short-read WGS or exome sequencing have been reported to be inaccurate in detecting these expansions [@pmid:32413282]. RP-PCR has detected most repeats, while long-read sequencing accurately resolved size and structure [@pmid:32413282].", - "mechanism": "LoF/GoF?", - "mechanism_detail": "Findings suggest that the mechanism is likely not LoF, but the mechanism is otherwise unknown [@pmid:41121761]. This expansion appears to be predominantly RAN translated into a toxic protein [@pmid:41121761]. This protein has been reported to impair cell proliferation, induce cytotoxicity and apoptosis in multiple cell lines, and caused phenotypic defects in a zebrafish model [@pmid:41121761].", - "year": "2020 [@pmid:32413282]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CCG" - ], - "pathogenic_motif_reference_orientation": [ - "CCG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 0, - "benign_max": 32, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 73, - "pathogenic_max": 164, - "motif_len": 3, - "ref_copies": 14.7, - "novel": "ref", - "gard": [ - "16397" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "OCL080" - ], - "medgen": [ - "1718769" - ], - "mondo": [ - "0030134" - ], - "omim": [ - "618940" - ], - "orphanet": [], - "gnomad": [ - "GIPC1" - ], - "stripy": [ - "GIPC1" - ], - "tr_atlas": [ - "TR154638" - ], - "webstr_hg38": [ - "5626440" - ], - "webstr_hg19": [ - "STR_668861" - ], - "locus_tags": [ - "length_affects_onset", - "length_affects_severity" - ], - "disease_tags": [ - "oculopharyngodistal_myopathy", - "ataxia" - ], - "references": [ - "pmid:32413282", - "pmid:41975469", - "pmid:33374016", - "pmid:41121761", - "gnomad:GIPC1", - "genereviews:NBK535148", - "pmid:38876750", - "pmid:35245110", - "pmid:38467784", - "pmid:39349043" - ], - "additional_literature": [ - "pmid:42057638", - "pmid:41888971", - "pmid:41792844", - "pmid:41555317", - "pmid:40645757", - "pmid:40084170", - "pmid:39936620", - "pmid:39492694", - "pmid:39418922", - "pmid:39013564", - "pmid:38871700", - "pmid:37923380", - "pmid:37550168", - "pmid:36108428", - "pmid:36055118", - "pmid:35700120", - "pmid:35521937", - "pmid:35314910", - "pmid:35152460", - "pmid:35148830", - "pmid:34927285", - "pmid:33693509", - "pmid:33239111", - "pmid:22521844" - ] + "motif": "GGCCTG", + "count": null, + "type": "pathogenic_repeat" }, { - "id": "GDPAG_GLS", - "disease_id": "GDPAG", - "gene": "GLS", - "evidence": [ - "Definitive" - ], - "chrom": "chr2", - "start_hg38": 190880872, - "stop_hg38": 190880920, - "start_hg19": 191745598, - "stop_hg19": 191745646, - "start_t2t": 191369982, - "stop_t2t": 191370024, - "disease": "Glutaminase deficiency", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Glutaminase deficiency is characterized by refractory seizures, respiratory failure, brain abnormalities and death in the neonatal period, though milder cases with spastic ataxia-dysarthria have also been reported. This condition is caused by mutations in the glutaminase (GLS) gene [@mondo:0600001].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "As of 2019, only 7 cases total of GLS deficiency, including non-repeat. Identified unrelated patients have been Canadian [@pmid:30970188], Kurdish (Turkey) [@pmid:35913761], and US-American (Northern European/Native American descent) [@pmid:35913761].", - "age_onset": "Early childhood (2-4) [@pmid:30970188; @pmid:35913761].", - "age_onset_min": 2, - "age_onset_max": 4, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Pathogenic range from 3 unrelated probands; benign range inferred from mutation data [@genereviews:NBK535148]. Disease cases can be caused by homozygosity or compound heterozygotes [@omim:618412].", - "detection": "Exome sequencing does not reliably detect these expansions. Short-read sequencing has flagged expanded alleles while RP-PCR has confirmed them. Complex alleles may require optical genome mapping or long-read sequencing to resolve size and structure [@pmid:30970188; @pmid:35913761].", - "mechanism": "LoF", - "mechanism_detail": "Change in histone modification decreases transcription [@omim:618412].", - "year": "2019 [@pmid:30970188]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCA" - ], - "pathogenic_motif_reference_orientation": [ - "GCA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 38, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 680, - "pathogenic_max": 1500, - "motif_len": 3, - "ref_copies": 16, - "novel": "ref", - "gard": [], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "SPS235" - ], - "medgen": [ - "987241" - ], - "mondo": [ - "0600001" - ], - "omim": [ - "618412" - ], - "orphanet": [ - "557056" - ], - "gnomad": [ - "GLS" - ], - "stripy": [ - "GLS" - ], - "tr_atlas": [ - "TR24838" - ], - "webstr_hg38": [ - "333878", - "5494902" - ], - "webstr_hg19": [ - "STR_803303" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:30970188", - "pmid:35913761", - "omim:618412", - "genereviews:NBK535148", - "mondo:0600001" - ], - "additional_literature": [ - "pmid:41501457", - "pmid:40488180", - "pmid:40417743", - "pmid:39699045", - "pmid:39651202", - "pmid:38877099", - "pmid:38871700", - "pmid:38260514", - "pmid:34285061", - "pmid:34013182", - "pmid:33691262", - "pmid:33413375", - "pmid:14510958", - "pmid:7729621" - ] - }, + "motif": "CGCCTG", + "count": 3, + "type": "flank_repeat" + }], + "benign_min": 3, + "benign_max": 14, + "intermediate_min": 15, + "intermediate_max": 649, + "pathogenic_min": 650, + "pathogenic_max": 2500, + "motif_len": 6, + "ref_copies": 7.2, + "novel": "ref", + "gard": ["12367"], + "genereviews": ["NBK535148"], + "malacard": ["SPN265"], + "medgen": ["483339"], + "mondo": ["0013594"], + "omim": ["614153"], + "orphanet": ["276198"], + "gnomad": ["NOP56"], + "stripy": ["NOP56"], + "tr_atlas": ["TR157810", "TR157811"], + "webstr_hg38": ["6177296", "890490"], + "webstr_hg19": ["STR_833720"], + "locus_tags": ["somatic_instability", "length_affects_onset", "length_affects_severity"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["pmid:25101480", "pmid:37810464", "pmid:37332636", "omim:614153", "pmid:37051597", "pmid:28761930", "pmid:21683323", "mondo:0013594"], + "additional_literature": ["pmid:42038259", "pmid:41337098", "pmid:41074692", "pmid:40898875", "pmid:40765612", "pmid:40488180", "pmid:40015643", "pmid:40004498", "pmid:38961870", "pmid:38934198", "pmid:38811808", "pmid:38667292", "pmid:38227102", "pmid:36599645", "pmid:36572080", "pmid:36530930", "pmid:35599735", "pmid:35077744", "pmid:34179866", "pmid:33705846", "pmid:32989102", "pmid:32407596", "pmid:32375063", "pmid:32375043", "pmid:32270466", "pmid:31737797", "pmid:30610877", "pmid:30109267", "pmid:29316893", "pmid:29281254", "pmid:28918022", "pmid:27123487", "pmid:26661328", "pmid:25476002", "pmid:24985895", "pmid:24269018", "pmid:22744658", "pmid:22492559"] +}, +{ + "id": "NIID_NOTCH2NLC", + "disease_id": "NIID", + "gene": "NOTCH2NLC", + "evidence": ["Definitive"], + "chrom": "chr1", + "start_hg38": 149390802, + "stop_hg38": 149390842, + "start_hg19": 145209323, + "stop_hg19": 145209354, + "start_t2t": 148519695, + "stop_t2t": 148519738, + "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which can precede neurologic manifestations by decades in one documented case [pmid:41929501]. Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms [@pmid:42058219; @pmid:42005169]. Subclinical peripheral neuropathy has been reported in NOTCH2NLC-related NIID [@pmid:42001002]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.", + "hpo_terms": [], + "prevalence": null, + "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 30-70 [@omim:603472]; Range: 10 [@pmid:37090934] - 78 [@pmid:37305750].", + "age_onset_min": 10.0, + "age_onset_max": 78.0, + "typ_age_onset_min": 30.0, + "typ_age_onset_max": 70.0, + "details": "Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats [@genereviews:NBK535148]. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype [@pmid:39055960; @pmid:39496005]: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders [@pmid:31178126]. Age of onset inversely related to allele size [@pmid:38377026]. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype [@pmid:34718964]. Interruptions documented: GGA, GGG [@pmid:35245110]; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed [@pmid:38467784]. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.", + "detection": "Short-read sequencing is reported to be unreliable for sizing of large or complex expansions [@pmid:34034831]. RP-PCR has screened for expansions [@pmid:37371433], while long-read sequencing has resolved size, structure, and methylation [@pmid:34774111].", + "mechanism": "GoF", + "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation [@pmid:42058219]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@pmid:39920690]. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported [@pmid:41539185]. Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression [@pmid:41942455].", + "year": "2019 [@pmid:31332380]", + "location_in_gene": "5' UTR", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGC"], + "pathogenic_motif_reference_orientation": ["GGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["GGA", "AGC"], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AGG", "AGC"], + "locus_structure": [], + "benign_min": 7, + "benign_max": 37, + "intermediate_min": 38, + "intermediate_max": 65, + "pathogenic_min": 66, + "pathogenic_max": 517, + "motif_len": 3, + "ref_copies": 13.3, + "novel": "ref", + "gard": ["3971"], + "genereviews": ["NBK535148"], + "malacard": ["NRN008"], + "medgen": ["355075"], + "mondo": ["0011327"], + "omim": ["603472", "619473"], + "orphanet": ["2289"], + "gnomad": ["NOTCH2NLC"], + "stripy": ["NOTCH2NLC"], + "tr_atlas": ["TR7525"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": ["somatic_instability", "paternal_expansion", "length_affects_onset", "length_affects_phenotype", "motif_affects_onset", "motif_affects_phenotype"], + "disease_tags": ["phenotypic_spectrum"], + "references": ["omim:603472", "pmid:37090934", "pmid:37305750", "pmid:36169768", "pmid:38467784", "pmid:42058219", "doi:10.1186/s12964-025-02079-1", "pmid:41539185", "pmid:41942455", "genereviews:NBK535148", "pmid:39055960", "pmid:39496005", "pmid:31178126", "pmid:38377026", "pmid:34718964", "pmid:35245110", "pmid:37371433", "pmid:38876750", "pmid:31332380", "mondo:0011327", "pmid:41929501", "pmid:42005169"], + "additional_literature": ["pmid:42058219", "pmid:42033810", "pmid:42021030", "pmid:42015293", "pmid:42005169", "pmid:41964975", "pmid:41942455", "pmid:41929501", "pmid:41888971", "pmid:41882342", "pmid:41862851", "pmid:41792844", "pmid:41762523", "pmid:41756172", "pmid:41731582", "pmid:41688968", "pmid:41634634", "pmid:41556371", "pmid:41526374", "pmid:41235412", "pmid:41154122", "pmid:41074692", "pmid:40934004", "pmid:40879637", "pmid:40765612", "pmid:40708231", "pmid:40645757", "pmid:40635536", "pmid:40609325", "pmid:40517194", "pmid:40515658", "pmid:40514451", "pmid:40267536", "pmid:40084170", "pmid:39936620", "pmid:39920690", "pmid:39609868", "pmid:39529621", "pmid:39505310", "pmid:39492694", "pmid:39418922", "pmid:39167540", "pmid:39078482", "pmid:38779172", "pmid:38667292", "pmid:38579412", "pmid:38477063", "pmid:38288273", "pmid:38145851", "pmid:37975799", "pmid:37923380", "pmid:37864208", "pmid:37823700", "pmid:37644522", "pmid:37365282", "pmid:37271829", "pmid:37237429", "pmid:37184590", "pmid:37131242", "pmid:37001413", "pmid:36948577", "pmid:36942588", "pmid:36825461", "pmid:36823368", "pmid:36809423", "pmid:36715780", "pmid:36672065", "pmid:36621630", "pmid:36588885", "pmid:36570826", "pmid:36545534", "pmid:36483830", "pmid:36458450", "pmid:36417528", "pmid:36263606", "pmid:36216675", "pmid:36207023", "pmid:36191230", "pmid:36172483", "pmid:36150977", "pmid:36086903", "pmid:36061987", "pmid:36041634", "pmid:36033605", "pmid:35974122", "pmid:35866887", "pmid:35857137", "pmid:35838850", "pmid:35788208", "pmid:35772299", "pmid:35700120", "pmid:35419641", "pmid:35411397", "pmid:35402653", "pmid:35366689", "pmid:35314910", "pmid:35297556", "pmid:35180462", "pmid:35152460", "pmid:35148830", "pmid:35147270", "pmid:34927285", "pmid:34797461", "pmid:34774111", "pmid:34750918", "pmid:34694469", "pmid:34675106", "pmid:34641814", "pmid:34392981", "pmid:34306035", "pmid:34243731", "pmid:34054431", "pmid:34017298", "pmid:33943039", "pmid:33887199", "pmid:33871559", "pmid:33871549", "pmid:33766934", "pmid:33693509", "pmid:33679585", "pmid:33626493", "pmid:33625684", "pmid:33388663", "pmid:33377220", "pmid:33377207", "pmid:33239111", "pmid:33201994", "pmid:33201988", "pmid:33146692", "pmid:33146671", "pmid:33026126", "pmid:33016348", "pmid:32989102", "pmid:32931575", "pmid:32852534", "pmid:32827029", "pmid:32817896", "pmid:32777174", "pmid:32768149", "pmid:32602554", "pmid:32535679", "pmid:32516806", "pmid:32495371", "pmid:32449905", "pmid:32268889", "pmid:32250060", "pmid:32081467", "pmid:32039647", "pmid:31886491", "pmid:31819945", "pmid:31433517", "pmid:31413119", "pmid:31332381"] +}, +{ + "id": "OPML1_NUTM2B-AS1", + "disease_id": "OPML1", + "gene": "NUTM2B-AS1", + "evidence": ["Moderate"], + "chrom": "chr10", + "start_hg38": 79826383, + "stop_hg38": 79826404, + "start_hg19": 81586139, + "stop_hg19": 81586160, + "start_t2t": 80695718, + "stop_t2t": 80695748, + "disease": "Oculopharyngeal myopathy with leukoencephalopathy 1", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Oculopharyngodistal myopathy and white matter abnormalities [@pmid:38876750]; Ptosis, ophthalmoplegia, dysphagia, dysarthria [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Rare, found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "15-40 (only characterized in one family) [@pmid:31332380].", + "age_onset_min": 15.0, + "age_onset_max": 40.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (3-16 repeats) established in 1000 controls, studied alongside pathogenic probands of up to 700 repeats [@pmid:31332380]. Pathogenicity occurs at repeats as short as 161 motifs [@pmid:38159879; @pmid:37923380], while intermediate alleles may correlate to milder phenotypes [@pmid:38159879]. Alt transcript in opposite direction: LOC642361.", + "detection": "RP-PCR has effectively detected these expansions [@pmid:39308795], while long-read sequencing has resolved size and structure [@pmid:38159879].", + "mechanism": "GoF?", + "mechanism_detail": "RNA mediated toxicity hypothesized, overall mechanism unknown [@omim:618637; @pmid:36169768].", + "year": "2019 [@pmid:31332380]", + "location_in_gene": "Exon 1 of lncRNA (noncoding)", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGC"], + "pathogenic_motif_reference_orientation": ["GGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 3, + "benign_max": 16, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 161, + "pathogenic_max": 700, + "motif_len": 3, + "ref_copies": 7.0, + "novel": "ref", + "gard": [], + "genereviews": ["NBK535148"], + "malacard": ["OCL077"], + "medgen": ["1684701"], + "mondo": ["0032843"], + "omim": ["618637"], + "orphanet": [], + "gnomad": ["NUTM2B-AS1"], + "stripy": ["NUTM2B-AS1"], + "tr_atlas": ["TR102881"], + "webstr_hg38": [], + "webstr_hg19": ["STR_173942"], + "locus_tags": ["length_affects_severity", "length_affects_phenotype"], + "disease_tags": [], + "references": ["pmid:31332380", "omim:618637", "pmid:36169768", "pmid:38159879", "pmid:37923380", "pmid:38876750", "pmid:39349043"], + "additional_literature": ["pmid:40645757", "pmid:39308795", "pmid:39176128", "pmid:35152460"] +}, +{ + "id": "OPMD_PABPN1", + "disease_id": "OPMD", + "gene": "PABPN1", + "evidence": ["Definitive"], + "chrom": "chr14", + "start_hg38": 23321472, + "stop_hg38": 23321503, + "start_hg19": 23790681, + "stop_hg19": 23790712, + "start_t2t": 17522488, + "stop_t2t": 17522519, + "disease": "Oculopharyngeal muscular dystrophy", + "inheritance": ["AD", "AR"], + "association_type": ["Mendelian"], + "disease_description": "OPMD is a late-onset neuromuscular disease, characterized by ptosis, dysphagia, and general facial weakness [@omim:164300; @pmid:39349043; @pmid:38876750]. Proximal limb weakness commonly develops later in the disease course [@pmid:42157275].", + "hpo_terms": null, + "prevalence": "1/100000", + "prevalence_details": "1/100,000 (population specific) [@pmid:29100084]. Frequency of (GCN)11 alleles is 1-2% of North America/Europe/Japan [@genereviews:NBK1126]. Disease is significantly enriched in individuals of Jewish Bukharian descent[@pmid:42157275]. Disease is found worldwide, in more than 30 countries [@genereviews:NBK1126].", + "age_onset": "Typical: 40-59 [@pmid:37519616]; Range: 20-79 [@pmid:35112761].", + "age_onset_min": 20.0, + "age_onset_max": 79.0, + "typ_age_onset_min": 40.0, + "typ_age_onset_max": 59.0, + "details": "Disease is caused by a GCN polyalanine expansion in the first exon of PABPN1. Most known patients have (GCG)+, but GCN (any polyalanine) may be pathogenic [@genereviews:NBK1126]. This locus is heterozygous in ~90% of cases (autosomal dominant inheritance), while expansions are biallelic in ~10% of cases (consistent with autosomal recessive inheritance). Disease is generally more severe in cases with two expanded alleles. Age of onset is inverse to allele size, while penetrance and severity increase with allele size [@genereviews:NBK1126]. Mild, late-onset disease can occur in individuals with a (GCN)10(GCN)11 genotype, suggesting variable penetrance [@pmid:28011929]. The definition of this locus differs in the literature with prior work counting exact GCG motifs for a benign size of (GCG)6 [@pmid:9462747], while later resources count GCNs (any alanine codon), widening the region by 4 motifs to a benign size of (GCN)10 [@genereviews:NBK1126; @pmid:39349043]. STRchive is using the GCN definition.", + "detection": "Flanking PCR with fragment analysis has accurately detected expansions [@pmid:27980005]. Heterozygous expansions have been sized by Sanger sequencing. Biallelic expanded variants were assessed using short-read sequencing or PCR fragment analysis.", + "mechanism": "GoF/LoF", + "mechanism_detail": "Polyalanine expansions leading to cellular toxicity (loss of function) as well as abnormal aggregation and inefficient protein degradation, which may impact mRNA processing [@genereviews:NBK1126].", + "year": "1998 [@pmid:9462747]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 10, + "intermediate_min": 11, + "intermediate_max": 11, + "pathogenic_min": 12, + "pathogenic_max": 18, + "motif_len": 3, + "ref_copies": 7.0, + "novel": "ref", + "gard": ["7245"], + "genereviews": ["NBK1126"], + "malacard": ["OCL088"], + "medgen": ["1054618"], + "mondo": ["0958176"], + "omim": ["164300"], + "orphanet": ["270"], + "gnomad": ["PABPN1"], + "stripy": ["PABPN1"], + "tr_atlas": ["TR128439"], + "webstr_hg38": ["1442709", "5271481"], + "webstr_hg19": ["Expansion_OPMD/PAPBN1"], + "locus_tags": ["length_affects_onset", "length_affects_severity"], + "disease_tags": [], + "references": ["pmid:37519616", "pmid:35112761", "genereviews:NBK1126", "pmid:28011929", "pmid:9462747", "pmid:39349043", "pmid:29100084", "omim:164300", "pmid:38876750"], + "additional_literature": ["pmid:42196324", "pmid:42157275", "pmid:41764774", "pmid:41676387", "pmid:41587185", "pmid:40594369", "pmid:40552959", "pmid:40220918", "pmid:39113268", "pmid:38165364", "pmid:37698929", "pmid:37559347", "pmid:36790141", "pmid:35859342", "pmid:34927285", "pmid:34225694", "pmid:34047774", "pmid:31294444", "pmid:30455479", "pmid:28361972", "pmid:27980005", "pmid:26428746", "pmid:23793615", "pmid:23399899", "pmid:22519734", "pmid:21742497", "pmid:21647273", "pmid:21602480", "pmid:21316245", "pmid:19641605", "pmid:19101703", "pmid:18481858", "pmid:18367172", "pmid:18343218", "pmid:17138075", "pmid:16648376", "pmid:16642034", "pmid:16481821", "pmid:16378590", "pmid:16239242", "pmid:15811916", "pmid:15755680", "pmid:15725589", "pmid:15645184", "pmid:14627730", "pmid:12673802", "pmid:11712939", "pmid:11304042", "pmid:11222452", "pmid:11150975", "pmid:11087766", "pmid:11003790", "pmid:10734263", "pmid:10680791", "pmid:9084936"] +}, +{ + "id": "CCHS_PHOX2B", + "disease_id": "CCHS", + "gene": "PHOX2B", + "evidence": ["Definitive"], + "chrom": "chr4", + "start_hg38": 41745972, + "stop_hg38": 41746032, + "start_hg19": 41747989, + "stop_hg19": 41748049, + "start_t2t": 41719745, + "stop_t2t": 41719805, + "disease": "Congenital central hypoventilation syndrome", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of the PHOX-2B gene is found in 90% of the patients. Association with Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026]. Hyperinsulinism has been observed in patients [@pmid:41531556].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Incidence is 1:148000-200000 births (Estimated, may include mild/undiagnosed or be overestimated globally) [@genereviews:NBK1427]. Rare, but reported worldwide [@pmid:15121777].", + "age_onset": "Typical: 0-2 [@genereviews:NBK1427; @pmid:15121777]; Range: 0-36 [@pmid:16873766].", + "age_onset_min": 0.0, + "age_onset_max": 36.0, + "typ_age_onset_min": 0.0, + "typ_age_onset_max": 2.0, + "details": "Alleles of 24 repeats (and sometimes 25 repeats) correspond to delayed disease onset and/or milder phenotype; alleles above benign range (9-20 repeats) and below the pathogenic range (26-33 repeats) have uncertain significance [@genereviews:NBK1427].", + "detection": "Short-read sequencing and exome sequencing are reportedly unable to accurately detect these expansions. Fragment analysis is the standard detection method, while Sanger sequencing determines the exact repeat size [@genereviews:NBK1427].", + "mechanism": "LoF/GoF", + "mechanism_detail": "Polyalanine expansion leading to loss or gain of function, dependent on altered protein product [@pmid:38467784; @genereviews:NBK1427]. Correlation between length and reduced transcriptional activity [@pmid:15888479].", + "year": "2003 [@pmid:12640453]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 9, + "benign_max": 20, + "intermediate_min": 21, + "intermediate_max": 25, + "pathogenic_min": 26, + "pathogenic_max": 33, + "motif_len": 3, + "ref_copies": 15.7, + "novel": "ref", + "gard": ["8535"], + "genereviews": ["NBK1427"], + "malacard": ["CNT119"], + "medgen": ["1794285"], + "mondo": ["0800026"], + "omim": ["209880"], + "orphanet": ["661"], + "gnomad": ["PHOX2B"], + "stripy": ["PHOX2B"], + "tr_atlas": ["TR42548"], + "webstr_hg38": ["4725362"], + "webstr_hg19": ["Expansion_CCHS/PHOX2B"], + "locus_tags": ["length_affects_onset", "length_affects_severity"], + "disease_tags": [], + "references": ["genereviews:NBK1427", "pmid:15121777", "pmid:16873766", "pmid:38467784", "pmid:15888479", "pmid:12640453", "mondo:0800026", "pmid:41531556"], + "additional_literature": ["pmid:41420984", "pmid:41188450", "pmid:38467313", "pmid:38454954", "pmid:38431667", "pmid:38001308", "pmid:36394266", "pmid:35421844", "pmid:34626313", "pmid:34012823", "pmid:33958749", "pmid:33855005", "pmid:33047879", "pmid:32822965", "pmid:31950261", "pmid:30786110", "pmid:30672101", "pmid:30227298", "pmid:29058474", "pmid:28992836", "pmid:27485184", "pmid:27129232", "pmid:26378991", "pmid:26375764", "pmid:26063465", "pmid:26011159", "pmid:25975378", "pmid:25085640", "pmid:24442913", "pmid:24135798", "pmid:23460545", "pmid:23460419", "pmid:23103552", "pmid:23045564", "pmid:22922260", "pmid:22829249", "pmid:22821709", "pmid:22437207", "pmid:22278185", "pmid:22125732", "pmid:21373876", "pmid:20236122", "pmid:19881470", "pmid:19608868", "pmid:18798833", "pmid:18157832", "pmid:17928950", "pmid:17909190", "pmid:17045833", "pmid:16888290", "pmid:16258163", "pmid:16249188"] +}, +{ + "id": "MRUPAV_PLIN4", + "disease_id": "MRUPAV", + "gene": "PLIN4", + "evidence": ["Moderate"], + "chrom": "chr19", + "start_hg38": 4510727, + "stop_hg38": 4513659, + "start_hg19": 4510739, + "stop_hg19": 4513671, + "start_t2t": 4494212, + "stop_t2t": 4497342, + "disease": "Myopathy with Rimmed Ubiquitin-Positive Autophagic Vacuolation, PLIN4-Related Myopathy", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Autosomal dominant myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV) is characterized by adult onset of slowly progressive skeletal muscle weakness variably affecting the distal or proximal lower limbs. Some patients may also have upper limb involvement or neck muscle weakness, but respiratory and bulbar involvement only rarely occurs. EMG studies show a myopathic process, and myotonia may also be observed [@omim:601846]. An early characterisation of the disease was reported in Blasi, et al. [@pmid:15236412].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Studied in patients of chinese ancestry and two families of spanish ancestry [@pmid:36151849; @pmid:40693562].", + "age_onset": "22-66 [@pmid:36151849; @pmid:37145156; @pmid:35499779; @pmid:40693562].", + "age_onset_min": 22.0, + "age_onset_max": 66.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "This is an expanded variable number tandem repeat (VNTR) in the PLIN4 gene, located in exon 3. This repeat consists of a 99 bp motif which encodes 33 amino-acids within the perilipin-4 protein [@pmid:32451610]. Expansions of this 99 bp motif lead to insertion of multiple imperfect 33–amino acid repeats. These repetitive sequences are thought to contribute to abnormal protein aggregation and dysregulated autophagy seen in affected muscle tissue [@omim:601846].", + "detection": "Short-read sequencing and exome sequencing are reported to not reliably detect this repeat. Long-range PCR is used for detection, while long-read sequencing is used to fully resolve size and structure [@pmid:32451610; @pmid:33811808].", + "mechanism": "GoF", + "mechanism_detail": "The present disease is characterized by dominantly inherited progressively increasing mobilization of aggrephagy at sites of progressive accumulation of a mutated protein, suggesting that the mutation is leading to aggregation, likely through misfolding, exceeding aggrephagic capacity [@pmid:32451610]", + "year": "2020 [@pmid:32451610]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "-", + "reference_motif_reference_orientation": ["TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC"], + "pathogenic_motif_reference_orientation": ["TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AAAGGAACCATCCAGACCGGCGTGGACACCAGTAAGACTGTCCTAACAGGTACCAAGGACACCGTCTGTAGTGGGGTGACTGGTGCCATGAATGTGGCC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 29, + "benign_max": 31, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 37, + "pathogenic_max": 50, + "motif_len": 99, + "ref_copies": 31.0, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": [], + "medgen": ["355637"], + "mondo": ["0011155"], + "omim": ["601846"], + "orphanet": ["696063"], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": ["anticipation", "length_affects_onset"], + "disease_tags": [], + "references": ["pmid:36151849", "pmid:37145156", "pmid:35499779", "pmid:40693562", "pmid:32451610", "omim:601846", "pmid:15236412"], + "additional_literature": ["pmid:39492694"] +}, +{ + "id": "CPEO_POLG", + "disease_id": "CPEO", + "gene": "POLG", + "evidence": ["Disputed"], + "chrom": "chr15", + "start_hg38": 89333588, + "stop_hg38": 89333629, + "start_hg19": 89876819, + "stop_hg19": 89876860, + "start_t2t": 87088411, + "stop_t2t": 87088452, + "disease": "Progressive external ophthalmoplegia, Parkinson's disease", + "inheritance": [], + "association_type": ["Mendelian", "Risk", "Modifier"], + "disease_description": "sensory ataxic neuropathy, dysarthria, and ophthalmoparesis [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Disease association unclear but largely studied in European cohorts/patients [@omim:258450; @omim:157640].", + "age_onset": "Typical: 57 [@pmid:20399836] - 59 [@pmid:20826197]; Range: 23-87 [@pmid:20399836].", + "age_onset_min": 23.0, + "age_onset_max": 87.0, + "typ_age_onset_min": 57.0, + "typ_age_onset_max": 59.0, + "details": "There is conflicting evidence for the association between this repeat expansion and Parkinson's risk [@pmid:20399836; @pmid:10196696; @pmid:22963882], as well as overall disease significance. May be predisposing factor in earlier age of onset in FRDA patients [@pmid:19043662].", + "detection": null, + "mechanism": null, + "mechanism_detail": null, + "year": null, + "location_in_gene": "Coding Exon 2", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCT"], + "pathogenic_motif_reference_orientation": ["GCT"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "aFTLD-U_GOLGA8A", - "disease_id": "aFTLD-U", - "gene": "GOLGA8A", - "evidence": [ - "Provisional" - ], - "chrom": "chr15", - "start_hg38": 34419425, - "stop_hg38": 34419451, - "start_hg19": 34711626, - "stop_hg19": 34711652, - "start_t2t": 32225152, - "stop_t2t": 32225178, - "disease": "Atypical frontotemporal lobar degeneration with ubiquitinated inclusions (aFTLD-U)", - "inheritance": [], - "association_type": [ - "Risk" - ], - "disease_description": "A rare subtype of Frontotemporal Lobar Degeneration with FET protein inclusions (FTLD-FET). Categorized clinically by behavioral variant frontotemporal dementia (bvFTD) with TAF15/FUS/EWSR1 positive inclusions. Associated with psychiatric symptoms and frontal/striatal atrophy [@pmid:41820575].", - "hpo_terms": [ - "HP:0002145 Frontotemporal dementia" - ], - "prevalence": null, - "prevalence_details": "FTLD-FET makes up ~5–10% of FTLD, and aFTLD-U is the most common FTLD-FET subtype. Prevalence estimates are challenging because diagnosis typically requires neuropathology at autopsy. Risk haplotypes are enriched in Amish and non-Finnish europeans [@pmid:41820575].", - "age_onset": "Typical: 34-55; Range: 21-72 [@pmid:41820575].", - "age_onset_min": 21, - "age_onset_max": 72, - "typ_age_onset_min": 34, - "typ_age_onset_max": 55, - "details": "Variation in repeat length, motif length, and motif sequence, with long CT-dimer expansions strongly associated with aFTLD-U risk. CCTT and CCCTCT motif expansions have been observed in unaffected individuals. CCCCT repeats were present in one aFTLD-U case. Proposed risk-associated expansions are typically >450 bp with >80% CT content and/or contain >190 CT dimers, though unaffected carriers have also been observed. Although the functional consequence of this repeat remains unknown, its presence in nearly 60% of aFTLD-U cases points to a major role in disease pathogenesis [@pmid:41820575].", - "detection": null, - "mechanism": "Unknown [@pmid:41820575].", - "mechanism_detail": null, - "year": "2026 [@pmid:41820575]", - "location_in_gene": null, - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "TTTC" - ], - "pathogenic_motif_reference_orientation": [ - "CT" - ], - "benign_motif_reference_orientation": [ - "CCTT", - "CCCTCT" - ], - "unknown_motif_reference_orientation": [ - "CCCCT" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AG" - ], - "benign_motif_gene_orientation": [ - "AAGG", - "AGAGGG" - ], - "unknown_motif_gene_orientation": [ - "AGGGG" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "CT", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 190, - "pathogenic_max": 600, - "motif_len": 2, - "ref_copies": 6.75, - "novel": "novel", - "gard": [ - "8436" - ], - "genereviews": [], - "malacard": [ - "FRN066" - ], - "medgen": [ - "83266" - ], - "mondo": [], - "omim": [ - "616180" - ], - "orphanet": [], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [ - "STR_459855" - ], - "locus_tags": [ - "somatic_instability" - ], - "disease_tags": [], - "references": [ - "pmid:41820575" - ], - "additional_literature": [] + "motif": "GCT", + "count": 2, + "type": "flank_repeat" }, { - "id": "HFG_HOXA13-I", - "disease_id": "HFG-I", - "gene": "HOXA13", - "evidence": [ - "Limited" - ], - "chrom": "chr7", - "start_hg38": 27199924, - "stop_hg38": 27199966, - "start_hg19": 27239543, - "stop_hg19": 27239585, - "start_t2t": 27335912, - "stop_t2t": 27335954, - "disease": "Hand-foot-genital syndrome 1", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", - "detection": "PCR amplification of tract I, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short-read sequencing may miss expanded repeats [@genereviews:NBK1423].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", - "year": "2004 [@pmid:15385446]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 14, - "benign_max": 14, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 22, - "motif_len": 3, - "ref_copies": 14, - "novel": "ref", - "gard": [ - "2594" - ], - "genereviews": [ - "NBK1423" - ], - "malacard": [ - "HND004" - ], - "medgen": [ - "331103" - ], - "mondo": [ - "0007698" - ], - "omim": [ - "140000" - ], - "orphanet": [ - "2438" - ], - "gnomad": [ - "HOXA13_1" - ], - "stripy": [ - "HOXA13_1" - ], - "tr_atlas": [ - "TR74138" - ], - "webstr_hg38": [ - "5679832" - ], - "webstr_hg19": [ - "STR_1311037" - ], - "locus_tags": [], - "disease_tags": [ - "hand_foot_genital_syndrome" - ], - "references": [ - "genereviews:NBK1423", - "pmid:15385446", - "pmid:17935235", - "mondo:0007698" - ], - "additional_literature": [ - "pmid:32386547", - "pmid:23532960", - "pmid:19591980", - "pmid:12414828", - "pmid:11543619" - ] + "motif": "GTT", + "count": 1, + "type": "flank_repeat" }, { - "id": "HFG_HOXA13-II", - "disease_id": "HFG-II", - "gene": "HOXA13", - "evidence": [ - "Limited" - ], - "chrom": "chr7", - "start_hg38": 27199825, - "stop_hg38": 27199861, - "start_hg19": 27239444, - "stop_hg19": 27239480, - "start_t2t": 27335813, - "stop_t2t": 27335849, - "disease": "Hand-foot-genital syndrome 2", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Anticipation does not occur, and expansions appear fully penetrant [@genereviews:NBK1423].", - "detection": "PCR amplification of tract II, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", - "year": "2003 [@pmid:12676922]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 12, - "benign_max": 12, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 18, - "pathogenic_max": 18, - "motif_len": 3, - "ref_copies": 12, - "novel": "ref", - "gard": [ - "2594" - ], - "genereviews": [ - "NBK1423" - ], - "malacard": [ - "HND004" - ], - "medgen": [ - "331103" - ], - "mondo": [ - "0007698" - ], - "omim": [ - "140000" - ], - "orphanet": [ - "2438" - ], - "gnomad": [ - "HOXA13_2" - ], - "stripy": [ - "HOXA13_2" - ], - "tr_atlas": [ - "TR74137" - ], - "webstr_hg38": [ - "5679831" - ], - "webstr_hg19": [ - "STR_1311036" - ], - "locus_tags": [], - "disease_tags": [ - "hand_foot_genital_syndrome" - ], - "references": [ - "genereviews:NBK1423", - "pmid:15385446", - "pmid:17935235", - "pmid:12676922", - "mondo:0007698" - ], - "additional_literature": [ - "pmid:32386547", - "pmid:23532960", - "pmid:19591980", - "pmid:12414828", - "pmid:11543619" - ] - }, + "motif": "GCT", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 10, + "benign_max": 10, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": null, + "pathogenic_max": null, + "motif_len": 3, + "ref_copies": 13.7, + "novel": "ref", + "gard": ["15215", "13174"], + "genereviews": [], + "malacard": ["PRG130", "PRK002"], + "medgen": ["897191", "371919"], + "mondo": ["0009783", "0024528"], + "omim": ["258450", "157640"], + "orphanet": ["520820"], + "gnomad": [], + "stripy": [], + "tr_atlas": ["TR137533"], + "webstr_hg38": ["5177947"], + "webstr_hg19": ["STR_493430"], + "locus_tags": ["proposed_modifier"], + "disease_tags": [], + "references": ["pmid:20399836", "pmid:20826197", "pmid:10196696", "pmid:22963882", "pmid:19043662", "omim:258450", "omim:157640", "pmid:38876750"], + "additional_literature": ["pmid:41009775", "pmid:40844737", "pmid:39812846", "pmid:34600502", "pmid:29029963", "pmid:28444220", "pmid:25767537", "pmid:24491464", "pmid:23912752", "pmid:23493802", "pmid:20803511", "pmid:15694274", "pmid:12036482"] +}, +{ + "id": "SCA12_PPP2R2B", + "disease_id": "SCA12", + "gene": "PPP2R2B", + "evidence": ["Moderate"], + "chrom": "chr5", + "start_hg38": 146878727, + "stop_hg38": 146878759, + "start_hg19": 146258290, + "stop_hg19": 146258322, + "start_t2t": 147414733, + "stop_t2t": 147414780, + "disease": "Spinocerebellar ataxia type 12", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 12 (SCA12) is a very rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by the presence of action tremor associated with relatively mild cerebellar ataxia. Associated pyramidal and extrapyramidal signs and dementia have been reported [@mondo:0011439].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Frequent in India; rare in other populations [@pmid:34711523].", + "age_onset": "Typical: 26-50; Range: 8-62 [@omim:604326; @pmid:42105155].", + "age_onset_min": 8.0, + "age_onset_max": 62.0, + "typ_age_onset_min": 26.0, + "typ_age_onset_max": 50.0, + "details": "Benign range is 6-32 repeats, intermediate range 40-49, and pathogenic range is 51-78 [@pmid:37906407]; intermediate alleles are associated with reduced penetrance [@pmid:11198281].", + "detection": "RP-PCR generally detects expansions, while PCR fragment analysis approximates allele size. Large expansions may require Southern blot confirmation [@pmid:35262663; @pmid:10581021].", + "mechanism": "GoF", + "mechanism_detail": "Polyalanine gain of function associated with RAN translation [@pmid:38467784].", + "year": "1999 [@pmid:10581021]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCT"], + "pathogenic_motif_reference_orientation": ["GCT"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 6, + "benign_max": 32, + "intermediate_min": 40, + "intermediate_max": 49, + "pathogenic_min": 51, + "pathogenic_max": 78, + "motif_len": 3, + "ref_copies": 10.7, + "novel": "ref", + "gard": ["10476"], + "genereviews": ["NBK535148"], + "malacard": ["SPN293"], + "medgen": ["347653"], + "mondo": ["0011439"], + "omim": ["604326"], + "orphanet": ["98762"], + "gnomad": ["PPP2R2B"], + "stripy": ["PPP2R2B"], + "tr_atlas": ["TR59714"], + "webstr_hg38": ["985593", "6072892"], + "webstr_hg19": ["Expansion_SCA12/PPP2R2B"], + "locus_tags": ["length_affects_penetrance"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["omim:604326", "pmid:38467784", "pmid:37906407", "pmid:11198281", "pmid:34711523", "pmid:10581021", "mondo:0011439"], + "additional_literature": ["pmid:42105155", "pmid:42038259", "pmid:41788301", "pmid:41762523", "pmid:41691974", "pmid:41612618", "pmid:41074692", "pmid:40488180", "pmid:39565297", "pmid:39469072", "pmid:38961870", "pmid:38798069", "pmid:38711441", "pmid:38227102", "pmid:38058854", "pmid:35531119", "pmid:33502644", "pmid:32675418", "pmid:32124191", "pmid:30130680", "pmid:29057148", "pmid:27864267", "pmid:26340331", "pmid:26077168", "pmid:25634432", "pmid:25586539", "pmid:25274186", "pmid:24269018", "pmid:21029765", "pmid:20937954", "pmid:20533062", "pmid:18940801", "pmid:18484086", "pmid:17961920", "pmid:16054804", "pmid:11171892"] +}, +{ + "id": "HSAN-VIII_PRDM12", + "disease_id": "HSAN VIII", + "gene": "PRDM12", + "evidence": ["Moderate"], + "chrom": "chr9", + "start_hg38": 130681605, + "stop_hg38": 130681641, + "start_hg19": 133556992, + "stop_hg19": 133557028, + "start_t2t": 142886568, + "stop_t2t": 142886595, + "disease": "Hereditary sensory and autonomic neuropathy type VIII", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "A hereditary sensory neuropathy characterized by congenital insensitivity to pain and decreased sweating and tear production that has material basis in homozygous mutation in the PRDM12 gene on chromosome 9q34 [@mondo:0014662].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Expansions found in 2 families from Pakistan and Saudi Arabia [@pmid:26005867]. All PRDM12 disease mutations < 1/1,000,000", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Pathogenic expansion found in 2 families, from whom pathogenic range (18-19) is inferred [@pmid:26005867]. Benign range (7-14) inferred from Human Gene Mutation Database [@genereviews:NBK535148].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Mutations abrogate the histone-modifying potential of PRDM12, consistent with a loss of function mechanism [@omim:616488].", + "year": "2015 [@pmid:26005867]", + "location_in_gene": "Coding Exon 5", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 7, + "benign_max": 14, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 18, + "pathogenic_max": 19, + "motif_len": 3, + "ref_copies": 12.0, + "novel": "ref", + "gard": ["17866"], + "genereviews": ["NBK535148"], + "malacard": ["NRP044"], + "medgen": ["894363"], + "mondo": ["0014662"], + "omim": ["616488"], + "orphanet": ["478664"], + "gnomad": ["PRDM12"], + "stripy": ["PRDM12"], + "tr_atlas": ["TR97506"], + "webstr_hg38": ["1543400"], + "webstr_hg19": ["STR_1521945"], + "locus_tags": [], + "disease_tags": [], + "references": ["omim:616488", "pmid:26005867", "genereviews:NBK535148", "mondo:0014662"], + "additional_literature": ["pmid:41630927"] +}, +{ + "id": "CJD_PRNP", + "disease_id": "CJD", + "gene": "PRNP", + "evidence": ["Moderate"], + "chrom": "chr20", + "start_hg38": 4699397, + "stop_hg38": 4699493, + "start_hg19": 4680043, + "stop_hg19": 4680139, + "start_t2t": 4738633, + "stop_t2t": 4738705, + "disease": "Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Schneiker syndrome (GSS) are a rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus [@genereviews:NBK1229]. These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat [@doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "<0.0225/1,000,000: <15% of CJ variants are repeat expansions [@genereviews:NBK535148]. 15% newly diagnosed prion disease cases are genetic [@genereviews:NBK1229], 1 individual per million per year worldwide (350 cases annually in US) [@pmid:29939637]. Found worldwide [@genereviews:NBK1229].", + "age_onset": "Typical: 50-60 [@genereviews:NBK1229]; Range: 31-63 [@pmid:37379724].", + "age_onset_min": 31.0, + "age_onset_max": 63.0, + "typ_age_onset_min": 50.0, + "typ_age_onset_max": 60.0, + "details": "Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln; any additional repeat leads to pathogenicity, with the largest repeat observed 16 motifs [@genereviews:NBK1229]. Insertion length may correspond to phenotype, such as CJD versus frontotemporal dementia [@pmid:36977684].", + "detection": null, + "mechanism": "LoF?", + "mechanism_detail": "Loss of function hypothesized [@pmid:38467784]", + "year": "1991 [@pmid:1683708]", + "location_in_gene": "Coding Exon 2", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGTGGTGGCTGGGGGCAGCCTCAT"], + "pathogenic_motif_reference_orientation": ["CCTCATGGTGGTGGCTGGGGGCAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGCCTCATGGTGGTGGCTGGGGGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "HFG_HOXA13-III", - "disease_id": "HFG-III", - "gene": "HOXA13", - "evidence": [ - "Limited" - ], - "chrom": "chr7", - "start_hg38": 27199678, - "stop_hg38": 27199732, - "start_hg19": 27239297, - "stop_hg19": 27239351, - "start_t2t": 27335684, - "stop_t2t": 27335720, - "disease": "Hand-foot-genital syndrome 3", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Hand-foot-genital syndrome (HFGS) is a very rare multiple congenital abnormality syndrome characterized by distal limb malformations and urogenital defects [@mondo:0007698].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Extremely rare, published cases generally European ancestry or unknown [@pmid:15385446; @pmid:17935235; @genereviews:NBK1423].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Anticipation does not occur, and expansions appear fully penetrant; it is unknown if contractions also lead to phenotypic variation [@genereviews:NBK1423].", - "detection": "PCR amplification of tract III, followed by fragment analysis or Sanger sequencing, has detected and sized these alleles. Standard short read sequencing may miss expanded repeats [@genereviews:NBK1423].", - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to haploinsufficiency [@genereviews:NBK1423]", - "year": "2000 [@pmid:10839976]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 8, - "benign_max": 18, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 32, - "motif_len": 3, - "ref_copies": 18, - "novel": "ref", - "gard": [ - "2594" - ], - "genereviews": [ - "NBK1423" - ], - "malacard": [ - "HND004" - ], - "medgen": [ - "331103" - ], - "mondo": [ - "0007698" - ], - "omim": [ - "140000" - ], - "orphanet": [ - "2438" - ], - "gnomad": [ - "HOXA13_3" - ], - "stripy": [ - "HOXA13_3" - ], - "tr_atlas": [ - "TR74136" - ], - "webstr_hg38": [ - "1365344" - ], - "webstr_hg19": [ - "STR_1311035" - ], - "locus_tags": [], - "disease_tags": [ - "hand_foot_genital_syndrome" - ], - "references": [ - "genereviews:NBK1423", - "pmid:15385446", - "pmid:17935235", - "pmid:10839976", - "mondo:0007698" - ], - "additional_literature": [ - "pmid:32386547", - "pmid:23532960", - "pmid:19591980", - "pmid:12414828", - "pmid:11543619" - ] + "motif": "CCTCAGGGCGGTGGTGGCTGGGGGCAG", + "count": 1, + "type": "flank_repeat" }, { - "id": "SD5_HOXD13", - "disease_id": "SD5", - "gene": "HOXD13", - "evidence": [ - "Definitive" - ], - "chrom": "chr2", - "start_hg38": 176093058, - "stop_hg38": 176093103, - "start_hg19": 176957786, - "stop_hg19": 176957831, - "start_t2t": 176581179, - "stop_t2t": 176581224, - "disease": "Syndactyly", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Synpolydactyly (SPD), or syndactyly type II, is defined as a connection between the middle and ring fingers and fourth and fifth toes, variably associated with postaxial polydactyly in the same digits. Minor local anomalies and various metacarpal or metatarsal abnormalities may be present [@omim:186000].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Syndactyly is found across dozens of unrelated families worldwide [@pmid:24038517]. However, syndactyly-5 specific to STR expansion has been found in 3 individuals [@genereviews:NBK535148].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign alleles are highly conserved to be 15 repeats, with disease observed in individuals with 22-23 repeats [@pmid:8614804; @pmid:22406499] as well as in individuals with 8-11 repeats [@genereviews:NBK535148].", - "detection": "Targeted PCR across exon 1 has detected expansions, and subcloning with Sanger sequencing has characterized them [@pmid:9223304].", - "mechanism": "GoF", - "mechanism_detail": "Polyalanine expansion leading to GoF [@pmid:38467784]", - "year": "1996 [@pmid:8614804]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 23, - "motif_len": 3, - "ref_copies": 14, - "novel": "ref", - "gard": [ - "17358" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "SYN084" - ], - "medgen": [ - "1809573" - ], - "mondo": [ - "0008513" - ], - "omim": [ - "186000" - ], - "orphanet": [ - "295195" - ], - "gnomad": [ - "HOXD13" - ], - "stripy": [ - "HOXD13" - ], - "tr_atlas": [ - "TR24032" - ], - "webstr_hg38": [ - "5486677" - ], - "webstr_hg19": [ - "STR_796395" - ], - "locus_tags": [ - "contraction" - ], - "disease_tags": [], - "references": [ - "pmid:38467784", - "pmid:8614804", - "pmid:22406499", - "genereviews:NBK535148", - "pmid:24038517", - "omim:186000" - ], - "additional_literature": [ - "pmid:34159400", - "pmid:32652111", - "pmid:32386547", - "pmid:19841179", - "pmid:19546318", - "pmid:17935235", - "pmid:12414828", - "pmid:12116248", - "pmid:11543619" - ] - }, + "motif": "CCTCATGGTGGTGGCTGGGGGCAG", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 4, + "benign_max": 4, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 5, + "pathogenic_max": 16, + "motif_len": 24, + "ref_copies": null, + "novel": "ref", + "gard": ["17307"], + "genereviews": ["NBK1229"], + "malacard": ["CRT072"], + "medgen": ["155837"], + "mondo": ["0007403"], + "omim": ["123400"], + "orphanet": ["282166"], + "gnomad": ["PRNP"], + "stripy": [], + "tr_atlas": ["TR157963", "TR157964"], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": ["length_affects_phenotype"], + "disease_tags": [], + "references": ["genereviews:NBK1229", "pmid:37379724", "pmid:38467784", "pmid:36977684", "genereviews:NBK535148", "pmid:29939637", "pmid:1683708", "doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1"], + "additional_literature": ["pmid:41890154", "pmid:41009775", "pmid:40803449", "pmid:39256877", "pmid:35926480", "pmid:35903139", "pmid:35752680", "pmid:35585119", "pmid:33131137", "pmid:31795947", "pmid:31127772", "pmid:30777654", "pmid:30530974", "pmid:29966485", "pmid:28003435", "pmid:27400454", "pmid:25239657", "pmid:23998997", "pmid:21686668", "pmid:19092329", "pmid:18397498", "pmid:18366654", "pmid:17709704", "pmid:16858508", "pmid:14729275", "pmid:12805114", "pmid:12451210", "pmid:11593450", "pmid:10611945", "pmid:9710033", "pmid:9565627", "pmid:8030952"] +}, +{ + "id": "FAME8_RAI1", + "disease_id": "FAME8", + "gene": "RAI1", + "evidence": ["Limited"], + "chrom": "chr17", + "start_hg38": 17808358, + "stop_hg38": 17808460, + "start_hg19": 17711672, + "stop_hg19": 17711774, + "start_t2t": 17754961, + "stop_t2t": 17755053, + "disease": "Familial adult myoclonic epilepsy type 8", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Observed in a single family from Mali with ten affected individuals [@pmid:37994247].", + "age_onset": "7-68 (one family)", + "age_onset_min": 7.0, + "age_onset_max": 68.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1 gene that co-segregated with disease status in a single large family from Mali [@pmid:37994247]. Ten affected individuals were studied. Both TTTTA and TTTCA motifs were observed in all eight of the affected individuals with spanning reads, with allele sizes in the range: (TTTTA)278-773(TTTCA)9-334. A single individual was observed with additional motifs and interruptions in one allele with the structure: (TTTTA)exp(GGGGT)ins(GGGAT)ins(TTTCA)ins. TTTCA repeats were absent in 200 Malian controls, who had alleles in the range: (TTTCA)16-20. Reviewed in [@pmid:38876750]. It is uncertain if expansions at both the TTTTA and TTTCA motifs, or only the TTTCA motif are required for pathogenicity. The pathogenic range in STRchive is for the TTTCA motif only. Note: locus is partially deleted in T2T reference genome.", + "detection": null, + "mechanism": "Unknown", + "mechanism_detail": "Expression isn't changed [@pmid:7994247].", + "year": "2024 [@pmid:37994247]", + "location_in_gene": "Intron 4", + "gene_strand": "+", + "reference_motif_reference_orientation": ["TTTTA"], + "pathogenic_motif_reference_orientation": ["TTTCA"], + "benign_motif_reference_orientation": ["TTTTA"], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["GGGGT", "GGGAT"], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": ["ATTTT"], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["GGGGT", "ATGGG"], + "locus_structure": [ { - "id": "HD_HTT", - "disease_id": "HD", - "gene": "HTT", - "evidence": [ - "Definitive" - ], - "chrom": "chr4", - "start_hg38": 3074876, - "stop_hg38": 3074933, - "start_hg19": 3076603, - "stop_hg19": 3076660, - "start_t2t": 3073603, - "stop_t2t": 3073687, - "disease": "Huntington disease", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian", - "Risk" - ], - "disease_description": "Huntington disease (HD) is a rare neurodegenerative disorder of the central nervous system characterized by unwanted choreatic movements, behavioral and psychiatric disturbances and dementia [@mondo:0007739].", - "hpo_terms": null, - "prevalence": "1/10000", - "prevalence_details": "6.5-15/100,000 [@pmid:29100084]. 9.71-17:100,000 (European) vs. 0.1-2/100,000 (African), as many as 1 in 400 have reduced penetrance (0.2-2% for 36-38 CAG) HTT alleles [@genereviews:NBK1305]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1305].", - "age_onset": "Typical: 35-44 [@genereviews:NBK1305]; Range: 1-85 [@pmid:39441074; @pmid:21171977].", - "age_onset_min": 1, - "age_onset_max": 85, - "typ_age_onset_min": 35, - "typ_age_onset_max": 44, - "details": "27-35 motifs are unstable/premutations, while 36-39 motifs are associated with reduced penetrance and mild phenotypes [@pmid:39572770], and alleles over 40 repeats are typically fully penetrant [@genereviews:NBK1305]. >60 motifs associated with onset age <20 years [@genereviews:NBK1305]. Only CAG expansions are considered pathogenic, but interruptions impact pathogenicity (CAA) [@pmid:35245110; @pmid:39673793]. Only fathers with premutations are considered at risk of transmitting pathogenic alleles [@pmid:19507258]. CAG repeat size 21-35 may continuously modulate brain structure and psychiatric disease risk in an age-dependent manner [@pmid:39572770] [@doi:https://doi.org/10.64898/2026.05.08.26352223]. Somatic expansion of HTT CAG repeats in vulnerable tissues is proposed to contribute to age-dependent onset and neurodegeneration, with greater repeat instability associated with earlier disease onset [@pmid:41926793; @pmid:39824182]. Undiagnosed carriers of premutation and pathogenic HTT expansions, exhibit reduced striatal brain volumes and elevated neurofilament light chain levels before clinical diagnosis, consistent with findings observed across other loci [@pmid:41951733].", - "detection": "PCR methods have reliably detected expansions up to ~115 repeats, but very large expansions may require Southern blotting [@genereviews:NBK1305]. Long-read sequencing has resolved interruptions and validated sizing [@pmid:41512049].", - "mechanism": "GoF/LoF", - "mechanism_detail": "While the primary pathogenic mechanism is gain of function of the protein product, pathogenesis is complex and multifactorial [@pmid:27940602]. Reduced SCN4B expression in striatal neurons has been implicated as a modifier of HD-associated phenotype severity, potentially contributing to dysfunction in motor associated striatal neuronal populations [@pmid:41959367].", - "year": "1993 [@pmid:8458085]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "CAA" - ], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AAC" - ], - "locus_structure": [ - { - "motif": "CAG", - "count": null, - "type": "pathogenic_repeat" - }, - { - "motif": "CAACAG", - "count": 1, - "type": "interruption" - }, - { - "motif": "CCG", - "count": 12, - "type": "flank_repeat" - } - ], - "benign_min": 6, - "benign_max": 26, - "intermediate_min": 27, - "intermediate_max": 35, - "pathogenic_min": 36, - "pathogenic_max": 250, - "motif_len": 3, - "ref_copies": 21.3, - "novel": "ref", - "gard": [ - "6677" - ], - "genereviews": [ - "NBK1305" - ], - "malacard": [ - "HNT016" - ], - "medgen": [ - "5654" - ], - "mondo": [ - "0007739" - ], - "omim": [ - "143100" - ], - "orphanet": [ - "399" - ], - "gnomad": [ - "HTT" - ], - "stripy": [ - "HTT" - ], - "tr_atlas": [ - "TR40017", - "TR40018" - ], - "webstr_hg38": [ - "4701738", - "86468", - "86467" - ], - "webstr_hg19": [ - "Expansion_HD/HTT" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_phenotype", - "length_affects_severity", - "motif_affects_instability", - "motif_affects_onset", - "motif_affects_penetrance", - "proposed_modifier" - ], - "disease_tags": [], - "references": [ - "genereviews:NBK1305", - "pmid:39441074", - "pmid:21171977", - "pmid:27940602", - "pmid:41959367", - "pmid:39572770", - "pmid:35245110", - "pmid:39673793", - "pmid:19507258", - "doi:https://doi.org/10.64898/2026.05.08.26352223", - "pmid:41926793", - "pmid:39824182", - "pmid:41951733", - "pmid:29100084", - "pmid:8458085", - "mondo:0007739" - ], - "additional_literature": [ - "pmid:42210302", - "pmid:42202221", - "pmid:42196324", - "pmid:42185880", - "pmid:42183198", - "pmid:42182232", - "pmid:42181265", - "pmid:42152675", - "pmid:42109206", - "pmid:42091595", - "pmid:42007924", - "pmid:41957010", - "pmid:41916314", - "pmid:41906693", - "pmid:41884622", - "pmid:41883719", - "pmid:41850723", - "pmid:41849610", - "pmid:41849583", - "pmid:41841355", - "pmid:41838909", - "pmid:41828602", - "pmid:41786746", - "pmid:41770933", - "pmid:41762523", - "pmid:41741274", - "pmid:41736717", - "pmid:41736445", - "pmid:41697960", - "pmid:41640354", - "pmid:41622913", - "pmid:41620818", - "pmid:41612618", - "pmid:41557250", - "pmid:41545439", - "pmid:41520110", - "pmid:41462929", - "pmid:41427302", - "pmid:41426430", - "pmid:41424860", - "pmid:41418088", - "pmid:41389205", - "pmid:41361856", - "pmid:41358280", - "pmid:41346861", - "pmid:41332649", - "pmid:41279265", - "pmid:41256123", - "pmid:41254939", - "pmid:41240184", - "pmid:41239019", - "pmid:41147028", - "pmid:41139934", - "pmid:41126427", - "pmid:41095675", - "pmid:41095094", - "pmid:41084658", - "pmid:41074680", - "pmid:41030958", - "pmid:41003760", - "pmid:40985165", - "pmid:40945646", - "pmid:40926977", - "pmid:40905034", - "pmid:40898018", - "pmid:40844528", - "pmid:40838126", - "pmid:40801627", - "pmid:40796049", - "pmid:40791503", - "pmid:40777434", - "pmid:40777236", - "pmid:40752726", - "pmid:40748251", - "pmid:40748199", - "pmid:40746751", - "pmid:40702881", - "pmid:40702852", - "pmid:40667291", - "pmid:40662609", - "pmid:40643497", - "pmid:40626527", - "pmid:40620227", - "pmid:40585812", - "pmid:40563832", - "pmid:40560365", - "pmid:40559333", - "pmid:40546037", - "pmid:40520366", - "pmid:40501897", - "pmid:40501854", - "pmid:40490511", - "pmid:40450087", - "pmid:40443124", - "pmid:40429681", - "pmid:40426848", - "pmid:40419681", - "pmid:40417743", - "pmid:40369544", - "pmid:40330856", - "pmid:40319093", - "pmid:40300581", - "pmid:40267238", - "pmid:40258535", - "pmid:40221975", - "pmid:40161725", - "pmid:40081335", - "pmid:40060574", - "pmid:40055280", - "pmid:40040448", - "pmid:40004498", - "pmid:40002561", - "pmid:39984289", - "pmid:39973385", - "pmid:39938516", - "pmid:39937881", - "pmid:39923663", - "pmid:39897579", - "pmid:39849121", - "pmid:39843658", - "pmid:39825149", - "pmid:39812810", - "pmid:39803497", - "pmid:39801710", - "pmid:39772743", - "pmid:39768315", - "pmid:39763784", - "pmid:39762660", - "pmid:39713241", - "pmid:39669608", - "pmid:39666103", - "pmid:39662690", - "pmid:39651202", - "pmid:39627841", - "pmid:39621338", - "pmid:39617003", - "pmid:39614274", - "pmid:39592326", - "pmid:39574844", - "pmid:39473968", - "pmid:39457479", - "pmid:39331414", - "pmid:39309355", - "pmid:39298485", - "pmid:39270726", - "pmid:39250876", - "pmid:39242198", - "pmid:39229124", - "pmid:39185703", - "pmid:39155290", - "pmid:39155061", - "pmid:39153206", - "pmid:39115048", - "pmid:39112488", - "pmid:39096606", - "pmid:39026894", - "pmid:39023561", - "pmid:38977715", - "pmid:38974999", - "pmid:38948755", - "pmid:38931834", - "pmid:38897956", - "pmid:38895438", - "pmid:38869243", - "pmid:38841617", - "pmid:38803421", - "pmid:38786052", - "pmid:38774633", - "pmid:38749429", - "pmid:38744826", - "pmid:38734203", - "pmid:38660915", - "pmid:38627751", - "pmid:38609352", - "pmid:38595854", - "pmid:38585669", - "pmid:38544341", - "pmid:38459427", - "pmid:38449714", - "pmid:38418081", - "pmid:38416505", - "pmid:38383663", - "pmid:38379425", - "pmid:38352602", - "pmid:38291334", - "pmid:38280392", - "pmid:38267530", - "pmid:38237588", - "pmid:38195181", - "pmid:38137557", - "pmid:38092667", - "pmid:38035176", - "pmid:38007671", - "pmid:38003344", - "pmid:37993517", - "pmid:37992538", - "pmid:37961595", - "pmid:37961108", - "pmid:37855597", - "pmid:37840138", - "pmid:37831730", - "pmid:37830620", - "pmid:37827155", - "pmid:37761940", - "pmid:37751638", - "pmid:37745577", - "pmid:37744022", - "pmid:37727506", - "pmid:37716514", - "pmid:37700320", - "pmid:37582307", - "pmid:37547003", - "pmid:37535888", - "pmid:37501188", - "pmid:37481821", - "pmid:37407555", - "pmid:37379724", - "pmid:37333326", - "pmid:37315918", - "pmid:37315450", - "pmid:37306313", - "pmid:37302585", - "pmid:37288993", - "pmid:37231148", - "pmid:37199581", - "pmid:37177784", - "pmid:37162872", - "pmid:37148558", - "pmid:37146135", - "pmid:37117485", - "pmid:37005488", - "pmid:36994811", - "pmid:36958627", - "pmid:36902304", - "pmid:36839842", - "pmid:36825038", - "pmid:36797418", - "pmid:36793800", - "pmid:36711022", - "pmid:36691277", - "pmid:36658243", - "pmid:36599645", - "pmid:36599142", - "pmid:36585400", - "pmid:36550260", - "pmid:36458209", - "pmid:36427954", - "pmid:36352624", - "pmid:36344508", - "pmid:36335527", - "pmid:36335491", - "pmid:36285345", - "pmid:36262216", - "pmid:36252286", - "pmid:36220612", - "pmid:36179426", - "pmid:36130218", - "pmid:36099320", - "pmid:36098485", - "pmid:36087538", - "pmid:36075537", - "pmid:36066723", - "pmid:36064847", - "pmid:36063627", - "pmid:36009409", - "pmid:35997316", - "pmid:35935919", - "pmid:35928225", - "pmid:35926480", - "pmid:35915275", - "pmid:35914128", - "pmid:35852957", - "pmid:35803234", - "pmid:35793238", - "pmid:35661131", - "pmid:35659303", - "pmid:35628406", - "pmid:35580427", - "pmid:35440014", - "pmid:35395816", - "pmid:35379994", - "pmid:35370826", - "pmid:35357736", - "pmid:35275350", - "pmid:35241644", - "pmid:35224162", - "pmid:35182509", - "pmid:35146388", - "pmid:35143966", - "pmid:35114102", - "pmid:35099257", - "pmid:35095420", - "pmid:35058188", - "pmid:35055435", - "pmid:35046408", - "pmid:35036881", - "pmid:38835439", - "pmid:34948242", - "pmid:34942093", - "pmid:34884469", - "pmid:34880419", - "pmid:34851867", - "pmid:34829752", - "pmid:34806402", - "pmid:34800149", - "pmid:34747792", - "pmid:34718701", - "pmid:34681268", - "pmid:34663519", - "pmid:34659371", - "pmid:34658796", - "pmid:34631219", - "pmid:34608934", - "pmid:34539331", - "pmid:34536046", - "pmid:34520257", - "pmid:34504195", - "pmid:34492254", - "pmid:34473992", - "pmid:34469738", - "pmid:34423286", - "pmid:34423068", - "pmid:34390268", - "pmid:34389718", - "pmid:34376056", - "pmid:34372915", - "pmid:34366363", - "pmid:34330701", - "pmid:34301881", - "pmid:34296279", - "pmid:34200421", - "pmid:34183222", - "pmid:34180418", - "pmid:34115782", - "pmid:34093422", - "pmid:34077591", - "pmid:34071882", - "pmid:34028139", - "pmid:34003958", - "pmid:33989290", - "pmid:33983118", - "pmid:33949657", - "pmid:33918672", - "pmid:33909994", - "pmid:33907289", - "pmid:33892278", - "pmid:33824468", - "pmid:33805940", - "pmid:33766994", - "pmid:33751106", - "pmid:33731741", - "pmid:33722743", - "pmid:33710799", - "pmid:33692166", - "pmid:33684424", - "pmid:33681777", - "pmid:33675499", - "pmid:33611676", - "pmid:33606279", - "pmid:33602179", - "pmid:33581487", - "pmid:33579864", - "pmid:33576024", - "pmid:33567536", - "pmid:33556538", - "pmid:33547932", - "pmid:33521985", - "pmid:33517535", - "pmid:33500176", - "pmid:33487499", - "pmid:33376800", - "pmid:33329316", - "pmid:33310753", - "pmid:33250715", - "pmid:33249136", - "pmid:33247537", - "pmid:33242422", - "pmid:33228555", - "pmid:33209959", - "pmid:33159825", - "pmid:33108594", - "pmid:33106889", - "pmid:33105495", - "pmid:33044188", - "pmid:32979842", - "pmid:32979507", - "pmid:32975927", - "pmid:32956974", - "pmid:32954323", - "pmid:32898862", - "pmid:32876667", - "pmid:32825467", - "pmid:32807001", - "pmid:32784364", - "pmid:32761094", - "pmid:32741964", - "pmid:32702387", - "pmid:32696070", - "pmid:32675418", - "pmid:32668197", - "pmid:32661355", - "pmid:32656337", - "pmid:32612964", - "pmid:32589923", - "pmid:32580238", - "pmid:32555394", - "pmid:32548276", - "pmid:32533168", - "pmid:32500377", - "pmid:32469433", - "pmid:32439598", - "pmid:32424160", - "pmid:32339315", - "pmid:32329133", - "pmid:32260409", - "pmid:32240172", - "pmid:32189861", - "pmid:32179492", - "pmid:32164608", - "pmid:32124191", - "pmid:32102602", - "pmid:32093602", - "pmid:32077165", - "pmid:32060489", - "pmid:32043503", - "pmid:31985471", - "pmid:31940111", - "pmid:31922295", - "pmid:31893246", - "pmid:31844074", - "pmid:31828084", - "pmid:31820322", - "pmid:31810584", - "pmid:31796991", - "pmid:31785809", - "pmid:31728006", - "pmid:31725947", - "pmid:31722751", - "pmid:31712634", - "pmid:31695145", - "pmid:31614197", - "pmid:31607598", - "pmid:31599037", - "pmid:31595198", - "pmid:31586340", - "pmid:31561381", - "pmid:31546689", - "pmid:31522753", - "pmid:31491822", - "pmid:31465962", - "pmid:31403680", - "pmid:31398342", - "pmid:31379510", - "pmid:31326748", - "pmid:31302194", - "pmid:31184975", - "pmid:31114543", - "pmid:31108174", - "pmid:31104771", - "pmid:31103960", - "pmid:31086827", - "pmid:31079989", - "pmid:31059641", - "pmid:30984798", - "pmid:30961637", - "pmid:30891880", - "pmid:30887245", - "pmid:30867264", - "pmid:30850442", - "pmid:30838312", - "pmid:30811996", - "pmid:30788902", - "pmid:30726572", - "pmid:30689590", - "pmid:30682531", - "pmid:30672003", - "pmid:30631090", - "pmid:30624705", - "pmid:30618600", - "pmid:30618191", - "pmid:30615214", - "pmid:30576007", - "pmid:30550751", - "pmid:30523767", - "pmid:30396032", - "pmid:30376191", - "pmid:30358836", - "pmid:30354976", - "pmid:30336474", - "pmid:30314815", - "pmid:30262848", - "pmid:30256717", - "pmid:30239724", - "pmid:30194983", - "pmid:30194046", - "pmid:30185623", - "pmid:30171891", - "pmid:30149534", - "pmid:30126429", - "pmid:30122542", - "pmid:30120431", - "pmid:30103339", - "pmid:30103338", - "pmid:30028085", - "pmid:30007561", - "pmid:29984244", - "pmid:29945620", - "pmid:29932473", - "pmid:29925548", - "pmid:29902468", - "pmid:29881950", - "pmid:29858077", - "pmid:29813067", - "pmid:29804730", - "pmid:29801887", - "pmid:29791508", - "pmid:29743609", - "pmid:29738460", - "pmid:29715545", - "pmid:29694882", - "pmid:29687370", - "pmid:29685790", - "pmid:29682858", - "pmid:29670796", - "pmid:29660633", - "pmid:29619771", - "pmid:29581148", - "pmid:29564144", - "pmid:29535594", - "pmid:29513687", - "pmid:29494703", - "pmid:29491012", - "pmid:29480209", - "pmid:29480205", - "pmid:29480204", - "pmid:29466333", - "pmid:29462355", - "pmid:29460498", - "pmid:29459817", - "pmid:29451775", - "pmid:29441485", - "pmid:29440125", - "pmid:29378824", - "pmid:29375575", - "pmid:29367444", - "pmid:29346421", - "pmid:29324753", - "pmid:29291624", - "pmid:29264979", - "pmid:29253686", - "pmid:29249939", - "pmid:29230030", - "pmid:29229845", - "pmid:29212711", - "pmid:29172480", - "pmid:29160844", - "pmid:29066237", - "pmid:29046994", - "pmid:29043641", - "pmid:29036832", - "pmid:28986324", - "pmid:28984613", - "pmid:28971447", - "pmid:28843844", - "pmid:28743452", - "pmid:28729730", - "pmid:28715425", - "pmid:28698602", - "pmid:28661018", - "pmid:28657159", - "pmid:28653853", - "pmid:28652746", - "pmid:28642124", - "pmid:28621522", - "pmid:28585930", - "pmid:28582868", - "pmid:28536578", - "pmid:28494017", - "pmid:28465506", - "pmid:28412438", - "pmid:28406926", - "pmid:28400517", - "pmid:28359739", - "pmid:28339398", - "pmid:28270748", - "pmid:28266655", - "pmid:28238795", - "pmid:28205498", - "pmid:28202696", - "pmid:28165127", - "pmid:28153533", - "pmid:28129107", - "pmid:28096892", - "pmid:28000697", - "pmid:27983559", - "pmid:27913616", - "pmid:27870408", - "pmid:27868347", - "pmid:27818324", - "pmid:27681197", - "pmid:27774050", - "pmid:27740685", - "pmid:27714917", - "pmid:27689620", - "pmid:27677791", - "pmid:27662335", - "pmid:27658206", - "pmid:27639545", - "pmid:27611938", - "pmid:27540492", - "pmid:27481337", - "pmid:27479945", - "pmid:27477323", - "pmid:27400454", - "pmid:27376585", - "pmid:27335115", - "pmid:27335079", - "pmid:27318215", - "pmid:27288455", - "pmid:27271685", - "pmid:27221610", - "pmid:27207688", - "pmid:27182645", - "pmid:27170315", - "pmid:27085395", - "pmid:27080129", - "pmid:27031731", - "pmid:27014581", - "pmid:27003665", - "pmid:27003663", - "pmid:27002149", - "pmid:26982737", - "pmid:26958025", - "pmid:26951563", - "pmid:26900923", - "pmid:26874369", - "pmid:26864449", - "pmid:26849111", - "pmid:26846325", - "pmid:26702360", - "pmid:26682993", - "pmid:26651603", - "pmid:26642438", - "pmid:26621114", - "pmid:26615955", - "pmid:26557176", - "pmid:26490331", - "pmid:26439718", - "pmid:26428929", - "pmid:26410751", - "pmid:26397897", - "pmid:26397895", - "pmid:26378991", - "pmid:26375764", - "pmid:26333255", - "pmid:26320893", - "pmid:26247199", - "pmid:26232222", - "pmid:26219658", - "pmid:26218986", - "pmid:26201449", - "pmid:26195796", - "pmid:26148071", - "pmid:26148061", - "pmid:26100538", - "pmid:26081309", - "pmid:26079385", - "pmid:25993131", - "pmid:25990798", - "pmid:25972145", - "pmid:25953777", - "pmid:25934536", - "pmid:25928884", - "pmid:25889241", - "pmid:25876513", - "pmid:25871323", - "pmid:25859666", - "pmid:25850430", - "pmid:25849618", - "pmid:25800750", - "pmid:25767004", - "pmid:25732261", - "pmid:25703232", - "pmid:25687118", - "pmid:25678252", - "pmid:25662336", - "pmid:25642374", - "pmid:25606985", - "pmid:25574027", - "pmid:25562842", - "pmid:25466405", - "pmid:25464109", - "pmid:25453459", - "pmid:25447230", - "pmid:25385587", - "pmid:25380582", - "pmid:25358814", - "pmid:25322077", - "pmid:25316307", - "pmid:25300333", - "pmid:25300330", - "pmid:25248608", - "pmid:25246229", - "pmid:25207939", - "pmid:25136821", - "pmid:25101541", - "pmid:25099302", - "pmid:25088714", - "pmid:25062863", - "pmid:25062764", - "pmid:25035419", - "pmid:25034271", - "pmid:25026978", - "pmid:24972706", - "pmid:24951540", - "pmid:24938402", - "pmid:24921664", - "pmid:24911443", - "pmid:24841383", - "pmid:24825316", - "pmid:24816393", - "pmid:24788406", - "pmid:24784230", - "pmid:24751919", - "pmid:24728353", - "pmid:24706734", - "pmid:24633813", - "pmid:24566949", - "pmid:24564568", - "pmid:24534762", - "pmid:24465260", - "pmid:24462335", - "pmid:24459609", - "pmid:24459107", - "pmid:24452335", - "pmid:24405816", - "pmid:24390280", - "pmid:24389360", - "pmid:24380395", - "pmid:24363131", - "pmid:24359926", - "pmid:24314096", - "pmid:24292706", - "pmid:24286237", - "pmid:24270512", - "pmid:24192302", - "pmid:24047873", - "pmid:24041806", - "pmid:24038471", - "pmid:24027120", - "pmid:24022020", - "pmid:24019913", - "pmid:24000094", - "pmid:23974869", - "pmid:23963702", - "pmid:23946314", - "pmid:23933208", - "pmid:23906595", - "pmid:23896435", - "pmid:23894380", - "pmid:23847583", - "pmid:23775678", - "pmid:23765727", - "pmid:23732677", - "pmid:23664844", - "pmid:23644918", - "pmid:23624566", - "pmid:23595883", - "pmid:23576953", - "pmid:23557875", - "pmid:23525903", - "pmid:23494654", - "pmid:23480802", - "pmid:23443539", - "pmid:23440000", - "pmid:23437422", - "pmid:23419892", - "pmid:23416527", - "pmid:23398026", - "pmid:23372043", - "pmid:23346156", - "pmid:23341618", - "pmid:23300918", - "pmid:23284626", - "pmid:23277128", - "pmid:25063431", - "pmid:23157165", - "pmid:23083689", - "pmid:23054839", - "pmid:23051704", - "pmid:23042244", - "pmid:23008174", - "pmid:22993450", - "pmid:22985800", - "pmid:22974690", - "pmid:22914735", - "pmid:22833283", - "pmid:22814437", - "pmid:22803944", - "pmid:22786682", - "pmid:22748968", - "pmid:22720673", - "pmid:22674458", - "pmid:22668780", - "pmid:22649062", - "pmid:22623107", - "pmid:22613578", - "pmid:22589249", - "pmid:22583646", - "pmid:22580959", - "pmid:22580459", - "pmid:22542623", - "pmid:22537721", - "pmid:22526956", - "pmid:22497302", - "pmid:26307259", - "pmid:22454241", - "pmid:22425717", - "pmid:22409360", - "pmid:22387017", - "pmid:22383888", - "pmid:22367996", - "pmid:22359536", - "pmid:22323755", - "pmid:22306231", - "pmid:22297462", - "pmid:22274789", - "pmid:22237433", - "pmid:22235343", - "pmid:22219281", - "pmid:22216210", - "pmid:22210241", - "pmid:24353748", - "pmid:23925262", - "pmid:23476655", - "pmid:22179316", - "pmid:22178474", - "pmid:22124413", - "pmid:22072510", - "pmid:22011578", - "pmid:21989477", - "pmid:21962718", - "pmid:21951270", - "pmid:21915913", - "pmid:21909428", - "pmid:21907324", - "pmid:21897851", - "pmid:21896309", - "pmid:21858921", - "pmid:21672921", - "pmid:21566259", - "pmid:21555070", - "pmid:21540131", - "pmid:21519949", - "pmid:21509658", - "pmid:21507249", - "pmid:21432905", - "pmid:21427085", - "pmid:21370269", - "pmid:21347256", - "pmid:21334439", - "pmid:21322024", - "pmid:21297956", - "pmid:21247881", - "pmid:21211002", - "pmid:21192926", - "pmid:22832606", - "pmid:22453877", - "pmid:21177255", - "pmid:21170307", - "pmid:21147489", - "pmid:21108634", - "pmid:21106039", - "pmid:21068430", - "pmid:21037797", - "pmid:21037796", - "pmid:21028906", - "pmid:20935170", - "pmid:20919768", - "pmid:24868381", - "pmid:20877453", - "pmid:20864123", - "pmid:20697744", - "pmid:20688164", - "pmid:20655708", - "pmid:20645403", - "pmid:20629137", - "pmid:20585470", - "pmid:20569486", - "pmid:20552561", - "pmid:20457230", - "pmid:20385209", - "pmid:20360314", - "pmid:20217280", - "pmid:20190273", - "pmid:20145031", - "pmid:22353486", - "pmid:20001119", - "pmid:19997493", - "pmid:19956633", - "pmid:19895335", - "pmid:19882735", - "pmid:19857538", - "pmid:19823894", - "pmid:19810823", - "pmid:19776381", - "pmid:19652143", - "pmid:19649213", - "pmid:19621255", - "pmid:19607813", - "pmid:19595623", - "pmid:19586540", - "pmid:19573560", - "pmid:19573298", - "pmid:21048629", - "pmid:19484127", - "pmid:19465745", - "pmid:19455596", - "pmid:19412185", - "pmid:19270701", - "pmid:19266143", - "pmid:19250382", - "pmid:19249009", - "pmid:21415933", - "pmid:19243073", - "pmid:19210789", - "pmid:19200948", - "pmid:19200361", - "pmid:19193881", - "pmid:19133136", - "pmid:19130884", - "pmid:19064745", - "pmid:19059613", - "pmid:19014073", - "pmid:19012814", - "pmid:18986359", - "pmid:18981372", - "pmid:18931668", - "pmid:18930824", - "pmid:18854207", - "pmid:18844975", - "pmid:18754766", - "pmid:18688140", - "pmid:18640989", - "pmid:18608348", - "pmid:18512767", - "pmid:18502655", - "pmid:18481795", - "pmid:18441666", - "pmid:18430257", - "pmid:18413470", - "pmid:18403212", - "pmid:18403126", - "pmid:18398004", - "pmid:18387780", - "pmid:18380486", - "pmid:18373410", - "pmid:18349696", - "pmid:18314311", - "pmid:18307262", - "pmid:18299573", - "pmid:18298206", - "pmid:18231868", - "pmid:18204817", - "pmid:18192679", - "pmid:19378429", - "pmid:18158109", - "pmid:18157708", - "pmid:18096682", - "pmid:18091069", - "pmid:18077673", - "pmid:18068007", - "pmid:18067195", - "pmid:18057558", - "pmid:18004675", - "pmid:17952586", - "pmid:17947312", - "pmid:17726644", - "pmid:17707354", - "pmid:17687393", - "pmid:17665004", - "pmid:17660463", - "pmid:17653603", - "pmid:17653274", - "pmid:17653262", - "pmid:17627386", - "pmid:17615168", - "pmid:17610899", - "pmid:17584778", - "pmid:17569088", - "pmid:17562929", - "pmid:17557337", - "pmid:17548158", - "pmid:17516481", - "pmid:17493035", - "pmid:17478887", - "pmid:17427191", - "pmid:17409200", - "pmid:17383831", - "pmid:17363167", - "pmid:17356014", - "pmid:17352933", - "pmid:17352932", - "pmid:17352931", - "pmid:17352930", - "pmid:17307423", - "pmid:17299512", - "pmid:17293170", - "pmid:17291464", - "pmid:17183717", - "pmid:17181545", - "pmid:17174018", - "pmid:17115386", - "pmid:17096834", - "pmid:17055784", - "pmid:17040921", - "pmid:17018562", - "pmid:17018277", - "pmid:16987871", - "pmid:16981596", - "pmid:16980414", - "pmid:16973440", - "pmid:16925544", - "pmid:16918952", - "pmid:16914060", - "pmid:16858508", - "pmid:16772714", - "pmid:16769871", - "pmid:16751280", - "pmid:16690085", - "pmid:16687439", - "pmid:16626669", - "pmid:16606912", - "pmid:16600988", - "pmid:16570300", - "pmid:16564426", - "pmid:16526033", - "pmid:16515395", - "pmid:16461334", - "pmid:16434483", - "pmid:16395126", - "pmid:16372906", - "pmid:16321399", - "pmid:16261565", - "pmid:16221531", - "pmid:16159402", - "pmid:16135087", - "pmid:16125146", - "pmid:16111888", - "pmid:16096998", - "pmid:16082690", - "pmid:16040812", - "pmid:16033418", - "pmid:16007623", - "pmid:15986189", - "pmid:15954918", - "pmid:15906159", - "pmid:15850737", - "pmid:15848234", - "pmid:15843398", - "pmid:15832309", - "pmid:15811941", - "pmid:15764008", - "pmid:15758168", - "pmid:15742215", - "pmid:15722951", - "pmid:15716522", - "pmid:15704211", - "pmid:15635668", - "pmid:15531095", - "pmid:15496672", - "pmid:15496421", - "pmid:15468075", - "pmid:15372528", - "pmid:15365789", - "pmid:15361494", - "pmid:15354395", - "pmid:15345132", - "pmid:15254954", - "pmid:15229244", - "pmid:15211622", - "pmid:15201464", - "pmid:15201455", - "pmid:15193429", - "pmid:15147313", - "pmid:15094787", - "pmid:15076735", - "pmid:15040808", - "pmid:15025718", - "pmid:14999077", - "pmid:14993615", - "pmid:14713958", - "pmid:14708029", - "pmid:14688268", - "pmid:14673581", - "pmid:14625278", - "pmid:14625025", - "pmid:14581669", - "pmid:14570710", - "pmid:12966525", - "pmid:12926013", - "pmid:12895502", - "pmid:12886033", - "pmid:12850791", - "pmid:12824708", - "pmid:12805114", - "pmid:12797118", - "pmid:12791042", - "pmid:12783847", - "pmid:12782968", - "pmid:12700167", - "pmid:12599191", - "pmid:12576549", - "pmid:12554681", - "pmid:12460551", - "pmid:12438470", - "pmid:12405543", - "pmid:12393802", - "pmid:12354780", - "pmid:12226089", - "pmid:12223581", - "pmid:12221159", - "pmid:12218657", - "pmid:12208565", - "pmid:12177311", - "pmid:12123845", - "pmid:12097805", - "pmid:11979062", - "pmid:11978769", - "pmid:11920857", - "pmid:11914418", - "pmid:11807410", - "pmid:11782460", - "pmid:11761463", - "pmid:11741397", - "pmid:11704263", - "pmid:11689489", - "pmid:11607033", - "pmid:11593450", - "pmid:11592850", - "pmid:11558794", - "pmid:11552131", - "pmid:11532992", - "pmid:11524486", - "pmid:11520890", - "pmid:11494364", - "pmid:11483245", - "pmid:11386982", - "pmid:11409734", - "pmid:11406606", - "pmid:11340249", - "pmid:11331615", - "pmid:11317220", - "pmid:11279522", - "pmid:11260214", - "pmid:22034471", - "pmid:11225602", - "pmid:11172033", - "pmid:11152661", - "pmid:11106399", - "pmid:11105061", - "pmid:11063736", - "pmid:11040449", - "pmid:11030759", - "pmid:11021756", - "pmid:11013077", - "pmid:11009201", - "pmid:10980573", - "pmid:10964480", - "pmid:10880387", - "pmid:10860124", - "pmid:10814708", - "pmid:10794362", - "pmid:10780268", - "pmid:10770860", - "pmid:10766906", - "pmid:10717003", - "pmid:10712225", - "pmid:10677504", - "pmid:10666223", - "pmid:10631644", - "pmid:10611371", - "pmid:10581038", - "pmid:10574348", - "pmid:10564878", - "pmid:10533044", - "pmid:10522893", - "pmid:10502848", - "pmid:10502825", - "pmid:10489045", - "pmid:10486315", - "pmid:10478585", - "pmid:10441327", - "pmid:10441201", - "pmid:10434306", - "pmid:10434303", - "pmid:10434297", - "pmid:10434295", - "pmid:10405095", - "pmid:10398087", - "pmid:10334474", - "pmid:10333377", - "pmid:10206229", - "pmid:10197541", - "pmid:10196370", - "pmid:10196365", - "pmid:10098889", - "pmid:10091627", - "pmid:10090478", - "pmid:10082833", - "pmid:10052816", - "pmid:10051007", - "pmid:10023115", - "pmid:9949443", - "pmid:9949199", - "pmid:9932964", - "pmid:9887339", - "pmid:9818876", - "pmid:9806905", - "pmid:9792871", - "pmid:9768849", - "pmid:9684917", - "pmid:9674805", - "pmid:9666478", - "pmid:9647305", - "pmid:9626775", - "pmid:9611675", - "pmid:9527890", - "pmid:9536082", - "pmid:9536081", - "pmid:9536080", - "pmid:9595987", - "pmid:9577843", - "pmid:9514585", - "pmid:9514579", - "pmid:9361024", - "pmid:9485067", - "pmid:9462548", - "pmid:9415475", - "pmid:23604331", - "pmid:9399688", - "pmid:9398841", - "pmid:9388503", - "pmid:9339688", - "pmid:9299885", - "pmid:9299309", - "pmid:9267034", - "pmid:9267033", - "pmid:9152833", - "pmid:9150744", - "pmid:9150168", - "pmid:9108071", - "pmid:9106534", - "pmid:9143014", - "pmid:10462592", - "pmid:9020849", - "pmid:9401013", - "pmid:9219003", - "pmid:9002673", - "pmid:9384710", - "pmid:8931689", - "pmid:8898202", - "pmid:8855141", - "pmid:8912795", - "pmid:8751857", - "pmid:8659522", - "pmid:8735227", - "pmid:8643525", - "pmid:8678115", - "pmid:8606810", - "pmid:8714530", - "pmid:8614526", - "pmid:8985734", - "pmid:8954302", - "pmid:8840396", - "pmid:8766138", - "pmid:8572659", - "pmid:8557266", - "pmid:7477379", - "pmid:8804464", - "pmid:7576661", - "pmid:7568002", - "pmid:8544189", - "pmid:8541834", - "pmid:7668287", - "pmid:7668260", - "pmid:7639626", - "pmid:7484060", - "pmid:7480359", - "pmid:7774020", - "pmid:7675777", - "pmid:7898693", - "pmid:7868117", - "pmid:7634532", - "pmid:7757069", - "pmid:9173995", - "pmid:7881406", - "pmid:7969980", - "pmid:7959696", - "pmid:7853373", - "pmid:7915776", - "pmid:7815437", - "pmid:8208412", - "pmid:8178825", - "pmid:8064815", - "pmid:7909529", - "pmid:8162059", - "pmid:8162055", - "pmid:8162053", - "pmid:8044653", - "pmid:7888133", - "pmid:7865169", - "pmid:8133511", - "pmid:8133510", - "pmid:8133508", - "pmid:8133495", - "pmid:8111374", - "pmid:8087617", - "pmid:8105214", - "pmid:8268906", - "pmid:8252042", - "pmid:8242074", - "pmid:8401589", - "pmid:8401588", - "pmid:8401587", - "pmid:2521771", - "pmid:2971929", - "pmid:3131233" - ] + "motif": "TTTTA", + "count": 18, + "type": "internal_repeat" }, { - "id": "HDL2_JPH3", - "disease_id": "HDL2", - "gene": "JPH3", - "evidence": [ - "Definitive" - ], - "chrom": "chr16", - "start_hg38": 87604282, - "stop_hg38": 87604329, - "start_hg19": 87637888, - "stop_hg19": 87637935, - "start_t2t": 93675723, - "stop_t2t": 93675776, - "disease": "Huntington disease-like 2", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Huntington disease-like 2 (HDL2) is a severe neurodegenerative disorder considered part of the neuroacanthocytosis syndromes characterized by a triad of movement, psychiatric, and cognitive abnormalities [@mondo:0011671].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "<1/1,000,000 [@orphanet:98934]. Largely in individuals of African ancestry [@genereviews:NBK1529], where a possible JPH3 founder mutation has been identified [@pmid:40187026].", - "age_onset": "Typical: 30-52; Range: 12-66 [@genereviews:NBK1529].", - "age_onset_min": 12, - "age_onset_max": 66, - "typ_age_onset_min": 30, - "typ_age_onset_max": 52, - "details": "Intermediate alleles (29-39) may either be premutations or associated with reduced penetrance; the longest pathogenic expansion (40+ motifs) to date is 60 repeats [@genereviews:NBK1529]", - "detection": null, - "mechanism": "LoF/GoF", - "mechanism_detail": "Non-mutually exclusive mechanisms include loss of function from RNA sequestration and gain of function from toxic transcripts and increased protein expression [@genereviews:NBK1529]", - "year": "2001 [@pmid:11694876]", - "location_in_gene": "Coding Exon 2", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CTG" - ], - "pathogenic_motif_reference_orientation": [ - "CTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CTG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 28, - "intermediate_min": 29, - "intermediate_max": 39, - "pathogenic_min": 40, - "pathogenic_max": 60, - "motif_len": 3, - "ref_copies": 15.6667, - "novel": "ref", - "gard": [ - "16874" - ], - "genereviews": [ - "NBK1529" - ], - "malacard": [ - "HNT004" - ], - "medgen": [ - "341120" - ], - "mondo": [ - "0011671" - ], - "omim": [ - "606438" - ], - "orphanet": [ - "98934" - ], - "gnomad": [ - "JPH3" - ], - "stripy": [ - "JPH3" - ], - "tr_atlas": [ - "TR143309" - ], - "webstr_hg38": [ - "828516", - "5987878" - ], - "webstr_hg19": [ - "Expansion_HDL2/JPH3" - ], - "locus_tags": [ - "somatic_instability", - "length_affects_phenotype", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_severity" - ], - "disease_tags": [], - "references": [ - "genereviews:NBK1529", - "orphanet:98934", - "pmid:40187026", - "pmid:11694876", - "mondo:0011671" - ], - "additional_literature": [ - "pmid:41957010", - "pmid:41074680", - "pmid:40914005", - "pmid:38948793", - "pmid:38725192", - "pmid:38617831", - "pmid:37379724", - "pmid:35926480", - "pmid:33824468", - "pmid:33044188", - "pmid:32675418", - "pmid:32028232", - "pmid:30682531", - "pmid:30615214", - "pmid:29801887", - "pmid:29208631", - "pmid:29066237", - "pmid:27400454", - "pmid:27288455", - "pmid:26079385", - "pmid:24269018", - "pmid:22447335", - "pmid:22367996", - "pmid:22297462", - "pmid:21555070", - "pmid:17516481", - "pmid:16858508", - "pmid:15764008", - "pmid:15468075", - "pmid:14557581", - "pmid:12805114", - "pmid:11906164" - ] - }, + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 9, + "pathogenic_max": 334, + "motif_len": 5, + "ref_copies": 20.8, + "novel": "novel", + "gard": ["16758"], + "genereviews": [], + "malacard": [], + "medgen": [], + "mondo": [], + "omim": [], + "orphanet": ["86814"], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": ["486849"], + "webstr_hg19": [], + "locus_tags": ["motif_affects_onset"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:7994247", "pmid:37994247", "pmid:38876750"], + "additional_literature": ["pmid:41874439", "pmid:41219789", "pmid:40541176", "pmid:38871700", "pmid:37339841", "pmid:34565721", "pmid:33186760", "pmid:32283749", "pmid:32281848", "pmid:30891880", "pmid:30622881", "pmid:25663198", "pmid:23897707", "pmid:17457615", "pmid:15148657", "pmid:11594924", "pmid:10915763", "pmid:8817239"] +}, +{ + "id": "FAME7_RAPGEF2", + "disease_id": "FAME7", + "gene": "RAPGEF2", + "evidence": ["Limited"], + "chrom": "chr4", + "start_hg38": 159342526, + "stop_hg38": 159342618, + "start_hg19": 160263678, + "stop_hg19": 160263770, + "start_t2t": 162693303, + "stop_t2t": 162693405, + "disease": "Familial adult myoclonic epilepsy type 7", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. Repeat expansion found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 20-33 [@pmid:30351492]; Range: 18 [@pmid:29507423] - 37 [@pmid:30351492].", + "age_onset_min": 18.0, + "age_onset_max": 37.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "The locus structure is (TTTTA)exp(TTTCA)exp(TTTTA)n, where only the TTTCA is specific to affected individuals as a pathogenic insertion [@pmid:29507423; @pmid:30351492]. Pathogenic expansions range from 60 to thousands of repeats [@pmid:29507423; @pmid:30351492]. Interruptions seen: TATTA, TTTTTA [@pmid:35245110].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423].", + "year": "2018 [@pmid:29507423]", + "location_in_gene": "Intron 14", + "gene_strand": "+", + "reference_motif_reference_orientation": ["TTTTA"], + "pathogenic_motif_reference_orientation": ["TTTCA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["TTTTT", "TTATG"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["TTTTT", "ATGTT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "OPDM1_LRP12", - "disease_id": "OPDM1", - "gene": "LRP12", - "evidence": [ - "Strong" - ], - "chrom": "chr8", - "start_hg38": 104588970, - "stop_hg38": 104588999, - "start_hg19": 105601198, - "stop_hg19": 105601227, - "start_t2t": 105716409, - "stop_t2t": 105716441, - "disease": "Oculopharyngodistal myopathy type 1", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Adult-onset ptosis, dysphagia [@pmid:39349043]; External ophthalmoplegia, facial weakness, pharyngeal, and distal limb weakness [@pmid:38876750]; May be slight male predominance [@pmid:34047774].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Population dependent; unknown percentage of LRP12 pathogenic variants. Typically East Asian ancestry [@pmid:38876750]; potentially most frequent cause of OPDM in Japan [@pmid:34047774].", - "age_onset": "Typical: 31-51 [@pmid:34047774]; Range: 7-66 [@pmid:2124290].", - "age_onset_min": 7, - "age_onset_max": 66, - "typ_age_onset_min": 31, - "typ_age_onset_max": 51, - "details": "Benign range (13-45) inferred from cohort data, but pathogenic range isn't yet fully understood [@genereviews:NBK535148]. In a cohort of 65 patients from 59 families, alleles ranged from 85-289 repeats, with an inverse relationship between size and age of onset [@pmid:34047774]. Inherited peripheral neuropathy (IPN) may be associated with shorter expansions [@pmid:39013564]. Interruptions seen: ACG, CCA [@pmid:35245110].", - "detection": "Short-read sequencing has been reported to be unreliable at detecting large expansions [@pmid:40858832]. RP-PCR followed by long-read sequencing is commonly used for characterization [@pmid:39013564].", - "mechanism": "GoF?", - "mechanism_detail": "RNA mediated toxicity hypothesized [@omim:164310]; may involve RAN translation [@pmid:38467784]. Somatic mosaicism and hypermethylation have also been reported [@pmid:41131788].", - "year": "2019 [@pmid:31332380]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CGC" - ], - "pathogenic_motif_reference_orientation": [ - "CGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 13, - "benign_max": 45, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 85, - "pathogenic_max": 289, - "motif_len": 3, - "ref_copies": 11.7, - "novel": "ref", - "gard": [ - "15097" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "OCL076" - ], - "medgen": [ - "1684682" - ], - "mondo": [ - "0020793" - ], - "omim": [ - "164310" - ], - "orphanet": [ - "98897" - ], - "gnomad": [ - "LRP12" - ], - "stripy": [ - "LRP12" - ], - "tr_atlas": [ - "TR88348" - ], - "webstr_hg38": [ - "1082178", - "4874587" - ], - "webstr_hg19": [ - "STR_1441036" - ], - "locus_tags": [ - "somatic_instability", - "anticipation", - "length_affects_onset" - ], - "disease_tags": [ - "oculopharyngodistal_myopathy" - ], - "references": [ - "pmid:34047774", - "pmid:2124290", - "omim:164310", - "pmid:38467784", - "pmid:41131788", - "genereviews:NBK535148", - "pmid:39013564", - "pmid:35245110", - "pmid:38876750", - "pmid:31332380", - "pmid:39349043" - ], - "additional_literature": [ - "pmid:41888971", - "pmid:41792844", - "pmid:41125376", - "pmid:40645757", - "pmid:40417202", - "pmid:40084170", - "pmid:38726482", - "pmid:37923380", - "pmid:37864208", - "pmid:37339631", - "pmid:36052448", - "pmid:35700120", - "pmid:35314910", - "pmid:35152460", - "pmid:35148830", - "pmid:34927285", - "pmid:33693509", - "pmid:33374016", - "pmid:33239111", - "pmid:32493488", - "pmid:27072820" - ] + "motif": "TTTTA", + "count": 17, + "type": "internal_repeat" }, { - "id": "FAME3_MARCHF6", - "disease_id": "FAME3", - "gene": "MARCHF6", - "evidence": [ - "Definitive" - ], - "chrom": "chr5", - "start_hg38": 10356343, - "stop_hg38": 10356411, - "start_hg19": 10356455, - "stop_hg19": 10356523, - "start_t2t": 10295525, - "stop_t2t": 10295593, - "disease": "Familial adult myoclonic epilepsy type 3", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical tremor with epilepsy [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Overall FAME prevalence is < 1/35,000; MARCHF6-caused much smaller. Most cases have European ancestry [@pmid:38876750].", - "age_onset": "Typical: 24-41 based on one 76 member pedigree [@pmid:19616813]; Range: 10 [@omim:613608] - 50 [@pmid:40788430].", - "age_onset_min": 10, - "age_onset_max": 50, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Healthy controls do not have pathogenic allele (TTTCA), but do have 9-20 benign motifs (TTTTA) [@genereviews:NBK535148]. Total allele size in probands spanned from 650-1035 repeats; an inverse relationship between allele size and age of onset was noted [@pmid:31664039, @pmid:40788430]. In one study it was proposed that pathogenicity only occurs when TTTCA is expanded [@pmid:40788430]. RP-PCR can detect the pathogenic TTTCA insertion motif but does not adequately resolve complex TTTTA/TTTCA architecture [@pmid:41268177].", - "detection": "Long-range PCR followed by long-read sequencing has been used to size and determine structure [@pmid:40200849].", - "mechanism": "Unknown", - "mechanism_detail": "Noted as unknown in literature [@omim:613608].", - "year": "2019 [@pmid:31664039]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "TTTTA" - ], - "pathogenic_motif_reference_orientation": [ - "TTTCA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "ATGTT", - "TAGTT", - "TTTTG", - "TTTTT" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "ATGTT", - "AGTTT", - "GTTTT", - "TTTTT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "TTTTA", - "count": 12, - "type": "internal_repeat" - }, - { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 650, - "pathogenic_max": 1035, - "motif_len": 5, - "ref_copies": 13.6, - "novel": "novel", - "gard": [ - "18084" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "EPL053" - ], - "medgen": [ - "462210" - ], - "mondo": [ - "0013322" - ], - "omim": [ - "613608" - ], - "orphanet": [ - "86814" - ], - "gnomad": [ - "MARCHF6" - ], - "stripy": [ - "MARCHF6" - ], - "tr_atlas": [ - "TR51895" - ], - "webstr_hg38": [ - "5994579" - ], - "webstr_hg19": [ - "STR_1116660" - ], - "locus_tags": [ - "somatic_instability", - "motif_affects_onset", - "motif_affects_penetrance", - "motif_affects_severity" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:19616813", - "omim:613608", - "pmid:40788430", - "genereviews:NBK535148", - "pmid:31664039", - "pmid:38876750", - "pmid:39349043" - ], - "additional_literature": [ - "pmid:41268177", - "pmid:41219789", - "pmid:40417743", - "pmid:40200849", - "pmid:33040085" - ] - }, + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 60, + "pathogenic_max": 2200, + "motif_len": 5, + "ref_copies": 17.4, + "novel": "novel", + "gard": ["16758"], + "genereviews": ["NBK535148"], + "malacard": ["EPL228"], + "medgen": ["1648435"], + "mondo": ["0054847"], + "omim": ["618075"], + "orphanet": ["86814"], + "gnomad": ["RAPGEF2"], + "stripy": ["RAPGEF2"], + "tr_atlas": ["TR49300"], + "webstr_hg38": ["154264", "4792219"], + "webstr_hg19": ["STR_1096016"], + "locus_tags": ["motif_affects_penetrance"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:30351492", "pmid:29507423", "pmid:35245110", "pmid:38876750"], + "additional_literature": ["pmid:41219789", "pmid:36092952", "pmid:33040085", "pmid:31483537"] +}, +{ + "id": "CANVAS_RFC1", + "disease_id": "CANVAS", + "gene": "RFC1", + "evidence": ["Definitive"], + "chrom": "chr4", + "start_hg38": 39348424, + "stop_hg38": 39348483, + "start_hg19": 39350044, + "stop_hg19": 39350103, + "start_t2t": 39318077, + "stop_t2t": 39318136, + "disease": "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Sensory disturbances, imbalance, oscillopsia, chronic dry cough, dysarthria and dysphagia [@pmid:38876750]; Late-onset ataxia, sensory neuropathy, vestibular areflexia syndrome [@pmid:39349043]. This expansion has been implicated in the genetic etiology of Parkinson's disease [@pmid:41177915].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Carrier frequency in Europeans is 0.7-4% and in Chinese Han population is 2.24%; estimated prevalence of 1/20,000 to 1/625 [@genereviews:NBK564656]. Many cases are likely not diagnosed due to heterogeneous presentation [@pmid:39230846]. Observed in multiple ethnicities [@pmid:38876750]; patients diagnosed with European, Chinese Han, and Maori ancestry, as well as found in Japan, Canada, Brazil, the UK, Italy, Germany, and Australia [@genereviews:NBK564656].", + "age_onset": "Typical: 36-52; Range: 19-76 [@genereviews:NBK564656].", + "age_onset_min": 19.0, + "age_onset_max": 76.0, + "typ_age_onset_min": 36.0, + "typ_age_onset_max": 52.0, + "details": "Disease is caused by an insertion of a pathogenic motif, although motif presence is variable and can expand up to 200 repeats without apparently causing a phenotype [@genereviews:NBK564656]. Pathogenic expansions (ranging from 400-2750 pathogenic motifs) may be flanked by other motifs [@genereviews:NBK564656]. For example, (AAAGG)10-25(AAGGG)exp(AAAGG)4-6 [@pmid:32851396]. Motif heterogeneity is common in unaffected individuals [@genereviews:NBK564656], and motif associations are described by Delforge et al. [@pmid:38627134]. The pathogenic size threshold appears to differ for the AAAGG motif: AAAGG expansions >= 600 repeats have been observed in CANVAS patients (vs 400 with established pathogenic motif AAGGG), while ~100-380 AAAGG repeats were found in unaffected controls [@pmid:37450567]. Length appears to impact age of onset and disease severity, with particular impact from the smaller allele [@doi:10.1136/jnnp-2024-ABN.259]. Phenotypic spectrum may include Parkinsonism [@pmid:39833204], chronic cough [@pmid:39811557], idiopathic sensory neuropathy, small fiber neuropathy, and sensorimotor neuropathy [@pmid:41964406].", + "detection": "Expansions are suggested by flanking PCR failure and a pathogenic RP-PCR sawtooth pattern, but biallelic confirmation and sizing rely on Southern blotting [@genereviews:NBK564656]. Long-read sequencing or optical genome mapping are useful for resolving this variable, complex motif structure [@pmid:37892228; @pmid:37450567].", + "mechanism": "LoF", + "mechanism_detail": "LoF; exact mechanism unknown [@pmid:38467784].", + "year": "2019 [@pmid:31230722]", + "location_in_gene": "Intron 2", + "gene_strand": "-", + "reference_motif_reference_orientation": ["AAAAG"], + "pathogenic_motif_reference_orientation": ["AAGGG", "ACAGG", "AAAGG", "AGGGC"], + "benign_motif_reference_orientation": ["AAAAG", "AAAGGG"], + "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AACGG", "AAGAC", "AAGGT", "AGGGG", "AAGAG", "AAAAGG", "AAACG", "AACAG", "AGGTG", "ACGGG", "AAAAAG", "AAGGC"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CCCTT", "CCTGT", "CCTTT", "CCCTG"], + "benign_motif_gene_orientation": ["CTTTT", "CCCTTT"], + "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "CCGTT", "CTTGT", "ACCTT", "CCCCT", "CTCTT", "CCTTTT", "CGTTT", "CTGTT", "ACCTC", "CCCGT", "CTTTTT", "CCTTG"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "CHNG3_MIR7-2", - "disease_id": "CHNG3", - "gene": "MIR7-2", - "evidence": [ - "Strong" - ], - "chrom": "chr15", - "start_hg38": 88569433, - "stop_hg38": 88569452, - "start_hg19": 89112664, - "stop_hg19": 89112683, - "start_t2t": 86324038, - "stop_t2t": 86324057, - "disease": "Nongoitrous congenital hypothyroidism-3", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Nongoitrous congenital hypothyroidism-3 (CHNG3) is characterized by infantile-onset clinical and subclinical hypothyroidism associated with a small thyroid gland, high circulating TSH, normal free T4 levels, and normal or mildly increased serum thyroglobulin. Untreated patients or patients who discontinue treatment show a characteristic transition to multinodular goiter (MNG) with age [@omim:609893].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in 12 families, with ancestry including: Irish, White European, French (Normandie), Ashkenazi, French Canadian, Danish/White European, Welsh, Scottish, Italian, British/White European, Italian/Turkish/Lebanese, German/Palestinian, and South Chinese [@pmid:38714868].", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Deletion of one repeat (4 to 3 repeats) found in 10 unrelated families with unsolved disease [@pmid:38714869]; a heterozygous T-to-G transversion in the third repeat can also lead to disease [@pmid:38714868].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Activates a thyroid-specific enhancer [@pmid:38714868; @pmid:38714869].", - "year": "2024 [@pmid:38714869]", - "location_in_gene": "Non-coding", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "TTTG" - ], - "pathogenic_motif_reference_orientation": [ - "TTTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AAAC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 4, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 3, - "pathogenic_max": 3, - "motif_len": 4, - "ref_copies": null, - "novel": "ref", - "gard": [ - "1487" - ], - "genereviews": [], - "malacard": [ - "HYP355" - ], - "medgen": [ - "424853" - ], - "mondo": [ - "0012360" - ], - "omim": [ - "609893" - ], - "orphanet": [], - "gnomad": [ - "PRE-MIR7-2" - ], - "stripy": [], - "tr_atlas": [ - "TR192005" - ], - "webstr_hg38": [ - "5177365" - ], - "webstr_hg19": [ - "STR_492924" - ], - "locus_tags": [ - "contraction" - ], - "disease_tags": [], - "references": [ - "pmid:38714868", - "pmid:38714869", - "omim:609893" - ], - "additional_literature": [] + "motif": "AAAAG", + "count": 11, + "type": "internal_repeat" }, { - "id": "ADTKD_MUC1", - "disease_id": "ADTKD", - "gene": "MUC1", - "evidence": [ - "Definitive" - ], - "chrom": "chr1", - "start_hg38": 155188505, - "stop_hg38": 155192239, - "start_hg19": 155160981, - "stop_hg19": 155162030, - "start_t2t": 154328121, - "stop_t2t": 154330802, - "disease": "Autosomal dominant tubulointerstitial kidney disease", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function [@mondo:0020726].", - "hpo_terms": null, - "prevalence": "2.5/1000000", - "prevalence_details": "Disease is affected 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease [@genereviews:NBK153723]", - "age_onset": "Age of onset for end-stage renal disease (the only systemic manifestation) ranges from 16 [@pmid:41000883]-70 [@genereviews:NBK153723].", - "age_onset_min": 16, - "age_onset_max": 70, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family [@genereviews:NBK535148]. NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif.", - "detection": "This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475]. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40–83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant [@pmid:41285770]. Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants [@genereviews:NBK153723]. Instead, they are commonly detected by a VNTR assay, or resolved with long-read sequencing [@genereviews:NBK153723; @pmid:29520014].", - "mechanism": "GoF", - "mechanism_detail": "Toxic protein product accumulates in kidneys [@genereviews:NBK153723]", - "year": "2013 [@pmid:23396133]", - "location_in_gene": "Coding Exon 2", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG" - ], - "pathogenic_motif_reference_orientation": [ - "GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA" - ], - "benign_motif_reference_orientation": [ - "GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA" - ], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG" - ], - "benign_motif_gene_orientation": [ - "ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG" - ], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": null, - "pathogenic_max": null, - "motif_len": 1, - "ref_copies": null, - "novel": "ref", - "gard": [ - "7002" - ], - "genereviews": [ - "NBK153723" - ], - "malacard": [ - "TBL032" - ], - "medgen": [ - "358137" - ], - "mondo": [ - "0020726" - ], - "omim": [ - "174000" - ], - "orphanet": [ - "88949" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:41000883", - "genereviews:NBK153723", - "genereviews:NBK535148", - "pmid:23396133", - "pmid:39781475", - "doi:10.1101/2025.03.31.646505", - "mondo:0020726" - ], - "additional_literature": [ - "pmid:41961547", - "pmid:41832605", - "pmid:41345522", - "pmid:40244446", - "pmid:39848530", - "pmid:39576755", - "pmid:39325540", - "pmid:39314239", - "pmid:38605207", - "pmid:37547453", - "pmid:37456840", - "pmid:37316299", - "pmid:35982790", - "pmid:35497811", - "pmid:34641504", - "pmid:34452200", - "pmid:33672244", - "pmid:33001366", - "pmid:32451462", - "pmid:32293552", - "pmid:31213370", - "pmid:30593830", - "pmid:29520014", - "pmid:29328069", - "pmid:29217307", - "pmid:29156055", - "pmid:29052568", - "pmid:28581490", - "pmid:28407289", - "pmid:27957769", - "pmid:27036738", - "pmid:27367740", - "pmid:27340743", - "pmid:27157321", - "pmid:26943180", - "pmid:26838233", - "pmid:26693201", - "pmid:26692014", - "pmid:26498650", - "pmid:25753030", - "pmid:24718884", - "pmid:24509297", - "pmid:24416403", - "pmid:24246952", - "pmid:24233342", - "pmid:23778023", - "pmid:23770070", - "pmid:23652307", - "pmid:23317217", - "pmid:23259747", - "pmid:22970023", - "pmid:21998660", - "pmid:21385452", - "pmid:20876819", - "pmid:20562098", - "pmid:20470225", - "pmid:21637607", - "pmid:19811637", - "pmid:19625949", - "pmid:19534821", - "pmid:18619437", - "pmid:18094420", - "pmid:18021186", - "pmid:17974963", - "pmid:17694298", - "pmid:17581677", - "pmid:17203187", - "pmid:17050588", - "pmid:16711252", - "pmid:16631167", - "pmid:16302687", - "pmid:16101182", - "pmid:15991935", - "pmid:15944787", - "pmid:15814824", - "pmid:15729696", - "pmid:15604091", - "pmid:15387710", - "pmid:15115750", - "pmid:15041735", - "pmid:14871854", - "pmid:14707484", - "pmid:12747745", - "pmid:12646731", - "pmid:12626424", - "pmid:12090474", - "pmid:11923240", - "pmid:11445551", - "pmid:11391628", - "pmid:11358826", - "pmid:11295060", - "pmid:11169964", - "pmid:10797294", - "pmid:10741704", - "pmid:10653872", - "pmid:10652432", - "pmid:10541345", - "pmid:10430099", - "pmid:10389761", - "pmid:10383817", - "pmid:10235488", - "pmid:10206297", - "pmid:10052816", - "pmid:10024673", - "pmid:10022471", - "pmid:9935162", - "pmid:9823312", - "pmid:9755875", - "pmid:9727561", - "pmid:9690452", - "pmid:9591045", - "pmid:9579805", - "pmid:9575675", - "pmid:9551361", - "pmid:9427605", - "pmid:9419405", - "pmid:8967520", - "pmid:8643693", - "pmid:7594478", - "pmid:8579785", - "pmid:8567787", - "pmid:8519447", - "pmid:7628867", - "pmid:7816840", - "pmid:7946402", - "pmid:7514493", - "pmid:7690213", - "pmid:7685318" - ] - }, + "motif": "AAGGG", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 0, + "benign_max": 11, + "intermediate_min": 11, + "intermediate_max": 200, + "pathogenic_min": 400, + "pathogenic_max": 2750, + "motif_len": 5, + "ref_copies": 11.8, + "novel": "novel", + "gard": ["17937"], + "genereviews": ["NBK564656"], + "malacard": ["CRB196"], + "medgen": ["482853"], + "mondo": ["0044720"], + "omim": ["614575"], + "orphanet": ["504476"], + "gnomad": ["RFC1"], + "stripy": ["RFC1"], + "tr_atlas": ["TR42349"], + "webstr_hg38": ["4722884", "99101"], + "webstr_hg19": ["STR_1036603"], + "locus_tags": ["motif_affects_penetrance", "length_affects_onset", "length_affects_severity"], + "disease_tags": ["ataxia", "phenotypic_spectrum"], + "references": ["genereviews:NBK564656", "pmid:38467784", "pmid:32851396", "pmid:38627134", "pmid:37450567", "doi:10.1136/jnnp-2024-ABN.259", "pmid:39833204", "pmid:39811557", "pmid:41964406", "pmid:39230846", "pmid:38876750", "pmid:31230722", "pmid:39349043", "pmid:41177915"], + "additional_literature": ["pmid:42178418", "pmid:42096001", "pmid:42094143", "pmid:42038259", "pmid:41840142", "pmid:41780084", "pmid:41689662", "pmid:41614301", "pmid:41592538", "pmid:41532091", "pmid:41426430", "pmid:41327893", "pmid:41322202", "pmid:41278766", "pmid:41145152", "pmid:41118032", "pmid:41084404", "pmid:41074692", "pmid:41055766", "pmid:40898875", "pmid:40894141", "pmid:40802152", "pmid:40765612", "pmid:40637932", "pmid:40595562", "pmid:40594369", "pmid:40488180", "pmid:40481300", "pmid:40461673", "pmid:40417743", "pmid:40313272", "pmid:40273470", "pmid:40221271", "pmid:40211677", "pmid:40204545", "pmid:40141365", "pmid:40113266", "pmid:40007153", "pmid:39812846", "pmid:39721397", "pmid:39571249", "pmid:39543176", "pmid:39507594", "pmid:39416949", "pmid:39406499", "pmid:39342186", "pmid:39286915", "pmid:39231235", "pmid:39219417", "pmid:39152783", "pmid:39076534", "pmid:38978724", "pmid:38916676", "pmid:38789445", "pmid:38579416", "pmid:38487929", "pmid:38447794", "pmid:38381906", "pmid:38381176", "pmid:38324175", "pmid:38311638", "pmid:38306376", "pmid:38266156", "pmid:38193360", "pmid:38168171", "pmid:38145611", "pmid:38062616", "pmid:38054570", "pmid:37917284", "pmid:37892228", "pmid:37853169", "pmid:37747091", "pmid:37660923", "pmid:37578187", "pmid:37546920", "pmid:37476326", "pmid:37460231", "pmid:37414537", "pmid:37399286", "pmid:36805468", "pmid:36753892", "pmid:36705320", "pmid:36381255", "pmid:36289003", "pmid:36250766", "pmid:36227727", "pmid:36214978", "pmid:36177974", "pmid:36088850", "pmid:36061987", "pmid:36046423", "pmid:36034314", "pmid:35884855", "pmid:35883251", "pmid:35864213", "pmid:35633373", "pmid:35585435", "pmid:35502508", "pmid:35355059", "pmid:35306791", "pmid:35253317", "pmid:38835435", "pmid:35013364", "pmid:34968871", "pmid:34927205", "pmid:34600502", "pmid:34537679", "pmid:34101140", "pmid:33969391", "pmid:33940977", "pmid:33884451", "pmid:33807868", "pmid:33745133", "pmid:33666721", "pmid:33495376", "pmid:33188504", "pmid:33103729", "pmid:33068477", "pmid:33068476", "pmid:32949124", "pmid:32939785", "pmid:32910249", "pmid:32873692", "pmid:32732387", "pmid:32694621", "pmid:32682126", "pmid:32582864", "pmid:32151945", "pmid:32066831", "pmid:32040566", "pmid:31824583", "pmid:31817852", "pmid:31370354", "pmid:30926972", "pmid:25648260", "pmid:25007187", "pmid:24686188", "pmid:22086855", "pmid:15457444", "pmid:12556494"] +}, +{ + "id": "OPDM4_RILPL1", + "disease_id": "OPDM4", + "gene": "RILPL1", + "evidence": ["Moderate"], + "chrom": "chr12", + "start_hg38": 123533720, + "stop_hg38": 123533750, + "start_hg19": 124018267, + "stop_hg19": 124018297, + "start_t2t": 123532573, + "stop_t2t": 123532603, + "disease": "Oculopharyngodistal myopathy type 4", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Population dependent: 21.6% of one OPDM cohort [@pmid:35148830]. Typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 18-30 [@pmid:35148830]; Range: 10-30 [@pmid:35700120].", + "age_onset_min": 10.0, + "age_onset_max": 30.0, + "typ_age_onset_min": 18.0, + "typ_age_onset_max": 30.0, + "details": "Benign alleles have been documented to have 6-16 repeats [@pmid:37864208], while pathogenic repeats range from 120 to 197 repeats; there is no apparent relationship between allele size and age of onset [@pmid:37864208; @pmid:35148830]. Intermediate alleles may be associated with incomplete penetrance, or milder phenotypes [@pmid:35148830]. AGG, TGG, and CGT interruptions observed [@pmid:35148830; @pmid:35700120].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to RNA-mediated gain-of-function mechanism [@pmid:38467784].", + "year": "2022 [@pmid:35148830]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GGC"], + "pathogenic_motif_reference_orientation": ["GGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["TGG", "CGT", "AGG"], + "pathogenic_motif_gene_orientation": ["CCG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["ACC", "ACG", "CCT"], + "locus_structure": [], + "benign_min": 6, + "benign_max": 16, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 120, + "pathogenic_max": 197, + "motif_len": 3, + "ref_copies": 11.7, + "novel": "ref", + "gard": ["12592"], + "genereviews": [], + "malacard": ["OCL085"], + "medgen": ["1809981"], + "mondo": ["0030712"], + "omim": [], + "orphanet": ["98897"], + "gnomad": ["RILPL1"], + "stripy": ["RILPL1"], + "tr_atlas": ["TR121403"], + "webstr_hg38": ["5128610", "609239"], + "webstr_hg19": ["STR_347096"], + "locus_tags": [], + "disease_tags": ["oculopharyngodistal_myopathy"], + "references": ["pmid:35148830", "pmid:35700120", "pmid:38467784", "pmid:37864208", "pmid:38876750"], + "additional_literature": ["pmid:41792844", "pmid:40645757", "pmid:40084170", "pmid:39044557", "pmid:39013564", "pmid:37923380"] +}, +{ + "id": "CCD_RUNX2", + "disease_id": "CCD", + "gene": "RUNX2", + "evidence": ["Definitive"], + "chrom": "chr6", + "start_hg38": 45422750, + "stop_hg38": 45422801, + "start_hg19": 45390487, + "stop_hg19": 45390538, + "start_t2t": 45257567, + "stop_t2t": 45257618, + "disease": "Cleidocranial dysplasia", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "A condition that primarily affects the development of the bones and teeth. Characteristic features include underdeveloped or absent collarbones (clavicles); dental abnormalities; and delayed closing of the spaces between the skull bones (fontanels). Other features may include decreased bone density (osteopenia), osteoporosis, hearing loss, bone abnormalities of the hands, and recurrent sinus and ear infections [@mondo:0007340].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "All conditions 1/1,000,000 births (likely underdiagnosed); Utah population frequency 0.12/10,000. Found in many ethnic groups [@orphanet:1452]. TR expansions causative in 2 individuals [@genereviews:NBK535148].", + "age_onset": "0 (birth) [@genereviews:NBK1513].", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (4-17 repeats) established from gnomAD and primary literature; pathogenic ranges (20-27) reflect two clinical cases to date [@gnomad:RUNX2; @pmid:26220009]. Intermediate alleles (i.e, 18 repeats; 19 not reported) appear to not be associated with disease [@pmid:20560987; @pmid:26220009]. The gene RUNX2 was previously called CBFA1, as reflected in some of the literature [@pmid:9182765].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansion leading to haploinsufficiency [@pmid:26220009].", + "year": "Causation identified in 2015 [@pmid:26220009]; clinical association found in 1997 [@pmid:9182765]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 4, + "benign_max": 17, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 20, + "pathogenic_max": 27, + "motif_len": 3, + "ref_copies": 15.0, + "novel": "ref", + "gard": ["6118"], + "genereviews": ["NBK1513"], + "malacard": ["CLD001"], + "medgen": ["3486"], + "mondo": ["0007340"], + "omim": ["119600"], + "orphanet": ["1452"], + "gnomad": ["RUNX2"], + "stripy": ["RUNX2"], + "tr_atlas": ["TR65117"], + "webstr_hg38": ["5789216"], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["genereviews:NBK1513", "pmid:26220009", "gnomad:RUNX2", "pmid:20560987", "pmid:9182765", "orphanet:1452", "genereviews:NBK535148", "mondo:0007340"], + "additional_literature": ["pmid:41468806", "pmid:40585427", "pmid:37365568", "pmid:37202645", "pmid:32386547", "pmid:24497578", "pmid:22912713", "pmid:21887706", "pmid:19264154"] +}, +{ + "id": "FAME1_SAMD12", + "disease_id": "FAME1", + "gene": "SAMD12", + "evidence": ["Definitive"], + "chrom": "chr8", + "start_hg38": 118366812, + "stop_hg38": 118366918, + "start_hg19": 119379051, + "stop_hg19": 119379157, + "start_t2t": 119495247, + "stop_t2t": 119495353, + "disease": "Familial adult myoclonic epilepsy type 1", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical myoclonus, with seizures in up to a half of patients [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. Typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 21-39 [@pmid:29939203]; Range: 8 [@pmid:40503331] - 68 [@pmid:29507423].", + "age_onset_min": 8.0, + "age_onset_max": 68.0, + "typ_age_onset_min": 21.0, + "typ_age_onset_max": 39.0, + "details": "Novel, pathogenic alleles include expansions of TTTTAn + TTTCAn, but only the TTTCA insertion is specific to affected individuals and associated with symptom age of onset [@pmid:39569876]; pathogenic expansions range from 105 to 3860 repeats [@omim:601068; @pmid:29507423]", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA mediated gain of function proposed [@omim:601068; @pmid:38467784].", + "year": "2018 [@pmid:29507423]", + "location_in_gene": "Intron 4/4", + "gene_strand": "-", + "reference_motif_reference_orientation": ["TAAAA"], + "pathogenic_motif_reference_orientation": ["TGAAA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["AAAAA", "TAAAC", "TAACA", "TACAA", "TACAC"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["TTTTT", "AGTTT", "ATGTT", "ATTGT", "AGTGT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "NME_NAXE", - "disease_id": "NME", - "gene": "NAXE", - "evidence": [ - "Limited" - ], - "chrom": "chr1", - "start_hg38": 156591765, - "stop_hg38": 156591783, - "start_hg19": 156561557, - "stop_hg19": 156561575, - "start_t2t": 155728131, - "stop_t2t": 155728159, - "disease": "NAXE-related mitochondrial encephalopathy", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Patients with NAXE-related mitochondrial encephalopathy exhibit developmental delay, cognitive regression, altered consciousness, abnormalities in eye movement (including nystagmus), muscle weakness, respiratory failure, seizure, ataxia, and gait disturbance at the age of 1 to 2 years. The disease is characterized by fluctuating symptoms over time, often exacerbated by febrile illness; it is progressive and fatal in the long term [@pmid:39455596].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Single proband found in Japanese cohort [@pmid:39455596].", - "age_onset": "Single repeat expansion case had onset at 13 months, while NAXE-related mitochondrial encephalopathy more generally has predominately infantile onset, extending to 20y or older [@pmid:39455596].", - "age_onset_min": 1, - "age_onset_max": 1, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (2-7) alleles established by 484 control alleles and validated with orthogonal databases, while single proband had expansion of ~200 repeats inherited from mother via uniparental disomy [@pmid:39455596]. While the repeat expansion is newly reported, other variants in the NAXE gene have previously been associated with mitochondrial encephalopathy.", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Reduced NAXE expression from expansion in promoter; hypermethylation was detected at and downstream of the repeat sequence in the proband as well as the maternal copy of the expanded allele, which was not present in the maternal normal range allele nor in the controls [@pmid:39455596]", - "year": "2024 [@pmid:39455596]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGGCC" - ], - "pathogenic_motif_reference_orientation": [ - "GGGCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCGGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 7, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 200, - "pathogenic_max": 200, - "motif_len": 5, - "ref_copies": null, - "novel": "ref", - "gard": [ - "17991" - ], - "genereviews": [], - "malacard": [ - "ENC069" - ], - "medgen": [ - "934642" - ], - "mondo": [ - "0020781" - ], - "omim": [ - "617186" - ], - "orphanet": [ - "555407" - ], - "gnomad": [ - "NAXE" - ], - "stripy": [], - "tr_atlas": [ - "TR7952" - ], - "webstr_hg38": [ - "1184343", - "6351240" - ], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:39455596" - ], - "additional_literature": [ - "pmid:41091881" - ] + "motif": "TAAAA", + "count": 20, + "type": "internal_repeat" }, { - "id": "ALS1_NIPA1", - "disease_id": "ALS1", - "gene": "NIPA1", - "evidence": [ - "Disputed" - ], - "chrom": "chr15", - "start_hg38": 22786677, - "stop_hg38": 22786703, - "start_hg19": 23086363, - "stop_hg19": 23086389, - "start_t2t": 20458510, - "stop_t2t": 20458536, - "disease": "Amyotrophic lateral sclerosis", - "inheritance": [ - "AD" - ], - "association_type": [ - "Modifier" - ], - "disease_description": "Amyotrophic lateral sclerosis is a neurodegenerative disorder characterized by the death of motor neurons in the brain, brainstem, and spinal cord, resulting in fatal paralysis. ALS usually begins with asymmetric involvement of the muscles in middle adult life [@omim:105400].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "2.7-7.4/100,000 for all cases of ALS, NIPA1 + C9orf72 is 0.37% of ALS patients; frequency of NIPA1 expansion in controls is 3.74% [@pmid:31286297]. The NIPA1 expansion is associated with disease globally [@pmid:30342764], but likely unassociated in African probands [@pmid:34179866].", - "age_onset": "Typical: 44-60 [@pmid:26777436]; Range: 25 [@pmid:22378146] - 77 [@pmid:26777436].", - "age_onset_min": 25, - "age_onset_max": 77, - "typ_age_onset_min": 44, - "typ_age_onset_max": 60, - "details": "Allelic ranges taken from STRipy based on primary literature [@stripy:NIPA1]. Currently proposed as a modifier for ALS [@pmid:31286297]. Note: the motif for this locus is CGG in hg38 and T2T reference genomes, while in hg19, the motif is the reverse complement CCG because it is on the negative strand. GCA, GCT, and GCC interruptions have been reported [@pmid:40585427].", - "detection": null, - "mechanism": null, - "mechanism_detail": null, - "year": "2019 [@pmid:30342764]", - "location_in_gene": "Coding Exon 1/Intron 1 depending on transcript", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCG" - ], - "pathogenic_motif_reference_orientation": [ - "GCG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "GCA", - "GCT", - "GCC" - ], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AGC", - "CTG", - "CCG" - ], - "locus_structure": [], - "benign_min": 6, - "benign_max": 10, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 11, - "pathogenic_max": 56, - "motif_len": 3, - "ref_copies": 10.7, - "novel": "ref", - "gard": [ - "5786" - ], - "genereviews": [], - "malacard": [ - "FRN044" - ], - "medgen": [ - "400169" - ], - "mondo": [ - "0007103" - ], - "omim": [ - "105400" - ], - "orphanet": [ - "282", - "803" - ], - "gnomad": [ - "NIPA1" - ], - "stripy": [ - "NIPA1" - ], - "tr_atlas": [ - "TR133649" - ], - "webstr_hg38": [ - "5135087" - ], - "webstr_hg19": [], - "locus_tags": [ - "proposed_modifier" - ], - "disease_tags": [], - "references": [ - "pmid:26777436", - "pmid:22378146", - "stripy:NIPA1", - "pmid:31286297", - "pmid:40585427", - "pmid:30342764", - "pmid:34179866", - "omim:105400" - ], - "additional_literature": [ - "pmid:41426430", - "pmid:38667292", - "pmid:37043475", - "pmid:35869263", - "pmid:33414559", - "pmid:32954321", - "pmid:24866401", - "pmid:21419568", - "pmid:11839840", - "pmid:10987648", - "pmid:9736780" - ] - }, + "motif": "TGAAA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 105, + "pathogenic_max": 3680, + "motif_len": 5, + "ref_copies": 21.6, + "novel": "novel", + "gard": ["18082"], + "genereviews": ["NBK535148"], + "malacard": ["EPL201"], + "medgen": ["371424"], + "mondo": ["0010985"], + "omim": ["601068"], + "orphanet": ["86814"], + "gnomad": ["SAMD12"], + "stripy": ["SAMD12"], + "tr_atlas": ["TR89226"], + "webstr_hg38": ["1087693"], + "webstr_hg19": [], + "locus_tags": ["somatic_instability", "anticipation", "motif_affects_instability", "motif_affects_onset", "motif_affects_penetrance", "maternal_expansion"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:29939203", "pmid:40503331", "pmid:29507423", "omim:601068", "pmid:38467784", "pmid:39569876", "pmid:38876750", "pmid:39349043"], + "additional_literature": ["pmid:41874439", "pmid:41850906", "pmid:41426430", "pmid:41219789", "pmid:38961870", "pmid:38467733", "pmid:38059543", "pmid:37592133", "pmid:36740228", "pmid:36622139", "pmid:36092952", "pmid:33791773", "pmid:33721773", "pmid:33681653", "pmid:33501421", "pmid:33040085", "pmid:32973343", "pmid:32203200", "pmid:32194077", "pmid:32174879", "pmid:31664039", "pmid:31483537", "pmid:30559482", "pmid:30351492", "pmid:30194086"] +}, +{ + "id": "XLID_SOX3", + "disease_id": "XLID, PHPX", + "gene": "SOX3", + "evidence": ["Limited"], + "chrom": "chrX", + "start_hg38": 140504316, + "stop_hg38": 140504361, + "start_hg19": 139586481, + "stop_hg19": 139586526, + "start_t2t": 138816203, + "stop_t2t": 138816248, + "disease": "X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX)", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without intellectual disability [@pmid:24346842].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "3 families reported, however they were distributed across the world [@omim:300123].", + "age_onset": "Typical: 0-3 (small sample size) [@pmid:19654509; @pmid:21289259]; range: 0-9 [@pmid:19654509].", + "age_onset_min": 0.0, + "age_onset_max": 9.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148]. There is phenotypic and allelic overlap between XLID and PHPX, with the pathogenic threshold for XLID estimated at 26 motifs and the pathogenic threshold for PHPX estimated at 22 motifs [@pmid:15800844, @pmid:12428212].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansions leading to aggresome formation and impaired transcriptional activity [@pmid:17127446].", + "year": "2002 [@pmid:12428212]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["NGC"], + "pathogenic_motif_reference_orientation": ["NGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 22, + "pathogenic_max": 26, + "motif_len": 3, + "ref_copies": 15.0, + "novel": "ref", + "gard": [], + "genereviews": ["NBK535148"], + "malacard": ["PNH005", "INT405"], + "medgen": ["394771"], + "mondo": ["0010252"], + "omim": ["300123", "312000"], + "orphanet": ["67045"], + "gnomad": ["SOX3"], + "stripy": ["SOX3"], + "tr_atlas": ["TR173479"], + "webstr_hg38": [], + "webstr_hg19": ["STR_1597784"], + "locus_tags": ["contraction"], + "disease_tags": [], + "references": ["pmid:19654509", "pmid:21289259", "pmid:17127446", "genereviews:NBK535148", "pmid:15800844", "pmid:12428212", "omim:300123", "pmid:24346842"], + "additional_literature": [] +}, +{ + "id": "FAME2_STARD7", + "disease_id": "FAME2", + "gene": "STARD7", + "evidence": ["Strong"], + "chrom": "chr2", + "start_hg38": 96197066, + "stop_hg38": 96197124, + "start_hg19": 96862804, + "stop_hg19": 96862862, + "start_t2t": 96703674, + "stop_t2t": 96703732, + "disease": "Familial adult myoclonic epilepsy 2", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Finger, hand tremor with later-onset myoclonus and generalised tonic-clonic seizures [@pmid:39349043].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "This repeat expansion is typically found in individuals of European ancestry [@pmid:38876750].", + "age_onset": "Typical: 12-30; Range: 4-60 [@pmid:31664034].", + "age_onset_min": 4.0, + "age_onset_max": 60.0, + "typ_age_onset_min": 12.0, + "typ_age_onset_max": 30.0, + "details": "Disease caused by novel insertion of pathogenic motif (not found in any controls); size of pathogenic motif observed in two probands ranged from ~274-558 repeats, while the expanded reference motif ranged from 340-390 [@pmid:31664034].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity theorized [@pmid:31664034; @pmid:38467784].", + "year": "2019 [@pmid:31664034]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["AAAAT"], + "pathogenic_motif_reference_orientation": ["AAATG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["AAAAA", "AAAAC", "AAACC", "AAACG", "AAACT", "AACTC", "AACTG", "AATAC", "AATAG", "ATAAC"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["TTTTT", "GTTTT", "GGTTT", "CGTTT", "AGTTT", "AGTTG", "AGTTC", "ATTGT", "ATTCT", "ATGTT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "SCA36_NOP56", - "disease_id": "SCA36", - "gene": "NOP56", - "evidence": [ - "Definitive" - ], - "chrom": "chr20", - "start_hg38": 2652732, - "stop_hg38": 2652757, - "start_hg19": 2633378, - "stop_hg19": 2633403, - "start_t2t": 2683189, - "stop_t2t": 2683230, - "disease": "Spinocerebellar ataxia type 36", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 36 (SCA36) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1) characterized by gait and limb ataxia, lower limb spasticity, dysarthria, muscle fasciculations, tongue atrophy and hyperreflexia [@mondo:0013594].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Western Japan: 3.6% of all SCA; Costa da Morte region of Spain: 6.3% of all SCA [@pmid:37332636]; US: 0.7% of large undiagnosed ataxia cohort [@pmid:28761930]. Found across ancestries/ethnicities [@omim:614153].", - "age_onset": "Typical: 40-60 [@pmid:25101480]; Range: 28 [@pmid:37810464] - 67 [@pmid:37332636].", - "age_onset_min": 28, - "age_onset_max": 67, - "typ_age_onset_min": 40, - "typ_age_onset_max": 60, - "details": "Benign alleles range from 3-14 repeats and pathogenic alleles (650+ repeats) appear fully penetrant; the significance of intermediate alleles has yet to be elucidated [@pmid:25101480]. Interruptions documented: GGCTG, GGCCCTG, GGCCG, and GGCCTTG [@pmid:37051597].", - "detection": "RP-PCR with fragment analysis has been used to detect these expansions [@pmid:21683323]. Long-read sequencing has accurately sized alleles [@pmid:37051597].", - "mechanism": "GoF", - "mechanism_detail": "Toxic protein gain-of-function, RAN translation [@omim:614153].", - "year": "2011 [@pmid:21683323]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGCCTG" - ], - "pathogenic_motif_reference_orientation": [ - "GGCCTG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "GGCTG", - "GGCCCTG", - "GGCCG", - "GGCCTT" - ], - "pathogenic_motif_gene_orientation": [ - "CCTGGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "CTGGG", - "CCCTGGG", - "CCGGG", - "CCTTGG" - ], - "locus_structure": [ - { - "motif": "GGCCTG", - "count": null, - "type": "pathogenic_repeat" - }, - { - "motif": "CGCCTG", - "count": 3, - "type": "flank_repeat" - } - ], - "benign_min": 3, - "benign_max": 14, - "intermediate_min": 15, - "intermediate_max": 649, - "pathogenic_min": 650, - "pathogenic_max": 2500, - "motif_len": 6, - "ref_copies": 7.2, - "novel": "ref", - "gard": [ - "12367" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "SPN265" - ], - "medgen": [ - "483339" - ], - "mondo": [ - "0013594" - ], - "omim": [ - "614153" - ], - "orphanet": [ - "276198" - ], - "gnomad": [ - "NOP56" - ], - "stripy": [ - "NOP56" - ], - "tr_atlas": [ - "TR157810", - "TR157811" - ], - "webstr_hg38": [ - "6177296", - "890490" - ], - "webstr_hg19": [ - "STR_833720" - ], - "locus_tags": [ - "somatic_instability", - "length_affects_onset", - "length_affects_severity" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "pmid:25101480", - "pmid:37810464", - "pmid:37332636", - "omim:614153", - "pmid:37051597", - "pmid:28761930", - "pmid:21683323", - "mondo:0013594" - ], - "additional_literature": [ - "pmid:42038259", - "pmid:41337098", - "pmid:41074692", - "pmid:40898875", - "pmid:40765612", - "pmid:40488180", - "pmid:40015643", - "pmid:40004498", - "pmid:38961870", - "pmid:38934198", - "pmid:38811808", - "pmid:38667292", - "pmid:38227102", - "pmid:36599645", - "pmid:36572080", - "pmid:36530930", - "pmid:35599735", - "pmid:35077744", - "pmid:34179866", - "pmid:33705846", - "pmid:32989102", - "pmid:32407596", - "pmid:32375063", - "pmid:32375043", - "pmid:32270466", - "pmid:31737797", - "pmid:30610877", - "pmid:30109267", - "pmid:29316893", - "pmid:29281254", - "pmid:28918022", - "pmid:27123487", - "pmid:26661328", - "pmid:25476002", - "pmid:24985895", - "pmid:24269018", - "pmid:22744658", - "pmid:22492559" - ] + "motif": "AAATG", + "count": null, + "type": "pathogenic_repeat" }, { - "id": "NIID_NOTCH2NLC", - "disease_id": "NIID", - "gene": "NOTCH2NLC", - "evidence": [ - "Definitive" - ], - "chrom": "chr1", - "start_hg38": 149390802, - "stop_hg38": 149390842, - "start_hg19": 145209323, - "stop_hg19": 145209354, - "start_t2t": 148519695, - "stop_t2t": 148519738, - "disease": "Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss [@mondo:0011327]. Often presents with gastrointestinal symptoms, including chronic refractory nausea, which can precede neurologic manifestations by decades in one documented case [pmid:41929501]. Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms [@pmid:42058219; @pmid:42005169]. Subclinical peripheral neuropathy has been reported in NOTCH2NLC-related NIID [@pmid:42001002]. Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.", - "hpo_terms": [], - "prevalence": null, - "prevalence_details": ">400 patients reported in literature [@pmid:37371433]. Found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 30-70 [@omim:603472]; Range: 10 [@pmid:37090934] - 78 [@pmid:37305750].", - "age_onset_min": 10, - "age_onset_max": 78, - "typ_age_onset_min": 30, - "typ_age_onset_max": 70, - "details": "Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats [@genereviews:NBK535148]. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype [@pmid:39055960; @pmid:39496005]: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders [@pmid:31178126]. Age of onset inversely related to allele size [@pmid:38377026]. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype [@pmid:34718964]. Interruptions documented: GGA, GGG [@pmid:35245110]; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed [@pmid:38467784]. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.", - "detection": "Short-read sequencing is reported to be unreliable for sizing of large or complex expansions [@pmid:34034831]. RP-PCR has screened for expansions [@pmid:37371433], while long-read sequencing has resolved size, structure, and methylation [@pmid:34774111].", - "mechanism": "GoF", - "mechanism_detail": "Polyglycine expansion; may relate to methylation or RNA pathogenicity [@omim:603472; @pmid:36169768; @pmid:38467784]. Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation [@pmid:42058219]. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy [@pmid:39920690]. Tau pathology is evident, changes in p-tau levels and tau deposition have been reported [@pmid:41539185]. Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression [@pmid:41942455].", - "year": "2019 [@pmid:31332380]", - "location_in_gene": "5' UTR", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGC" - ], - "pathogenic_motif_reference_orientation": [ - "GGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "GGA", - "AGC" - ], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AGG", - "AGC" - ], - "locus_structure": [], - "benign_min": 7, - "benign_max": 37, - "intermediate_min": 38, - "intermediate_max": 65, - "pathogenic_min": 66, - "pathogenic_max": 517, - "motif_len": 3, - "ref_copies": 13.3, - "novel": "ref", - "gard": [ - "3971" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "NRN008" - ], - "medgen": [ - "355075" - ], - "mondo": [ - "0011327" - ], - "omim": [ - "603472", - "619473" - ], - "orphanet": [ - "2289" - ], - "gnomad": [ - "NOTCH2NLC" - ], - "stripy": [ - "NOTCH2NLC" - ], - "tr_atlas": [ - "TR7525" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [ - "somatic_instability", - "paternal_expansion", - "length_affects_onset", - "length_affects_phenotype", - "motif_affects_onset", - "motif_affects_phenotype" - ], - "disease_tags": [ - "phenotypic_spectrum" - ], - "references": [ - "omim:603472", - "pmid:37090934", - "pmid:37305750", - "pmid:36169768", - "pmid:38467784", - "pmid:42058219", - "doi:10.1186/s12964-025-02079-1", - "pmid:41539185", - "pmid:41942455", - "genereviews:NBK535148", - "pmid:39055960", - "pmid:39496005", - "pmid:31178126", - "pmid:38377026", - "pmid:34718964", - "pmid:35245110", - "pmid:37371433", - "pmid:38876750", - "pmid:31332380", - "mondo:0011327", - "pmid:41929501", - "pmid:42005169" - ], - "additional_literature": [ - "pmid:42058219", - "pmid:42033810", - "pmid:42021030", - "pmid:42015293", - "pmid:42005169", - "pmid:41964975", - "pmid:41942455", - "pmid:41929501", - "pmid:41888971", - "pmid:41882342", - "pmid:41862851", - "pmid:41792844", - "pmid:41762523", - "pmid:41756172", - "pmid:41731582", - "pmid:41688968", - "pmid:41634634", - "pmid:41556371", - "pmid:41526374", - "pmid:41235412", - "pmid:41154122", - "pmid:41074692", - "pmid:40934004", - "pmid:40879637", - "pmid:40765612", - "pmid:40708231", - "pmid:40645757", - "pmid:40635536", - "pmid:40609325", - "pmid:40517194", - "pmid:40515658", - "pmid:40514451", - "pmid:40267536", - "pmid:40084170", - "pmid:39936620", - "pmid:39920690", - "pmid:39609868", - "pmid:39529621", - "pmid:39505310", - "pmid:39492694", - "pmid:39418922", - "pmid:39167540", - "pmid:39078482", - "pmid:38779172", - "pmid:38667292", - "pmid:38579412", - "pmid:38477063", - "pmid:38288273", - "pmid:38145851", - "pmid:37975799", - "pmid:37923380", - "pmid:37864208", - "pmid:37823700", - "pmid:37644522", - "pmid:37365282", - "pmid:37271829", - "pmid:37237429", - "pmid:37184590", - "pmid:37131242", - "pmid:37001413", - "pmid:36948577", - "pmid:36942588", - "pmid:36825461", - "pmid:36823368", - "pmid:36809423", - "pmid:36715780", - "pmid:36672065", - "pmid:36621630", - "pmid:36588885", - "pmid:36570826", - "pmid:36545534", - "pmid:36483830", - "pmid:36458450", - "pmid:36417528", - "pmid:36263606", - "pmid:36216675", - "pmid:36207023", - "pmid:36191230", - "pmid:36172483", - "pmid:36150977", - "pmid:36086903", - "pmid:36061987", - "pmid:36041634", - "pmid:36033605", - "pmid:35974122", - "pmid:35866887", - "pmid:35857137", - "pmid:35838850", - "pmid:35788208", - "pmid:35772299", - "pmid:35700120", - "pmid:35419641", - "pmid:35411397", - "pmid:35402653", - "pmid:35366689", - "pmid:35314910", - "pmid:35297556", - "pmid:35180462", - "pmid:35152460", - "pmid:35148830", - "pmid:35147270", - "pmid:34927285", - "pmid:34797461", - "pmid:34774111", - "pmid:34750918", - "pmid:34694469", - "pmid:34675106", - "pmid:34641814", - "pmid:34392981", - "pmid:34306035", - "pmid:34243731", - "pmid:34054431", - "pmid:34017298", - "pmid:33943039", - "pmid:33887199", - "pmid:33871559", - "pmid:33871549", - "pmid:33766934", - "pmid:33693509", - "pmid:33679585", - "pmid:33626493", - "pmid:33625684", - "pmid:33388663", - "pmid:33377220", - "pmid:33377207", - "pmid:33239111", - "pmid:33201994", - "pmid:33201988", - "pmid:33146692", - "pmid:33146671", - "pmid:33026126", - "pmid:33016348", - "pmid:32989102", - "pmid:32931575", - "pmid:32852534", - "pmid:32827029", - "pmid:32817896", - "pmid:32777174", - "pmid:32768149", - "pmid:32602554", - "pmid:32535679", - "pmid:32516806", - "pmid:32495371", - "pmid:32449905", - "pmid:32268889", - "pmid:32250060", - "pmid:32081467", - "pmid:32039647", - "pmid:31886491", - "pmid:31819945", - "pmid:31433517", - "pmid:31413119", - "pmid:31332381" - ] - }, + "motif": "AAAAT", + "count": 11, + "type": "internal_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 274, + "pathogenic_max": 558, + "motif_len": 5, + "ref_copies": 11.6, + "novel": "novel", + "gard": ["18083"], + "genereviews": ["NBK535148"], + "malacard": ["EPL203"], + "medgen": ["375031"], + "mondo": ["0011930"], + "omim": ["607876"], + "orphanet": ["86814"], + "gnomad": ["STARD7"], + "stripy": ["STARD7"], + "tr_atlas": ["TR19329"], + "webstr_hg38": ["286156"], + "webstr_hg19": ["STR_754470"], + "locus_tags": ["somatic_instability", "motif_affects_instability", "motif_affects_penetrance"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:31664034", "pmid:38467784", "pmid:38876750", "pmid:39349043"], + "additional_literature": ["pmid:41219789", "pmid:33040085"] +}, +{ + "id": "XDP_TAF1", + "disease_id": "XDP", + "gene": "TAF1", + "evidence": ["Definitive"], + "chrom": "chrX", + "start_hg38": 71453054, + "stop_hg38": 71453131, + "start_hg19": 70672904, + "stop_hg19": 70672981, + "start_t2t": 69887153, + "stop_t2t": 69887230, + "disease": "X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3)", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "X-linked dystonia-parkinsonism (XDP) associated with antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron of TAF1. Clinical features include focal and generalised dystonia, parkinsonism, cognitive dysfunction. XX individuals who are heterozygous carriers usually do not develop the full syndrome, although some patients have non-progressive focal dystonia with parkinsonism. Disease severity is associated with number of hexanucleotide repeats within the SVA. (Adapted) [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Philippines overall 0.34:100,000. Panay Islands 5.24:100,000. Capiz province 18.9:100,000. To date, all known cases to date are of Filipino descent [@pmid:38876750].", + "age_onset": "Average age of onset for XDP is 39.7 years in males, 52 years in females, range 12-79 years. ~99% of cases are male [@pmid:29229810; @pmid:38876750; @pmid:15596620].", + "age_onset_min": 12.0, + "age_onset_max": 79.0, + "typ_age_onset_min": 39.7, + "typ_age_onset_max": 39.7, + "details": "Strong inverse relationship between age of onset and insertion length, which varied between 35-52 repeats [@pmid:29229810].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Altered splicing with intron retention, haploinsufficiency [@pmid:38876750].", + "year": "2017 [@pmid:29229810]", + "location_in_gene": "Intron 32", + "gene_strand": "+", + "reference_motif_reference_orientation": ["AGAGGG"], + "pathogenic_motif_reference_orientation": ["AGAGGG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGAGGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 35, + "pathogenic_max": 52, + "motif_len": 6, + "ref_copies": 4.0, + "novel": "ref", + "gard": ["10533"], + "genereviews": ["NBK1489"], + "malacard": ["DYS064"], + "medgen": ["326820"], + "mondo": ["0010747"], + "omim": ["314250"], + "orphanet": ["53351"], + "gnomad": [], + "stripy": [], + "tr_atlas": ["TR592600"], + "webstr_hg38": ["861907"], + "webstr_hg19": ["STR_1564408"], + "locus_tags": ["length_affects_onset"], + "disease_tags": [], + "references": ["pmid:29229810", "pmid:38876750", "pmid:15596620"], + "additional_literature": ["pmid:41443196", "pmid:40463055", "pmid:38834915", "pmid:38616406", "pmid:37234925", "pmid:35971992", "pmid:38835911", "pmid:35868859", "pmid:35481544", "pmid:35395816", "pmid:38835428", "pmid:34250228", "pmid:34111553", "pmid:32533168", "pmid:32152096", "pmid:27806289", "pmid:18952144", "pmid:18713817", "pmid:17273961", "pmid:7668293", "pmid:7829058", "pmid:1518853"] +}, +{ + "id": "OPDM_TBC1D7", + "disease_id": "OPDM", + "gene": "TBC1D7", + "evidence": ["Provisional"], + "chrom": "chr6", + "start_hg38": 13328476, + "stop_hg38": 13328603, + "start_hg19": 13328708, + "stop_hg19": 13328835, + "start_t2t": 13201716, + "stop_t2t": 13201843, + "disease": "Oculopharyngodistal myopathy", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "This is a newly proposed locus for OPDM, only having been reported in one paper [@pmid:41959811]. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in 3 families (7 total patients) of European ancestry [@pmid:41959811].", + "age_onset": "2nd to 6th decade (3/5 patients had onset in 2nd decade). Referred to as adult onset, so assuming high end of 2nd decade [@pmid:41959811]", + "age_onset_min": 18.0, + "age_onset_max": 59.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Benign range (0-60) estimated from population data and pathogenic range (83-148) gathered from 7 patients from 3 unrelated families [@pmid:41959811]. The hg38 coordinates reported in the paper (chr6:13328476-13328603) [@pmid:41959811] contain multiple annotated TRs and interruptions, so the true coordinates are likely more narrow.", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Gain of Function apparent, but mechanism is unknown. Methylation and RAN translation have been oberserved [@pmid:41959811].", + "year": "2026 [@pmid:41959811]", + "location_in_gene": "5' UTR", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 0, + "benign_max": 60, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 83, + "pathogenic_max": 148, + "motif_len": 3, + "ref_copies": null, + "novel": "ref", + "gard": ["12592"], + "genereviews": [], + "malacard": [], + "medgen": ["320250"], + "mondo": [], + "omim": ["612655"], + "orphanet": ["98897"], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": ["oculopharyngodistal_myopathy"], + "references": ["pmid:41959811", "mondo:0025193"], + "additional_literature": [] +}, +{ + "id": "SCA17_TBP", + "disease_id": "SCA17", + "gene": "TBP", + "evidence": ["Definitive"], + "chrom": "chr6", + "start_hg38": 170561906, + "stop_hg38": 170562017, + "start_hg19": 170870994, + "stop_hg19": 170871105, + "start_t2t": 171935458, + "stop_t2t": 171935569, + "disease": "Spinocerebellar ataxia type 17", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "A rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by a variable clinical picture which can include dementia, psychiatric disorders, parkinsonism, dystonia, chorea, spasticity, and epilepsy [@mondo:0011781].", + "hpo_terms": null, + "prevalence": "0.2/100000", + "prevalence_details": "Unknown (global), <100 families, 0.47:1,000,000 (Japanese), 0.16/100,000 (England) [@genereviews:NBK1438; @pmid:29100084]: 0.2/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1438].", + "age_onset": "Typical: 19-48; Range: 3-62, has second variant to delay onset [@omim:607136].", + "age_onset_min": 3.0, + "age_onset_max": 62.0, + "typ_age_onset_min": 19.0, + "typ_age_onset_max": 48.0, + "details": "Benign range is 25-40 repeats, pathogenic range is 49+ repeats (largest to date 66 motifs, with mild correlation between size and age of onset), and intermediate alleles (41-48 repeats) are associated with reduced penetrance and potentially milder phenotypes [@genereviews:NBK1438]. Huntington's disease-like phenotype [@pmid:12805114]. CAA CAG CAA interruption is seen in all alleles stably transmitted across generations [@genereviews:NBK1438;@pmid:35245110].", + "detection": "Short-read sequencing is reported to detect expansions but cannot size alleles beyond 250 bp. PCR amplification may detect expansions of ≤66 repeats [@pmid:37906407; @genereviews:NBK1438].", + "mechanism": "LoF/GoF", + "mechanism_detail": "Polyglutamine expansion leading to transcriptional dysregulation [@pmid:35053321].", + "year": "1999 [@pmid:10484774]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["CAA"], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AAC"], + "locus_structure": [], + "benign_min": 25, + "benign_max": 40, + "intermediate_min": 41, + "intermediate_max": 48, + "pathogenic_min": 49, + "pathogenic_max": 66, + "motif_len": 3, + "ref_copies": 37.0, + "novel": "ref", + "gard": ["10469"], + "genereviews": ["NBK1438"], + "malacard": ["SPN296"], + "medgen": ["337637"], + "mondo": ["0011781"], + "omim": ["607136"], + "orphanet": ["98759"], + "gnomad": ["TBP"], + "stripy": ["TBP"], + "tr_atlas": ["TR72502"], + "webstr_hg38": ["83566"], + "webstr_hg19": [], + "locus_tags": ["somatic_instability", "anticipation", "paternal_expansion", "length_affects_onset", "length_affects_penetrance", "length_affects_phenotype", "motif_affects_instability"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["omim:607136,@pmid:35053321,@genereviews:NBK1438,@pmid:12805114,@genereviews:NBK1438", "pmid:35245110,@genereviews:NBK1438,@pmid:29100084,@pmid:10484774,@mondo:0011781"], + "additional_literature": ["pmid:42196324", "pmid:42038259", "pmid:41843312", "pmid:41762523", "pmid:41612618", "pmid:41009775", "pmid:40488180", "pmid:40478462", "pmid:39950762", "pmid:39820777", "pmid:39680235", "pmid:39456985", "pmid:39125760", "pmid:38973070", "pmid:38961870", "pmid:38494459", "pmid:37855597", "pmid:37632648", "pmid:37146135", "pmid:36599645", "pmid:36476347", "pmid:36422518", "pmid:35926480", "pmid:35868859", "pmid:35493319", "pmid:35482253", "pmid:35275350", "pmid:35182509", "pmid:34906452", "pmid:34600502", "pmid:34565721", "pmid:34256333", "pmid:34235484", "pmid:33502644", "pmid:33377399", "pmid:32675418", "pmid:32533168", "pmid:32386547", "pmid:31940111", "pmid:31919387", "pmid:31522753", "pmid:30920184", "pmid:30891880", "pmid:30617627", "pmid:30615214", "pmid:30532692", "pmid:30314815", "pmid:30120431", "pmid:29801887", "pmid:29564144", "pmid:29249939", "pmid:29057148", "pmid:28821675", "pmid:28585930", "pmid:28444220", "pmid:28153533", "pmid:27865706", "pmid:27400454", "pmid:27172828", "pmid:26476771", "pmid:26387956", "pmid:26374734", "pmid:26267067", "pmid:26077168", "pmid:25672822", "pmid:24972706", "pmid:24677642", "pmid:24534762", "pmid:23665119", "pmid:23475385", "pmid:21710129", "pmid:21562248", "pmid:21437269", "pmid:20587494", "pmid:20199210", "pmid:20004653", "pmid:19595623", "pmid:19566714", "pmid:18218637", "pmid:18043721", "pmid:17961920", "pmid:17420317", "pmid:17273961", "pmid:17033685", "pmid:16858508", "pmid:16626296", "pmid:16223509", "pmid:16054804", "pmid:15850778", "pmid:15533937", "pmid:15503103", "pmid:15381080", "pmid:15365789", "pmid:15225551", "pmid:15193429", "pmid:14985389", "pmid:14967767", "pmid:12953269", "pmid:12891385", "pmid:12853230", "pmid:12758065", "pmid:11939898", "pmid:11571212", "pmid:11313753", "pmid:9399691", "pmid:8886170", "pmid:7892196", "pmid:8503450"] +}, +{ + "id": "TOF_TBX1", + "disease_id": "TOF", + "gene": "TBX1", + "evidence": ["Limited"], + "chrom": "chr22", + "start_hg38": 19766762, + "stop_hg38": 19766807, + "start_hg19": 19754285, + "stop_hg19": 19754330, + "start_t2t": 20143615, + "stop_t2t": 20143660, + "disease": "Tetralogy of Fallot", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Tetralogy of Fallot is a congenital cardiac malformation that consists of an interventricular communication, also known as a ventricular septal defect, obstruction of the right ventricular outflow tract, override of the ventricular septum by the aortic root, and right ventricular hypertrophy [@mondo:0008542].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in one Turkish individual [@genereviews:NBK535148].", + "age_onset": "0", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Found in one Turkish individual with Tetralogy of Fallot who had 25 repeats rather than 15 [@genereviews:NBK535148].", + "detection": null, + "mechanism": "LoF/GoF", + "mechanism_detail": "Polyalanine expansion, leading to cytoplasmic aggregation [@omim:187500; @pmid:19948535].", + "year": "2010 [@pmid:19948535]", + "location_in_gene": "Coding Exon 9", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 25, + "pathogenic_max": 25, + "motif_len": 3, + "ref_copies": 15.0, + "novel": "ref", + "gard": ["2245"], + "genereviews": ["NBK535148"], + "malacard": ["TTR001"], + "medgen": ["21498"], + "mondo": ["0008542"], + "omim": ["187500"], + "orphanet": ["3303"], + "gnomad": ["TBX1"], + "stripy": ["TBX1"], + "tr_atlas": ["TR163862"], + "webstr_hg38": ["4900984"], + "webstr_hg19": ["STR_889797"], + "locus_tags": [], + "disease_tags": [], + "references": ["omim:187500", "pmid:19948535", "genereviews:NBK535148", "mondo:0008542"], + "additional_literature": ["pmid:41607489", "pmid:24797903", "pmid:16141220", "pmid:10440825"] +}, +{ + "id": "FECD3_TCF4", + "disease_id": "FECD3", + "gene": "TCF4", + "evidence": ["Definitive"], + "chrom": "chr18", + "start_hg38": 55586153, + "stop_hg38": 55586229, + "start_hg19": 53253384, + "stop_hg19": 53253460, + "start_t2t": 55789233, + "stop_t2t": 55789288, + "disease": "Fuchs endothelial corneal dystrophy 3", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Late-onset Fuchs endothelial corneal dystrophy (FECD) is a degenerative disorder ... distinguished from other corneal disorders by the progressive formation of guttae [@omim:613267]. Studies suggest that disease severity increases in women with greater lifetime exposure to oestrogen [@pmid:40374208].", + "hpo_terms": null, + "prevalence": "4.5/100", + "prevalence_details": "~4/100 (over 40) [@omim:613267]; 5/100 [@pmid:20825314]. Predominantly in women (~75%) [@pmid:16769829]. In one study of two cohorts (Dallas Heart Study and 1000 Genomes Project), expanded allele carrier rates were 3.1% (African American), 8.1% (European American), and 3.3% (Latinos)in DHS, and 2.7% (AFR), 9.5% (EUR), 5.2% (East Asians), 7.2% (South Asians), and 5.2% (admixed Americans) in 1KGP [@pmid:39669694]. The highest carrier prevalence (12.1%–12.5%) occurred in EUR and admixed American subpopulations, while rates were 0%–1.9% in West Africans vs 6.2% in a Kenyan subpopulation.", + "age_onset": "Typical: 40-59 [@pmid:1676829]; Range: 32 [@pmid:21245398] - 79 [@pmid:39998965].", + "age_onset_min": 32.0, + "age_onset_max": 79.0, + "typ_age_onset_min": 40.0, + "typ_age_onset_max": 59.0, + "details": "Most controls have <40 repeats while majority of patients have >50 repeats; penetrance is <100%, as unaffected individuals have been documented with >80 repeats and alleles of affected individuals range from 12-2600 [@genereviews:NBK535148; @pmid:25168903]. Expansions are causative in approximately 70% of disease cases [@genereviews:NBK535148].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Sequestration of MBNL1 in RNA foci, similar to the mechanism underlying myotonic dystrophy-1 [@pmid:25593321]. Variation in RAN translation [@pmid:38467784].", + "year": "2012 [@pmid:23185296]", + "location_in_gene": "Intron 1", + "gene_strand": "-", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CTG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 39, + "intermediate_min": 40, + "intermediate_max": 50, + "pathogenic_min": 51, + "pathogenic_max": 2600, + "motif_len": 3, + "ref_copies": 25.3, + "novel": "ref", + "gard": ["10018"], + "genereviews": ["NBK535148"], + "malacard": ["FCH001", "CRN120"], + "medgen": ["442479"], + "mondo": ["0013203"], + "omim": ["613267"], + "orphanet": ["98974"], + "gnomad": ["TCF4"], + "stripy": ["TCF4"], + "tr_atlas": ["TR151784"], + "webstr_hg38": ["6247607", "463325"], + "webstr_hg19": [], + "locus_tags": ["length_affects_penetrance"], + "disease_tags": [], + "references": ["pmid:1676829", "pmid:21245398", "pmid:39998965", "pmid:25593321", "pmid:38467784", "genereviews:NBK535148", "pmid:25168903", "omim:613267", "pmid:20825314", "pmid:16769829", "pmid:39669694", "pmid:23185296", "pmid:40374208"], + "additional_literature": ["pmid:42180433", "pmid:42010886", "pmid:41944554", "pmid:41944537", "pmid:41865104", "pmid:41736702", "pmid:41713739", "pmid:41562921", "pmid:41533935", "pmid:41501457", "pmid:41373515", "pmid:41344296", "pmid:41298634", "pmid:41074692", "pmid:40961119", "pmid:40852795", "pmid:40767442", "pmid:40720054", "pmid:40585427", "pmid:40268158", "pmid:40081749", "pmid:40048186", "pmid:39651202", "pmid:39332053", "pmid:39288343", "pmid:39278108", "pmid:39231626", "pmid:38713708", "pmid:38704483", "pmid:38300219", "pmid:37747538", "pmid:37204786", "pmid:37169279", "pmid:36883248", "pmid:36773096", "pmid:36701310", "pmid:36275201", "pmid:36250467", "pmid:34946954", "pmid:34946867", "pmid:34855896", "pmid:34698281", "pmid:34644448", "pmid:33782268", "pmid:36246012", "pmid:33116252", "pmid:32934897", "pmid:32639312", "pmid:31554942", "pmid:31469403", "pmid:31276570", "pmid:30973406", "pmid:30811544", "pmid:30733599", "pmid:30267097", "pmid:30122888", "pmid:30098193", "pmid:29966009", "pmid:29799290", "pmid:29526280", "pmid:29325021", "pmid:29196769", "pmid:29044056", "pmid:28886202", "pmid:28832669", "pmid:28608272", "pmid:28118661", "pmid:27755191", "pmid:26401622", "pmid:26218914", "pmid:26200491", "pmid:25722209", "pmid:25298419", "pmid:24255041", "pmid:20960280", "pmid:11526470", "pmid:10712198", "pmid:10395212"] +}, +{ + "id": "SCA_THAP11", + "disease_id": "SCA51", + "gene": "THAP11", + "evidence": ["Strong"], + "chrom": "chr16", + "start_hg38": 67842862, + "stop_hg38": 67842950, + "start_hg19": 67876765, + "stop_hg19": 67876853, + "start_t2t": 73638636, + "stop_t2t": 73638724, + "disease": "Spinocerebellar ataxia 51", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "THAP11-caused SCA involves symptoms including gait ataxia, dysarthria, dysphagia, slow saccades, ptosis, and/or nystagmus [@pmid:37148549].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Has been observed in Chinese families [@pmid:37148549; @pmid:24677642]. Interruptions predisposing to expansion/disease appear to vary by ancestry [@pmid:39651830].", + "age_onset": "Typical: 8-40 (small sample size); Range: 4-51 [@pmid:37148549].", + "age_onset_min": 4.0, + "age_onset_max": 51.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Expansion (45-100 repeats) found in affected individuals from 2 families and not in 500 controls (benign range: 20-38 repeats) [@pmid:37148549]. Longer alleles were associated with earlier age of onset. For example, an individual with 100 repeats had age of onset at 4 years. CAA interruptions can reduce toxicity [@pmid:37148549; @pmid:37148549].", + "detection": null, + "mechanism": "GoF", + "mechanism_detail": "Polyglutamine expansion leading to gain of function toxicity [@pmid:37148549; @pmid:38467784].", + "year": "2023 [@pmid:37148549]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["CAG"], + "pathogenic_motif_reference_orientation": ["CAG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": ["CAA"], + "pathogenic_motif_gene_orientation": ["AGC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": ["AAC"], + "locus_structure": [], + "benign_min": 20, + "benign_max": 38, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 45, + "pathogenic_max": 100, + "motif_len": 3, + "ref_copies": 29.3, + "novel": "ref", + "gard": ["10748"], + "genereviews": [], + "malacard": [], + "medgen": ["431598"], + "mondo": [], + "omim": ["620947"], + "orphanet": [], + "gnomad": ["THAP11"], + "stripy": [], + "tr_atlas": ["TR142069"], + "webstr_hg38": ["814002", "5973136"], + "webstr_hg19": ["STR_540982"], + "locus_tags": ["anticipation", "length_affects_onset", "length_affects_severity", "motif_affects_onset", "motif_affects_severity"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["pmid:37148549", "pmid:38467784", "pmid:24677642", "pmid:39651830"], + "additional_literature": ["pmid:40886825", "pmid:40488180", "pmid:15368101"] +}, +{ + "id": "FAME6_TNRC6A", + "disease_id": "FAME6", + "gene": "TNRC6A", + "evidence": ["Limited"], + "chrom": "chr16", + "start_hg38": 24613438, + "stop_hg38": 24613532, + "start_hg19": 24624759, + "stop_hg19": 24624853, + "start_t2t": 24890366, + "stop_t2t": 24890430, + "disease": "Familial adult myoclonic epilepsy type 6", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Limited clinical details from one family, 'early 20s to 70s'", + "age_onset_min": 23.0, + "age_onset_max": 74.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Novel, reported pathogenic alleles: (TTTTA)22 (TTTCA)exp (TTTTA)exp, but only the TTTCA is specific to affected individuals (size: 1100 repeats). Non-pathogenic reference TTTTA repeat was expanded in nine healthy subjects 40-120 repeats and in two individuals was potentially even longer [@pmid:29507423].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423; @pmid:38467784].", + "year": "2018 [@pmid:29507423]", + "location_in_gene": "Intron 1/23", + "gene_strand": "+", + "reference_motif_reference_orientation": ["TTTTA"], + "pathogenic_motif_reference_orientation": ["TTTCA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["TTTTT"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["TTTTT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "OPML1_NUTM2B-AS1", - "disease_id": "OPML1", - "gene": "NUTM2B-AS1", - "evidence": [ - "Moderate" - ], - "chrom": "chr10", - "start_hg38": 79826383, - "stop_hg38": 79826404, - "start_hg19": 81586139, - "stop_hg19": 81586160, - "start_t2t": 80695718, - "stop_t2t": 80695748, - "disease": "Oculopharyngeal myopathy with leukoencephalopathy 1", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Oculopharyngodistal myopathy and white matter abnormalities [@pmid:38876750]; Ptosis, ophthalmoplegia, dysphagia, dysarthria [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Rare, found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "15-40 (only characterized in one family) [@pmid:31332380].", - "age_onset_min": 15, - "age_onset_max": 40, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (3-16 repeats) established in 1000 controls, studied alongside pathogenic probands of up to 700 repeats [@pmid:31332380]. Pathogenicity occurs at repeats as short as 161 motifs [@pmid:38159879; @pmid:37923380], while intermediate alleles may correlate to milder phenotypes [@pmid:38159879]. Alt transcript in opposite direction: LOC642361.", - "detection": "RP-PCR has effectively detected these expansions [@pmid:39308795], while long-read sequencing has resolved size and structure [@pmid:38159879].", - "mechanism": "GoF?", - "mechanism_detail": "RNA mediated toxicity hypothesized, overall mechanism unknown [@omim:618637; @pmid:36169768].", - "year": "2019 [@pmid:31332380]", - "location_in_gene": "Exon 1 of lncRNA (noncoding)", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGC" - ], - "pathogenic_motif_reference_orientation": [ - "GGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 3, - "benign_max": 16, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 161, - "pathogenic_max": 700, - "motif_len": 3, - "ref_copies": 7, - "novel": "ref", - "gard": [], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "OCL077" - ], - "medgen": [ - "1684701" - ], - "mondo": [ - "0032843" - ], - "omim": [ - "618637" - ], - "orphanet": [], - "gnomad": [ - "NUTM2B-AS1" - ], - "stripy": [ - "NUTM2B-AS1" - ], - "tr_atlas": [ - "TR102881" - ], - "webstr_hg38": [], - "webstr_hg19": [ - "STR_173942" - ], - "locus_tags": [ - "length_affects_severity", - "length_affects_phenotype" - ], - "disease_tags": [], - "references": [ - "pmid:31332380", - "omim:618637", - "pmid:36169768", - "pmid:38159879", - "pmid:37923380", - "pmid:38876750", - "pmid:39349043" - ], - "additional_literature": [ - "pmid:40645757", - "pmid:39308795", - "pmid:39176128", - "pmid:35152460" - ] + "motif": "TTTTA", + "count": 10, + "type": "internal_repeat" }, { - "id": "OPMD_PABPN1", - "disease_id": "OPMD", - "gene": "PABPN1", - "evidence": [ - "Definitive" - ], - "chrom": "chr14", - "start_hg38": 23321472, - "stop_hg38": 23321503, - "start_hg19": 23790681, - "stop_hg19": 23790712, - "start_t2t": 17522488, - "stop_t2t": 17522519, - "disease": "Oculopharyngeal muscular dystrophy", - "inheritance": [ - "AD", - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "OPMD is a late-onset neuromuscular disease, characterized by ptosis, dysphagia, and general facial weakness [@omim:164300; @pmid:39349043; @pmid:38876750]. Proximal limb weakness commonly develops later in the disease course [@pmid:42157275].", - "hpo_terms": null, - "prevalence": "1/100000", - "prevalence_details": "1/100,000 (population specific) [@pmid:29100084]. Frequency of (GCN)11 alleles is 1-2% of North America/Europe/Japan [@genereviews:NBK1126]. Disease is significantly enriched in individuals of Jewish Bukharian descent[@pmid:42157275]. Disease is found worldwide, in more than 30 countries [@genereviews:NBK1126].", - "age_onset": "Typical: 40-59 [@pmid:37519616]; Range: 20-79 [@pmid:35112761].", - "age_onset_min": 20, - "age_onset_max": 79, - "typ_age_onset_min": 40, - "typ_age_onset_max": 59, - "details": "Disease is caused by a GCN polyalanine expansion in the first exon of PABPN1. Most known patients have (GCG)+, but GCN (any polyalanine) may be pathogenic [@genereviews:NBK1126]. This locus is heterozygous in ~90% of cases (autosomal dominant inheritance), while expansions are biallelic in ~10% of cases (consistent with autosomal recessive inheritance). Disease is generally more severe in cases with two expanded alleles. Age of onset is inverse to allele size, while penetrance and severity increase with allele size [@genereviews:NBK1126]. Mild, late-onset disease can occur in individuals with a (GCN)10(GCN)11 genotype, suggesting variable penetrance [@pmid:28011929]. The definition of this locus differs in the literature with prior work counting exact GCG motifs for a benign size of (GCG)6 [@pmid:9462747], while later resources count GCNs (any alanine codon), widening the region by 4 motifs to a benign size of (GCN)10 [@genereviews:NBK1126; @pmid:39349043]. STRchive is using the GCN definition.", - "detection": "Flanking PCR with fragment analysis has accurately detected expansions [@pmid:27980005]. Heterozygous expansions have been sized by Sanger sequencing. Biallelic expanded variants were assessed using short-read sequencing or PCR fragment analysis.", - "mechanism": "GoF/LoF", - "mechanism_detail": "Polyalanine expansions leading to cellular toxicity (loss of function) as well as abnormal aggregation and inefficient protein degradation, which may impact mRNA processing [@genereviews:NBK1126].", - "year": "1998 [@pmid:9462747]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 10, - "intermediate_min": 11, - "intermediate_max": 11, - "pathogenic_min": 12, - "pathogenic_max": 18, - "motif_len": 3, - "ref_copies": 7, - "novel": "ref", - "gard": [ - "7245" - ], - "genereviews": [ - "NBK1126" - ], - "malacard": [ - "OCL088" - ], - "medgen": [ - "1054618" - ], - "mondo": [ - "0958176" - ], - "omim": [ - "164300" - ], - "orphanet": [ - "270" - ], - "gnomad": [ - "PABPN1" - ], - "stripy": [ - "PABPN1" - ], - "tr_atlas": [ - "TR128439" - ], - "webstr_hg38": [ - "1442709", - "5271481" - ], - "webstr_hg19": [ - "Expansion_OPMD/PAPBN1" - ], - "locus_tags": [ - "length_affects_onset", - "length_affects_severity" - ], - "disease_tags": [], - "references": [ - "pmid:37519616", - "pmid:35112761", - "genereviews:NBK1126", - "pmid:28011929", - "pmid:9462747", - "pmid:39349043", - "pmid:29100084", - "omim:164300", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:42196324", - "pmid:42157275", - "pmid:41764774", - "pmid:41676387", - "pmid:41587185", - "pmid:40594369", - "pmid:40552959", - "pmid:40220918", - "pmid:39113268", - "pmid:38165364", - "pmid:37698929", - "pmid:37559347", - "pmid:36790141", - "pmid:35859342", - "pmid:34927285", - "pmid:34225694", - "pmid:34047774", - "pmid:31294444", - "pmid:30455479", - "pmid:28361972", - "pmid:27980005", - "pmid:26428746", - "pmid:23793615", - "pmid:23399899", - "pmid:22519734", - "pmid:21742497", - "pmid:21647273", - "pmid:21602480", - "pmid:21316245", - "pmid:19641605", - "pmid:19101703", - "pmid:18481858", - "pmid:18367172", - "pmid:18343218", - "pmid:17138075", - "pmid:16648376", - "pmid:16642034", - "pmid:16481821", - "pmid:16378590", - "pmid:16239242", - "pmid:15811916", - "pmid:15755680", - "pmid:15725589", - "pmid:15645184", - "pmid:14627730", - "pmid:12673802", - "pmid:11712939", - "pmid:11304042", - "pmid:11222452", - "pmid:11150975", - "pmid:11087766", - "pmid:11003790", - "pmid:10734263", - "pmid:10680791", - "pmid:9084936" - ] - }, - { - "id": "CCHS_PHOX2B", - "disease_id": "CCHS", - "gene": "PHOX2B", - "evidence": [ - "Definitive" - ], - "chrom": "chr4", - "start_hg38": 41745972, - "stop_hg38": 41746032, - "start_hg19": 41747989, - "stop_hg19": 41748049, - "start_t2t": 41719745, - "stop_t2t": 41719805, - "disease": "Congenital central hypoventilation syndrome", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A rare disease due to a severely impaired central autonomic control of breathing and dysfunction of the autonomous nervous system. The incidence is estimated to be at 1 of 200 000 livebirths. A heterozygous mutation of the PHOX-2B gene is found in 90% of the patients. Association with Hirschsprung's disease is observed in 16% of the cases (adapted from Mondo) [@mondo:0800026]. Hyperinsulinism has been observed in patients [@pmid:41531556].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Incidence is 1:148000-200000 births (Estimated, may include mild/undiagnosed or be overestimated globally) [@genereviews:NBK1427]. Rare, but reported worldwide [@pmid:15121777].", - "age_onset": "Typical: 0-2 [@genereviews:NBK1427; @pmid:15121777]; Range: 0-36 [@pmid:16873766].", - "age_onset_min": 0, - "age_onset_max": 36, - "typ_age_onset_min": 0, - "typ_age_onset_max": 2, - "details": "Alleles of 24 repeats (and sometimes 25 repeats) correspond to delayed disease onset and/or milder phenotype; alleles above benign range (9-20 repeats) and below the pathogenic range (26-33 repeats) have uncertain significance [@genereviews:NBK1427].", - "detection": "Short-read sequencing and exome sequencing are reportedly unable to accurately detect these expansions. Fragment analysis is the standard detection method, while Sanger sequencing determines the exact repeat size [@genereviews:NBK1427].", - "mechanism": "LoF/GoF", - "mechanism_detail": "Polyalanine expansion leading to loss or gain of function, dependent on altered protein product [@pmid:38467784; @genereviews:NBK1427]. Correlation between length and reduced transcriptional activity [@pmid:15888479].", - "year": "2003 [@pmid:12640453]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 9, - "benign_max": 20, - "intermediate_min": 21, - "intermediate_max": 25, - "pathogenic_min": 26, - "pathogenic_max": 33, - "motif_len": 3, - "ref_copies": 15.7, - "novel": "ref", - "gard": [ - "8535" - ], - "genereviews": [ - "NBK1427" - ], - "malacard": [ - "CNT119" - ], - "medgen": [ - "1794285" - ], - "mondo": [ - "0800026" - ], - "omim": [ - "209880" - ], - "orphanet": [ - "661" - ], - "gnomad": [ - "PHOX2B" - ], - "stripy": [ - "PHOX2B" - ], - "tr_atlas": [ - "TR42548" - ], - "webstr_hg38": [ - "4725362" - ], - "webstr_hg19": [ - "Expansion_CCHS/PHOX2B" - ], - "locus_tags": [ - "length_affects_onset", - "length_affects_severity" - ], - "disease_tags": [], - "references": [ - "genereviews:NBK1427", - "pmid:15121777", - "pmid:16873766", - "pmid:38467784", - "pmid:15888479", - "pmid:12640453", - "mondo:0800026", - "pmid:41531556" - ], - "additional_literature": [ - "pmid:41420984", - "pmid:41188450", - "pmid:38467313", - "pmid:38454954", - "pmid:38431667", - "pmid:38001308", - "pmid:36394266", - "pmid:35421844", - "pmid:34626313", - "pmid:34012823", - "pmid:33958749", - "pmid:33855005", - "pmid:33047879", - "pmid:32822965", - "pmid:31950261", - "pmid:30786110", - "pmid:30672101", - "pmid:30227298", - "pmid:29058474", - "pmid:28992836", - "pmid:27485184", - "pmid:27129232", - "pmid:26378991", - "pmid:26375764", - "pmid:26063465", - "pmid:26011159", - "pmid:25975378", - "pmid:25085640", - "pmid:24442913", - "pmid:24135798", - "pmid:23460545", - "pmid:23460419", - "pmid:23103552", - "pmid:23045564", - "pmid:22922260", - "pmid:22829249", - "pmid:22821709", - "pmid:22437207", - "pmid:22278185", - "pmid:22125732", - "pmid:21373876", - "pmid:20236122", - "pmid:19881470", - "pmid:19608868", - "pmid:18798833", - "pmid:18157832", - "pmid:17928950", - "pmid:17909190", - "pmid:17045833", - "pmid:16888290", - "pmid:16258163", - "pmid:16249188" - ] - }, - { - "id": "MRUPAV_PLIN4", - "disease_id": "MRUPAV", - "gene": "PLIN4", - "evidence": [ - "Moderate" - ], - "chrom": "chr19", - "start_hg38": 4510727, - "stop_hg38": 4513659, - "start_hg19": 4510739, - "stop_hg19": 4513671, - "start_t2t": 4494212, - "stop_t2t": 4497342, - "disease": "Myopathy with Rimmed Ubiquitin-Positive Autophagic Vacuolation, PLIN4-Related Myopathy", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Autosomal dominant myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV) is characterized by adult onset of slowly progressive skeletal muscle weakness variably affecting the distal or proximal lower limbs. Some patients may also have upper limb involvement or neck muscle weakness, but respiratory and bulbar involvement only rarely occurs. EMG studies show a myopathic process, and myotonia may also be observed [@omim:601846]. An early characterisation of the disease was reported in Blasi, et al. [@pmid:15236412].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Studied in patients of chinese ancestry and two families of spanish ancestry [@pmid:36151849; @pmid:40693562].", - "age_onset": "22-66 [@pmid:36151849; @pmid:37145156; @pmid:35499779; @pmid:40693562].", - "age_onset_min": 22, - "age_onset_max": 66, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "This is an expanded variable number tandem repeat (VNTR) in the PLIN4 gene, located in exon 3. This repeat consists of a 99 bp motif which encodes 33 amino-acids within the perilipin-4 protein [@pmid:32451610]. Expansions of this 99 bp motif lead to insertion of multiple imperfect 33–amino acid repeats. These repetitive sequences are thought to contribute to abnormal protein aggregation and dysregulated autophagy seen in affected muscle tissue [@omim:601846].", - "detection": "Short-read sequencing and exome sequencing are reported to not reliably detect this repeat. Long-range PCR is used for detection, while long-read sequencing is used to fully resolve size and structure [@pmid:32451610; @pmid:33811808].", - "mechanism": "GoF", - "mechanism_detail": "The present disease is characterized by dominantly inherited progressively increasing mobilization of aggrephagy at sites of progressive accumulation of a mutated protein, suggesting that the mutation is leading to aggregation, likely through misfolding, exceeding aggrephagic capacity [@pmid:32451610]", - "year": "2020 [@pmid:32451610]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC" - ], - "pathogenic_motif_reference_orientation": [ - "TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AAAGGAACCATCCAGACCGGCGTGGACACCAGTAAGACTGTCCTAACAGGTACCAAGGACACCGTCTGTAGTGGGGTGACTGGTGCCATGAATGTGGCC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 29, - "benign_max": 31, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 37, - "pathogenic_max": 50, - "motif_len": 99, - "ref_copies": 31, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": [], - "medgen": [ - "355637" - ], - "mondo": [ - "0011155" - ], - "omim": [ - "601846" - ], - "orphanet": [ - "696063" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [ - "anticipation", - "length_affects_onset" - ], - "disease_tags": [], - "references": [ - "pmid:36151849", - "pmid:37145156", - "pmid:35499779", - "pmid:40693562", - "pmid:32451610", - "omim:601846", - "pmid:15236412" - ], - "additional_literature": [ - "pmid:39492694" - ] - }, + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 1100, + "pathogenic_max": 1100, + "motif_len": 3, + "ref_copies": 18.8, + "novel": "novel", + "gard": ["16758"], + "genereviews": ["NBK535148"], + "malacard": ["EPL227"], + "medgen": ["1648448"], + "mondo": ["0054846"], + "omim": ["618074"], + "orphanet": ["86814"], + "gnomad": ["TNRC6A"], + "stripy": ["TNRC6A"], + "tr_atlas": ["TR139999"], + "webstr_hg38": ["5951520"], + "webstr_hg19": ["STR_519979"], + "locus_tags": ["motif_affects_penetrance"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:29507423", "pmid:38467784", "pmid:38876750"], + "additional_literature": ["pmid:41219789", "pmid:36092952", "pmid:33040085", "pmid:31483537", "pmid:30351492", "pmid:23042244"] +}, +{ + "id": "CPUM_TYMS", + "disease_id": "CPUM", + "gene": "TYMS", + "evidence": ["Limited"], + "chrom": "chr18", + "start_hg38": 666891, + "stop_hg38": 667632, + "start_hg19": 666891, + "stop_hg19": 667632, + "start_t2t": 821235, + "stop_t2t": 821905, + "disease": "Congenital Progressive Universal Melanosis", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "CPUM is characterized by progressive widespread hyperpigmentation beginning at birth without accompanying symptoms. Studied children with CPUM have been born to unaffected parents. The children studied have been born with diffuse, universal, and progressive hyperpigmentation at 15 years of age. At this time the hyperpigmentation had fully progressed [@pmid:40589716]. It is not entirely clear that this is a distinct disease as it shares features with acquired universal melanosis (most similar), erythema dyschromicum perstans, lichen planus pigmentosus, and familial progressive hypigmentation.", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in two monozygotic twins in Thailand [@pmid:40589716].", + "age_onset": "0 (birth) [@pmid:40589716]", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "A study has identified an intronic GATGGT hexanucleotide tandem repeat in the TYMS gene. Both parents were found to be heterozygous carriers of the expansion, suggesting a recessive inheritance pattern. Evidence is limited, only a single family with monozygotic twins have been reported and no change in expression of the gene has been observed [@pmid:40589716].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Proposed mechanism involves repeat expansions in non-coding regions of the gene, reducing expression in melanocytes or keratinocytes, leading to a disruption in nucleotide balance in DNA repair and hyperpigmentation. Missense mutations disrupt nucleotide metabolism, resulting in loss-of-function and genome instability [@pmid:40589716].", + "year": "2025 [@pmid:40589716]", + "location_in_gene": "Intron 3", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GATGGT"], + "pathogenic_motif_reference_orientation": ["GATGGT"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ACCATC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 42, + "benign_max": 172, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 210, + "pathogenic_max": 259, + "motif_len": 6, + "ref_copies": null, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": [], + "medgen": [], + "mondo": [], + "omim": [], + "orphanet": [], + "gnomad": [], + "stripy": [], + "tr_atlas": [], + "webstr_hg38": [], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:40589716"], + "additional_literature": ["pmid:41507280", "pmid:41181325", "pmid:41074680", "pmid:41024012", "pmid:40890629", "pmid:40589716", "pmid:40195828", "pmid:38625071", "pmid:38411001", "pmid:38379425", "pmid:38311638", "pmid:38280392", "pmid:38134936", "pmid:36398398", "pmid:36209056", "pmid:35608245", "pmid:35233526", "pmid:35055435", "pmid:34650802", "pmid:34526668", "pmid:34197619", "pmid:34149004", "pmid:33805940", "pmid:33086767", "pmid:32813677", "pmid:32695278", "pmid:32612964", "pmid:32110891", "pmid:31817852", "pmid:31370354", "pmid:31161452", "pmid:30838312", "pmid:30823845", "pmid:30533396", "pmid:30464574", "pmid:30122542", "pmid:29995270", "pmid:29660633", "pmid:29394274", "pmid:29321350", "pmid:29162511", "pmid:28895423", "pmid:28349270", "pmid:28280649", "pmid:28074308", "pmid:28074022", "pmid:27995989", "pmid:27868347", "pmid:27864985", "pmid:27685916", "pmid:27375073", "pmid:29767611", "pmid:26745074", "pmid:26621114", "pmid:26277606", "pmid:26196219", "pmid:26189437", "pmid:25955097", "pmid:25648260", "pmid:25536611", "pmid:25366766", "pmid:25341694", "pmid:25294632", "pmid:25279663", "pmid:25258183", "pmid:25246386", "pmid:25028118", "pmid:25007187", "pmid:24726028", "pmid:24686188", "pmid:24641398", "pmid:24596472", "pmid:24554028", "pmid:24422758", "pmid:24415354", "pmid:24302747", "pmid:24137384", "pmid:23968134", "pmid:23571497", "pmid:23481061", "pmid:23232805", "pmid:23226765", "pmid:23148637", "pmid:22799365", "pmid:22763757", "pmid:22576918", "pmid:22086855", "pmid:22044939", "pmid:21630057", "pmid:21449681", "pmid:21269855", "pmid:21196216", "pmid:21075014", "pmid:20966539", "pmid:20962453", "pmid:20932673", "pmid:20880668", "pmid:20824655", "pmid:20651387", "pmid:20645403", "pmid:20570968", "pmid:20531375", "pmid:20372856", "pmid:20005374", "pmid:19998340", "pmid:19917450", "pmid:19798689", "pmid:19632929", "pmid:19349389", "pmid:19306093", "pmid:19200948", "pmid:19082493", "pmid:18843018", "pmid:18728661", "pmid:18704422", "pmid:18661526", "pmid:18406541", "pmid:18273818", "pmid:18267032", "pmid:18203297", "pmid:18095031", "pmid:17508355", "pmid:17396161", "pmid:17278107", "pmid:17273745", "pmid:17220568", "pmid:17201138", "pmid:17187508", "pmid:17047490", "pmid:17018589", "pmid:16929515", "pmid:16818689", "pmid:16596248", "pmid:16456808", "pmid:16334126", "pmid:16333305", "pmid:16234002", "pmid:16182121", "pmid:15897576", "pmid:15817609", "pmid:15749593", "pmid:15646842", "pmid:15579479", "pmid:15571262", "pmid:15510613", "pmid:15457444", "pmid:15386371", "pmid:15284183", "pmid:15115918", "pmid:14522928", "pmid:12684695", "pmid:12604405", "pmid:12460463", "pmid:12232785", "pmid:12215845", "pmid:12039668", "pmid:11913730", "pmid:11867566", "pmid:11751507", "pmid:11529907", "pmid:11445856", "pmid:10652619", "pmid:10636923", "pmid:10625460", "pmid:8751943", "pmid:3002689"] +}, +{ + "id": "HMNR7_VWA1", + "disease_id": "HMNR7", + "gene": "VWA1", + "evidence": ["Definitive"], + "chrom": "chr1", + "start_hg38": 1435798, + "stop_hg38": 1435818, + "start_hg19": 1371178, + "stop_hg19": 1371198, + "start_t2t": 870158, + "stop_t2t": 870178, + "disease": "Neuronopathy, distal hereditary motor, autosomal recessive 7", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Autosomal recessive distal hereditary motor neuronopathy-7 (HMNR7) is characterized by onset of lower leg weakness in the first decade. Affected individuals have difficulty climbing stairs and problems standing on their heels... Most patients have foot deformities, and some may have leg muscle atrophy. The disorder is slowly progressive and often involves the upper limbs [@omim:619216].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Biallelic variants found in 0.01% of 100 KGP participants; enriched in those with motor disease. 80% of VWA1 pathogenic variants are expansions/contractions [@genereviews:NBK535148]. The repeat expansion was found in several ethnicities; founder mutation 7,000 years prior [@pmid:33559681].", + "age_onset": "Typical: 1-3 [@pmid:33559681]; Range: 0-10 [@omim:619216].", + "age_onset_min": 0.0, + "age_onset_max": 10.0, + "typ_age_onset_min": 1.0, + "typ_age_onset_max": 3.0, + "details": "Any deviation from 2 motifs is thought to be pathogenic [@genereviews:NBK535148].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Loss of function [@pmid:38467784].", + "year": "2021 [@pmid:33559681]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GGCGCGGAGC"], + "pathogenic_motif_reference_orientation": ["GGCGCGGAGC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["AGCGGCGCGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 2, + "benign_max": 2, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 1, + "pathogenic_max": 3, + "motif_len": 10, + "ref_copies": null, + "novel": null, + "gard": ["18444"], + "genereviews": ["NBK535148"], + "malacard": ["NRN074"], + "medgen": ["1786836"], + "mondo": ["0030977"], + "omim": ["619216"], + "orphanet": ["314485"], + "gnomad": ["VWA1"], + "stripy": [], + "tr_atlas": ["TR32"], + "webstr_hg38": ["1099767"], + "webstr_hg19": [], + "locus_tags": ["contraction"], + "disease_tags": [], + "references": ["pmid:33559681", "omim:619216", "pmid:38467784", "genereviews:NBK535148"], + "additional_literature": ["pmid:42003611"] +}, +{ + "id": "DBQD2_XYLT1", + "disease_id": "DBQD2, BSS", + "gene": "XYLT1", + "evidence": ["Moderate"], + "chrom": "chr16", + "start_hg38": 17470907, + "stop_hg38": 17470922, + "start_hg19": 17564764, + "stop_hg19": 17564779, + "start_t2t": 17477909, + "stop_t2t": 17478002, + "disease": "Baratela-Scott Syndrome/Desbuquois dysplasia 2", + "inheritance": ["AR"], + "association_type": ["Mendelian"], + "disease_description": "Desbuquois dysplasia, which belongs to the multiple dislocation group of disorders, is characterized by dislocations of large joints, severe pre- and postnatal growth retardation, joint laxity, and flat face with prominent eyes. Radiologic features include short long bones with an exaggerated trochanter that gives a 'monkey wrench' appearance to the proximal femur, and advanced carpal and tarsal ossification [@pmid:24581741].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "<1/1,000,000 births [@orphanet:1425]; repeat expansions comprise half of DBQD variants [@genereviews:NBK535148]. <50 DBQD cases. Has been found in Belgian, Emirati families", + "age_onset": "0 (birth)", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": 0.0, + "typ_age_onset_max": 0.0, + "details": "Benign range (0-20) taken from primary literature of unaffected individuals and gnomAD data [@pmid:30554721; @gnomad:XYLT1]. Minimum repeat size to cause disease thought to range between 72 and 110 repeats [@pmid:30554721]. Repeat is within a 238bp sequence which is missing from hg38 but present in T2T-CHM13", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Methylation [@pmid:30554721].", + "year": "2019 [@pmid:30554721]", + "location_in_gene": "5' promoter region. Note, it can also be annotated coding or introntic depending on the reference, due to missing sequences in some reference genomes.", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "CPEO_POLG", - "disease_id": "CPEO", - "gene": "POLG", - "evidence": [ - "Disputed" - ], - "chrom": "chr15", - "start_hg38": 89333588, - "stop_hg38": 89333629, - "start_hg19": 89876819, - "stop_hg19": 89876860, - "start_t2t": 87088411, - "stop_t2t": 87088452, - "disease": "Progressive external ophthalmoplegia, Parkinson's disease", - "inheritance": [], - "association_type": [ - "Mendelian", - "Risk", - "Modifier" - ], - "disease_description": "sensory ataxic neuropathy, dysarthria, and ophthalmoparesis [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Disease association unclear but largely studied in European cohorts/patients [@omim:258450; @omim:157640].", - "age_onset": "Typical: 57 [@pmid:20399836] - 59 [@pmid:20826197]; Range: 23-87 [@pmid:20399836].", - "age_onset_min": 23, - "age_onset_max": 87, - "typ_age_onset_min": 57, - "typ_age_onset_max": 59, - "details": "There is conflicting evidence for the association between this repeat expansion and Parkinson's risk [@pmid:20399836; @pmid:10196696; @pmid:22963882], as well as overall disease significance. May be predisposing factor in earlier age of onset in FRDA patients [@pmid:19043662].", - "detection": null, - "mechanism": null, - "mechanism_detail": null, - "year": null, - "location_in_gene": "Coding Exon 2", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCT" - ], - "pathogenic_motif_reference_orientation": [ - "GCT" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "GCT", - "count": 2, - "type": "flank_repeat" - }, - { - "motif": "GTT", - "count": 1, - "type": "flank_repeat" - }, - { - "motif": "GCT", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 10, - "benign_max": 10, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": null, - "pathogenic_max": null, - "motif_len": 3, - "ref_copies": 13.7, - "novel": "ref", - "gard": [ - "15215", - "13174" - ], - "genereviews": [], - "malacard": [ - "PRG130", - "PRK002" - ], - "medgen": [ - "897191", - "371919" - ], - "mondo": [ - "0009783", - "0024528" - ], - "omim": [ - "258450", - "157640" - ], - "orphanet": [ - "520820" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [ - "TR137533" - ], - "webstr_hg38": [ - "5177947" - ], - "webstr_hg19": [ - "STR_493430" - ], - "locus_tags": [ - "proposed_modifier" - ], - "disease_tags": [], - "references": [ - "pmid:20399836", - "pmid:20826197", - "pmid:10196696", - "pmid:22963882", - "pmid:19043662", - "omim:258450", - "omim:157640", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:41009775", - "pmid:40844737", - "pmid:39812846", - "pmid:34600502", - "pmid:29029963", - "pmid:28444220", - "pmid:25767537", - "pmid:24491464", - "pmid:23912752", - "pmid:23493802", - "pmid:20803511", - "pmid:15694274", - "pmid:12036482" - ] + "motif": "GCC", + "count": 0, + "type": "internal_repeat" }, { - "id": "SCA12_PPP2R2B", - "disease_id": "SCA12", - "gene": "PPP2R2B", - "evidence": [ - "Moderate" - ], - "chrom": "chr5", - "start_hg38": 146878727, - "stop_hg38": 146878759, - "start_hg19": 146258290, - "stop_hg19": 146258322, - "start_t2t": 147414733, - "stop_t2t": 147414780, - "disease": "Spinocerebellar ataxia type 12", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 12 (SCA12) is a very rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by the presence of action tremor associated with relatively mild cerebellar ataxia. Associated pyramidal and extrapyramidal signs and dementia have been reported [@mondo:0011439].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Frequent in India; rare in other populations [@pmid:34711523].", - "age_onset": "Typical: 26-50; Range: 8-62 [@omim:604326; @pmid:42105155].", - "age_onset_min": 8, - "age_onset_max": 62, - "typ_age_onset_min": 26, - "typ_age_onset_max": 50, - "details": "Benign range is 6-32 repeats, intermediate range 40-49, and pathogenic range is 51-78 [@pmid:37906407]; intermediate alleles are associated with reduced penetrance [@pmid:11198281].", - "detection": "RP-PCR generally detects expansions, while PCR fragment analysis approximates allele size. Large expansions may require Southern blot confirmation [@pmid:35262663; @pmid:10581021].", - "mechanism": "GoF", - "mechanism_detail": "Polyalanine gain of function associated with RAN translation [@pmid:38467784].", - "year": "1999 [@pmid:10581021]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCT" - ], - "pathogenic_motif_reference_orientation": [ - "GCT" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 6, - "benign_max": 32, - "intermediate_min": 40, - "intermediate_max": 49, - "pathogenic_min": 51, - "pathogenic_max": 78, - "motif_len": 3, - "ref_copies": 10.7, - "novel": "ref", - "gard": [ - "10476" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "SPN293" - ], - "medgen": [ - "347653" - ], - "mondo": [ - "0011439" - ], - "omim": [ - "604326" - ], - "orphanet": [ - "98762" - ], - "gnomad": [ - "PPP2R2B" - ], - "stripy": [ - "PPP2R2B" - ], - "tr_atlas": [ - "TR59714" - ], - "webstr_hg38": [ - "985593", - "6072892" - ], - "webstr_hg19": [ - "Expansion_SCA12/PPP2R2B" - ], - "locus_tags": [ - "length_affects_penetrance" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "omim:604326", - "pmid:38467784", - "pmid:37906407", - "pmid:11198281", - "pmid:34711523", - "pmid:10581021", - "mondo:0011439" - ], - "additional_literature": [ - "pmid:42105155", - "pmid:42038259", - "pmid:41788301", - "pmid:41762523", - "pmid:41691974", - "pmid:41612618", - "pmid:41074692", - "pmid:40488180", - "pmid:39565297", - "pmid:39469072", - "pmid:38961870", - "pmid:38798069", - "pmid:38711441", - "pmid:38227102", - "pmid:38058854", - "pmid:35531119", - "pmid:33502644", - "pmid:32675418", - "pmid:32124191", - "pmid:30130680", - "pmid:29057148", - "pmid:27864267", - "pmid:26340331", - "pmid:26077168", - "pmid:25634432", - "pmid:25586539", - "pmid:25274186", - "pmid:24269018", - "pmid:21029765", - "pmid:20937954", - "pmid:20533062", - "pmid:18940801", - "pmid:18484086", - "pmid:17961920", - "pmid:16054804", - "pmid:11171892" - ] + "motif": "TCGGCTCGCCGCTGCTCCTCCTCC", + "count": 0, + "type": "interruption" }, { - "id": "HSAN-VIII_PRDM12", - "disease_id": "HSAN VIII", - "gene": "PRDM12", - "evidence": [ - "Moderate" - ], - "chrom": "chr9", - "start_hg38": 130681605, - "stop_hg38": 130681641, - "start_hg19": 133556992, - "stop_hg19": 133557028, - "start_t2t": 142886568, - "stop_t2t": 142886595, - "disease": "Hereditary sensory and autonomic neuropathy type VIII", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A hereditary sensory neuropathy characterized by congenital insensitivity to pain and decreased sweating and tear production that has material basis in homozygous mutation in the PRDM12 gene on chromosome 9q34 [@mondo:0014662].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Expansions found in 2 families from Pakistan and Saudi Arabia [@pmid:26005867]. All PRDM12 disease mutations < 1/1,000,000", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Pathogenic expansion found in 2 families, from whom pathogenic range (18-19) is inferred [@pmid:26005867]. Benign range (7-14) inferred from Human Gene Mutation Database [@genereviews:NBK535148].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Mutations abrogate the histone-modifying potential of PRDM12, consistent with a loss of function mechanism [@omim:616488].", - "year": "2015 [@pmid:26005867]", - "location_in_gene": "Coding Exon 5", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 7, - "benign_max": 14, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 18, - "pathogenic_max": 19, - "motif_len": 3, - "ref_copies": 12, - "novel": "ref", - "gard": [ - "17866" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "NRP044" - ], - "medgen": [ - "894363" - ], - "mondo": [ - "0014662" - ], - "omim": [ - "616488" - ], - "orphanet": [ - "478664" - ], - "gnomad": [ - "PRDM12" - ], - "stripy": [ - "PRDM12" - ], - "tr_atlas": [ - "TR97506" - ], - "webstr_hg38": [ - "1543400" - ], - "webstr_hg19": [ - "STR_1521945" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "omim:616488", - "pmid:26005867", - "genereviews:NBK535148", - "mondo:0014662" - ], - "additional_literature": [ - "pmid:41630927" - ] - }, - { - "id": "CJD_PRNP", - "disease_id": "CJD", - "gene": "PRNP", - "evidence": [ - "Moderate" - ], - "chrom": "chr20", - "start_hg38": 4699397, - "stop_hg38": 4699493, - "start_hg19": 4680043, - "stop_hg19": 4680139, - "start_t2t": 4738633, - "stop_t2t": 4738705, - "disease": "Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Schneiker syndrome (GSS) are a rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus [@genereviews:NBK1229]. These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat [@doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "<0.0225/1,000,000: <15% of CJ variants are repeat expansions [@genereviews:NBK535148]. 15% newly diagnosed prion disease cases are genetic [@genereviews:NBK1229], 1 individual per million per year worldwide (350 cases annually in US) [@pmid:29939637]. Found worldwide [@genereviews:NBK1229].", - "age_onset": "Typical: 50-60 [@genereviews:NBK1229]; Range: 31-63 [@pmid:37379724].", - "age_onset_min": 31, - "age_onset_max": 63, - "typ_age_onset_min": 50, - "typ_age_onset_max": 60, - "details": "Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln; any additional repeat leads to pathogenicity, with the largest repeat observed 16 motifs [@genereviews:NBK1229]. Insertion length may correspond to phenotype, such as CJD versus frontotemporal dementia [@pmid:36977684].", - "detection": null, - "mechanism": "LoF?", - "mechanism_detail": "Loss of function hypothesized [@pmid:38467784]", - "year": "1991 [@pmid:1683708]", - "location_in_gene": "Coding Exon 2", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGTGGTGGCTGGGGGCAGCCTCAT" - ], - "pathogenic_motif_reference_orientation": [ - "CCTCATGGTGGTGGCTGGGGGCAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGCCTCATGGTGGTGGCTGGGGGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "CCTCAGGGCGGTGGTGGCTGGGGGCAG", - "count": 1, - "type": "flank_repeat" - }, - { - "motif": "CCTCATGGTGGTGGCTGGGGGCAG", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 4, - "benign_max": 4, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 5, - "pathogenic_max": 16, - "motif_len": 24, - "ref_copies": null, - "novel": "ref", - "gard": [ - "17307" - ], - "genereviews": [ - "NBK1229" - ], - "malacard": [ - "CRT072" - ], - "medgen": [ - "155837" - ], - "mondo": [ - "0007403" - ], - "omim": [ - "123400" - ], - "orphanet": [ - "282166" - ], - "gnomad": [ - "PRNP" - ], - "stripy": [], - "tr_atlas": [ - "TR157963", - "TR157964" - ], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [ - "length_affects_phenotype" - ], - "disease_tags": [], - "references": [ - "genereviews:NBK1229", - "pmid:37379724", - "pmid:38467784", - "pmid:36977684", - "genereviews:NBK535148", - "pmid:29939637", - "pmid:1683708", - "doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1" - ], - "additional_literature": [ - "pmid:41890154", - "pmid:41009775", - "pmid:40803449", - "pmid:39256877", - "pmid:35926480", - "pmid:35903139", - "pmid:35752680", - "pmid:35585119", - "pmid:33131137", - "pmid:31795947", - "pmid:31127772", - "pmid:30777654", - "pmid:30530974", - "pmid:29966485", - "pmid:28003435", - "pmid:27400454", - "pmid:25239657", - "pmid:23998997", - "pmid:21686668", - "pmid:19092329", - "pmid:18397498", - "pmid:18366654", - "pmid:17709704", - "pmid:16858508", - "pmid:14729275", - "pmid:12805114", - "pmid:12451210", - "pmid:11593450", - "pmid:10611945", - "pmid:9710033", - "pmid:9565627", - "pmid:8030952" - ] - }, - { - "id": "FAME8_RAI1", - "disease_id": "FAME8", - "gene": "RAI1", - "evidence": [ - "Limited" - ], - "chrom": "chr17", - "start_hg38": 17808358, - "stop_hg38": 17808460, - "start_hg19": 17711672, - "stop_hg19": 17711774, - "start_t2t": 17754961, - "stop_t2t": 17755053, - "disease": "Familial adult myoclonic epilepsy type 8", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Observed in a single family from Mali with ten affected individuals [@pmid:37994247].", - "age_onset": "7-68 (one family)", - "age_onset_min": 7, - "age_onset_max": 68, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "TTTTA repeat expansions and TTTCA repeat insertions in intron 4 of the RAI1 gene that co-segregated with disease status in a single large family from Mali [@pmid:37994247]. Ten affected individuals were studied. Both TTTTA and TTTCA motifs were observed in all eight of the affected individuals with spanning reads, with allele sizes in the range: (TTTTA)278-773(TTTCA)9-334. A single individual was observed with additional motifs and interruptions in one allele with the structure: (TTTTA)exp(GGGGT)ins(GGGAT)ins(TTTCA)ins. TTTCA repeats were absent in 200 Malian controls, who had alleles in the range: (TTTCA)16-20. Reviewed in [@pmid:38876750]. It is uncertain if expansions at both the TTTTA and TTTCA motifs, or only the TTTCA motif are required for pathogenicity. The pathogenic range in STRchive is for the TTTCA motif only. Note: locus is partially deleted in T2T reference genome.", - "detection": null, - "mechanism": "Unknown", - "mechanism_detail": "Expression isn't changed [@pmid:7994247].", - "year": "2024 [@pmid:37994247]", - "location_in_gene": "Intron 4", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "TTTTA" - ], - "pathogenic_motif_reference_orientation": [ - "TTTCA" - ], - "benign_motif_reference_orientation": [ - "TTTTA" - ], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "GGGGT", - "GGGAT" - ], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [ - "ATTTT" - ], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "GGGGT", - "ATGGG" - ], - "locus_structure": [ - { - "motif": "TTTTA", - "count": 18, - "type": "internal_repeat" - }, - { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 9, - "pathogenic_max": 334, - "motif_len": 5, - "ref_copies": 20.8, - "novel": "novel", - "gard": [ - "16758" - ], - "genereviews": [], - "malacard": [], - "medgen": [], - "mondo": [], - "omim": [], - "orphanet": [ - "86814" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [ - "486849" - ], - "webstr_hg19": [], - "locus_tags": [ - "motif_affects_onset" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:7994247", - "pmid:37994247", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:41874439", - "pmid:41219789", - "pmid:40541176", - "pmid:38871700", - "pmid:37339841", - "pmid:34565721", - "pmid:33186760", - "pmid:32283749", - "pmid:32281848", - "pmid:30891880", - "pmid:30622881", - "pmid:25663198", - "pmid:23897707", - "pmid:17457615", - "pmid:15148657", - "pmid:11594924", - "pmid:10915763", - "pmid:8817239" - ] - }, - { - "id": "FAME7_RAPGEF2", - "disease_id": "FAME7", - "gene": "RAPGEF2", - "evidence": [ - "Limited" - ], - "chrom": "chr4", - "start_hg38": 159342526, - "stop_hg38": 159342618, - "start_hg19": 160263678, - "stop_hg19": 160263770, - "start_t2t": 162693303, - "stop_t2t": 162693405, - "disease": "Familial adult myoclonic epilepsy type 7", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. Repeat expansion found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 20-33 [@pmid:30351492]; Range: 18 [@pmid:29507423] - 37 [@pmid:30351492].", - "age_onset_min": 18, - "age_onset_max": 37, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "The locus structure is (TTTTA)exp(TTTCA)exp(TTTTA)n, where only the TTTCA is specific to affected individuals as a pathogenic insertion [@pmid:29507423; @pmid:30351492]. Pathogenic expansions range from 60 to thousands of repeats [@pmid:29507423; @pmid:30351492]. Interruptions seen: TATTA, TTTTTA [@pmid:35245110].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423].", - "year": "2018 [@pmid:29507423]", - "location_in_gene": "Intron 14", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "TTTTA" - ], - "pathogenic_motif_reference_orientation": [ - "TTTCA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "TTTTT", - "TTATG" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "TTTTT", - "ATGTT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "TTTTA", - "count": 17, - "type": "internal_repeat" - }, - { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 60, - "pathogenic_max": 2200, - "motif_len": 5, - "ref_copies": 17.4, - "novel": "novel", - "gard": [ - "16758" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "EPL228" - ], - "medgen": [ - "1648435" - ], - "mondo": [ - "0054847" - ], - "omim": [ - "618075" - ], - "orphanet": [ - "86814" - ], - "gnomad": [ - "RAPGEF2" - ], - "stripy": [ - "RAPGEF2" - ], - "tr_atlas": [ - "TR49300" - ], - "webstr_hg38": [ - "154264", - "4792219" - ], - "webstr_hg19": [ - "STR_1096016" - ], - "locus_tags": [ - "motif_affects_penetrance" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:30351492", - "pmid:29507423", - "pmid:35245110", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:41219789", - "pmid:36092952", - "pmid:33040085", - "pmid:31483537" - ] - }, - { - "id": "CANVAS_RFC1", - "disease_id": "CANVAS", - "gene": "RFC1", - "evidence": [ - "Definitive" - ], - "chrom": "chr4", - "start_hg38": 39348424, - "stop_hg38": 39348483, - "start_hg19": 39350044, - "stop_hg19": 39350103, - "start_t2t": 39318077, - "stop_t2t": 39318136, - "disease": "Cerebellar ataxia, neuropathy, and vestibular areflexia syndrome", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Sensory disturbances, imbalance, oscillopsia, chronic dry cough, dysarthria and dysphagia [@pmid:38876750]; Late-onset ataxia, sensory neuropathy, vestibular areflexia syndrome [@pmid:39349043]. This expansion has been implicated in the genetic etiology of Parkinson's disease [@pmid:41177915].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Carrier frequency in Europeans is 0.7-4% and in Chinese Han population is 2.24%; estimated prevalence of 1/20,000 to 1/625 [@genereviews:NBK564656]. Many cases are likely not diagnosed due to heterogeneous presentation [@pmid:39230846]. Observed in multiple ethnicities [@pmid:38876750]; patients diagnosed with European, Chinese Han, and Maori ancestry, as well as found in Japan, Canada, Brazil, the UK, Italy, Germany, and Australia [@genereviews:NBK564656].", - "age_onset": "Typical: 36-52; Range: 19-76 [@genereviews:NBK564656].", - "age_onset_min": 19, - "age_onset_max": 76, - "typ_age_onset_min": 36, - "typ_age_onset_max": 52, - "details": "Disease is caused by an insertion of a pathogenic motif, although motif presence is variable and can expand up to 200 repeats without apparently causing a phenotype [@genereviews:NBK564656]. Pathogenic expansions (ranging from 400-2750 pathogenic motifs) may be flanked by other motifs [@genereviews:NBK564656]. For example, (AAAGG)10-25(AAGGG)exp(AAAGG)4-6 [@pmid:32851396]. Motif heterogeneity is common in unaffected individuals [@genereviews:NBK564656], and motif associations are described by Delforge et al. [@pmid:38627134]. The pathogenic size threshold appears to differ for the AAAGG motif: AAAGG expansions >= 600 repeats have been observed in CANVAS patients (vs 400 with established pathogenic motif AAGGG), while ~100-380 AAAGG repeats were found in unaffected controls [@pmid:37450567]. Length appears to impact age of onset and disease severity, with particular impact from the smaller allele [@doi:10.1136/jnnp-2024-ABN.259]. Phenotypic spectrum may include Parkinsonism [@pmid:39833204], chronic cough [@pmid:39811557], idiopathic sensory neuropathy, small fiber neuropathy, and sensorimotor neuropathy [@pmid:41964406].", - "detection": "Expansions are suggested by flanking PCR failure and a pathogenic RP-PCR sawtooth pattern, but biallelic confirmation and sizing rely on Southern blotting [@genereviews:NBK564656]. Long-read sequencing or optical genome mapping are useful for resolving this variable, complex motif structure [@pmid:37892228; @pmid:37450567].", - "mechanism": "LoF", - "mechanism_detail": "LoF; exact mechanism unknown [@pmid:38467784].", - "year": "2019 [@pmid:31230722]", - "location_in_gene": "Intron 2", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "AAAAG" - ], - "pathogenic_motif_reference_orientation": [ - "AAGGG", - "ACAGG", - "AAAGG", - "AGGGC" - ], - "benign_motif_reference_orientation": [ - "AAAAG", - "AAAGGG" - ], - "unknown_motif_reference_orientation": [ - "AAAAA", - "AAAAC", - "AACGG", - "AAGAC", - "AAGGT", - "AGGGG", - "AAGAG", - "AAAAGG", - "AAACG", - "AACAG", - "AGGTG", - "ACGGG", - "AAAAAG", - "AAGGC" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CCCTT", - "CCTGT", - "CCTTT", - "CCCTG" - ], - "benign_motif_gene_orientation": [ - "CTTTT", - "CCCTTT" - ], - "unknown_motif_gene_orientation": [ - "TTTTT", - "GTTTT", - "CCGTT", - "CTTGT", - "ACCTT", - "CCCCT", - "CTCTT", - "CCTTTT", - "CGTTT", - "CTGTT", - "ACCTC", - "CCCGT", - "CTTTTT", - "CCTTG" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "AAAAG", - "count": 11, - "type": "internal_repeat" - }, - { - "motif": "AAGGG", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 0, - "benign_max": 11, - "intermediate_min": 11, - "intermediate_max": 200, - "pathogenic_min": 400, - "pathogenic_max": 2750, - "motif_len": 5, - "ref_copies": 11.8, - "novel": "novel", - "gard": [ - "17937" - ], - "genereviews": [ - "NBK564656" - ], - "malacard": [ - "CRB196" - ], - "medgen": [ - "482853" - ], - "mondo": [ - "0044720" - ], - "omim": [ - "614575" - ], - "orphanet": [ - "504476" - ], - "gnomad": [ - "RFC1" - ], - "stripy": [ - "RFC1" - ], - "tr_atlas": [ - "TR42349" - ], - "webstr_hg38": [ - "4722884", - "99101" - ], - "webstr_hg19": [ - "STR_1036603" - ], - "locus_tags": [ - "motif_affects_penetrance", - "length_affects_onset", - "length_affects_severity" - ], - "disease_tags": [ - "ataxia", - "phenotypic_spectrum" - ], - "references": [ - "genereviews:NBK564656", - "pmid:38467784", - "pmid:32851396", - "pmid:38627134", - "pmid:37450567", - "doi:10.1136/jnnp-2024-ABN.259", - "pmid:39833204", - "pmid:39811557", - "pmid:41964406", - "pmid:39230846", - "pmid:38876750", - "pmid:31230722", - "pmid:39349043", - "pmid:41177915" - ], - "additional_literature": [ - "pmid:42178418", - "pmid:42096001", - "pmid:42094143", - "pmid:42038259", - "pmid:41840142", - "pmid:41780084", - "pmid:41689662", - "pmid:41614301", - "pmid:41592538", - "pmid:41532091", - "pmid:41426430", - "pmid:41327893", - "pmid:41322202", - "pmid:41278766", - "pmid:41145152", - "pmid:41118032", - "pmid:41084404", - "pmid:41074692", - "pmid:41055766", - "pmid:40898875", - "pmid:40894141", - "pmid:40802152", - "pmid:40765612", - "pmid:40637932", - "pmid:40595562", - "pmid:40594369", - "pmid:40488180", - "pmid:40481300", - "pmid:40461673", - "pmid:40417743", - "pmid:40313272", - "pmid:40273470", - "pmid:40221271", - "pmid:40211677", - "pmid:40204545", - "pmid:40141365", - "pmid:40113266", - "pmid:40007153", - "pmid:39812846", - "pmid:39721397", - "pmid:39571249", - "pmid:39543176", - "pmid:39507594", - "pmid:39416949", - "pmid:39406499", - "pmid:39342186", - "pmid:39286915", - "pmid:39231235", - "pmid:39219417", - "pmid:39152783", - "pmid:39076534", - "pmid:38978724", - "pmid:38916676", - "pmid:38789445", - "pmid:38579416", - "pmid:38487929", - "pmid:38447794", - "pmid:38381906", - "pmid:38381176", - "pmid:38324175", - "pmid:38311638", - "pmid:38306376", - "pmid:38266156", - "pmid:38193360", - "pmid:38168171", - "pmid:38145611", - "pmid:38062616", - "pmid:38054570", - "pmid:37917284", - "pmid:37892228", - "pmid:37853169", - "pmid:37747091", - "pmid:37660923", - "pmid:37578187", - "pmid:37546920", - "pmid:37476326", - "pmid:37460231", - "pmid:37414537", - "pmid:37399286", - "pmid:36805468", - "pmid:36753892", - "pmid:36705320", - "pmid:36381255", - "pmid:36289003", - "pmid:36250766", - "pmid:36227727", - "pmid:36214978", - "pmid:36177974", - "pmid:36088850", - "pmid:36061987", - "pmid:36046423", - "pmid:36034314", - "pmid:35884855", - "pmid:35883251", - "pmid:35864213", - "pmid:35633373", - "pmid:35585435", - "pmid:35502508", - "pmid:35355059", - "pmid:35306791", - "pmid:35253317", - "pmid:38835435", - "pmid:35013364", - "pmid:34968871", - "pmid:34927205", - "pmid:34600502", - "pmid:34537679", - "pmid:34101140", - "pmid:33969391", - "pmid:33940977", - "pmid:33884451", - "pmid:33807868", - "pmid:33745133", - "pmid:33666721", - "pmid:33495376", - "pmid:33188504", - "pmid:33103729", - "pmid:33068477", - "pmid:33068476", - "pmid:32949124", - "pmid:32939785", - "pmid:32910249", - "pmid:32873692", - "pmid:32732387", - "pmid:32694621", - "pmid:32682126", - "pmid:32582864", - "pmid:32151945", - "pmid:32066831", - "pmid:32040566", - "pmid:31824583", - "pmid:31817852", - "pmid:31370354", - "pmid:30926972", - "pmid:25648260", - "pmid:25007187", - "pmid:24686188", - "pmid:22086855", - "pmid:15457444", - "pmid:12556494" - ] - }, - { - "id": "OPDM4_RILPL1", - "disease_id": "OPDM4", - "gene": "RILPL1", - "evidence": [ - "Moderate" - ], - "chrom": "chr12", - "start_hg38": 123533720, - "stop_hg38": 123533750, - "start_hg19": 124018267, - "stop_hg19": 124018297, - "start_t2t": 123532573, - "stop_t2t": 123532603, - "disease": "Oculopharyngodistal myopathy type 4", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Ptosis, external ophthalmoplegia, facial weakness, and pharyngeal and distal limb weakness [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Population dependent: 21.6% of one OPDM cohort [@pmid:35148830]. Typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 18-30 [@pmid:35148830]; Range: 10-30 [@pmid:35700120].", - "age_onset_min": 10, - "age_onset_max": 30, - "typ_age_onset_min": 18, - "typ_age_onset_max": 30, - "details": "Benign alleles have been documented to have 6-16 repeats [@pmid:37864208], while pathogenic repeats range from 120 to 197 repeats; there is no apparent relationship between allele size and age of onset [@pmid:37864208; @pmid:35148830]. Intermediate alleles may be associated with incomplete penetrance, or milder phenotypes [@pmid:35148830]. AGG, TGG, and CGT interruptions observed [@pmid:35148830; @pmid:35700120].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to RNA-mediated gain-of-function mechanism [@pmid:38467784].", - "year": "2022 [@pmid:35148830]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GGC" - ], - "pathogenic_motif_reference_orientation": [ - "GGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "TGG", - "CGT", - "AGG" - ], - "pathogenic_motif_gene_orientation": [ - "CCG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "ACC", - "ACG", - "CCT" - ], - "locus_structure": [], - "benign_min": 6, - "benign_max": 16, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 120, - "pathogenic_max": 197, - "motif_len": 3, - "ref_copies": 11.7, - "novel": "ref", - "gard": [ - "12592" - ], - "genereviews": [], - "malacard": [ - "OCL085" - ], - "medgen": [ - "1809981" - ], - "mondo": [ - "0030712" - ], - "omim": [], - "orphanet": [ - "98897" - ], - "gnomad": [ - "RILPL1" - ], - "stripy": [ - "RILPL1" - ], - "tr_atlas": [ - "TR121403" - ], - "webstr_hg38": [ - "5128610", - "609239" - ], - "webstr_hg19": [ - "STR_347096" - ], - "locus_tags": [], - "disease_tags": [ - "oculopharyngodistal_myopathy" - ], - "references": [ - "pmid:35148830", - "pmid:35700120", - "pmid:38467784", - "pmid:37864208", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:41792844", - "pmid:40645757", - "pmid:40084170", - "pmid:39044557", - "pmid:39013564", - "pmid:37923380" - ] - }, - { - "id": "CCD_RUNX2", - "disease_id": "CCD", - "gene": "RUNX2", - "evidence": [ - "Definitive" - ], - "chrom": "chr6", - "start_hg38": 45422750, - "stop_hg38": 45422801, - "start_hg19": 45390487, - "stop_hg19": 45390538, - "start_t2t": 45257567, - "stop_t2t": 45257618, - "disease": "Cleidocranial dysplasia", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A condition that primarily affects the development of the bones and teeth. Characteristic features include underdeveloped or absent collarbones (clavicles); dental abnormalities; and delayed closing of the spaces between the skull bones (fontanels). Other features may include decreased bone density (osteopenia), osteoporosis, hearing loss, bone abnormalities of the hands, and recurrent sinus and ear infections [@mondo:0007340].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "All conditions 1/1,000,000 births (likely underdiagnosed); Utah population frequency 0.12/10,000. Found in many ethnic groups [@orphanet:1452]. TR expansions causative in 2 individuals [@genereviews:NBK535148].", - "age_onset": "0 (birth) [@genereviews:NBK1513].", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (4-17 repeats) established from gnomAD and primary literature; pathogenic ranges (20-27) reflect two clinical cases to date [@gnomad:RUNX2; @pmid:26220009]. Intermediate alleles (i.e, 18 repeats; 19 not reported) appear to not be associated with disease [@pmid:20560987; @pmid:26220009]. The gene RUNX2 was previously called CBFA1, as reflected in some of the literature [@pmid:9182765].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansion leading to haploinsufficiency [@pmid:26220009].", - "year": "Causation identified in 2015 [@pmid:26220009]; clinical association found in 1997 [@pmid:9182765]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 4, - "benign_max": 17, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 20, - "pathogenic_max": 27, - "motif_len": 3, - "ref_copies": 15, - "novel": "ref", - "gard": [ - "6118" - ], - "genereviews": [ - "NBK1513" - ], - "malacard": [ - "CLD001" - ], - "medgen": [ - "3486" - ], - "mondo": [ - "0007340" - ], - "omim": [ - "119600" - ], - "orphanet": [ - "1452" - ], - "gnomad": [ - "RUNX2" - ], - "stripy": [ - "RUNX2" - ], - "tr_atlas": [ - "TR65117" - ], - "webstr_hg38": [ - "5789216" - ], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "genereviews:NBK1513", - "pmid:26220009", - "gnomad:RUNX2", - "pmid:20560987", - "pmid:9182765", - "orphanet:1452", - "genereviews:NBK535148", - "mondo:0007340" - ], - "additional_literature": [ - "pmid:41468806", - "pmid:40585427", - "pmid:37365568", - "pmid:37202645", - "pmid:32386547", - "pmid:24497578", - "pmid:22912713", - "pmid:21887706", - "pmid:19264154" - ] - }, - { - "id": "FAME1_SAMD12", - "disease_id": "FAME1", - "gene": "SAMD12", - "evidence": [ - "Definitive" - ], - "chrom": "chr8", - "start_hg38": 118366812, - "stop_hg38": 118366918, - "start_hg19": 119379051, - "stop_hg19": 119379157, - "start_t2t": 119495247, - "stop_t2t": 119495353, - "disease": "Familial adult myoclonic epilepsy type 1", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750]; Adult-onset cortical myoclonus, with seizures in up to a half of patients [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. Typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 21-39 [@pmid:29939203]; Range: 8 [@pmid:40503331] - 68 [@pmid:29507423].", - "age_onset_min": 8, - "age_onset_max": 68, - "typ_age_onset_min": 21, - "typ_age_onset_max": 39, - "details": "Novel, pathogenic alleles include expansions of TTTTAn + TTTCAn, but only the TTTCA insertion is specific to affected individuals and associated with symptom age of onset [@pmid:39569876]; pathogenic expansions range from 105 to 3860 repeats [@omim:601068; @pmid:29507423]", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA mediated gain of function proposed [@omim:601068; @pmid:38467784].", - "year": "2018 [@pmid:29507423]", - "location_in_gene": "Intron 4/4", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "TAAAA" - ], - "pathogenic_motif_reference_orientation": [ - "TGAAA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "AAAAA", - "TAAAC", - "TAACA", - "TACAA", - "TACAC" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "TTTTT", - "AGTTT", - "ATGTT", - "ATTGT", - "AGTGT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "TAAAA", - "count": 20, - "type": "internal_repeat" - }, - { - "motif": "TGAAA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 105, - "pathogenic_max": 3680, - "motif_len": 5, - "ref_copies": 21.6, - "novel": "novel", - "gard": [ - "18082" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "EPL201" - ], - "medgen": [ - "371424" - ], - "mondo": [ - "0010985" - ], - "omim": [ - "601068" - ], - "orphanet": [ - "86814" - ], - "gnomad": [ - "SAMD12" - ], - "stripy": [ - "SAMD12" - ], - "tr_atlas": [ - "TR89226" - ], - "webstr_hg38": [ - "1087693" - ], - "webstr_hg19": [], - "locus_tags": [ - "somatic_instability", - "anticipation", - "motif_affects_instability", - "motif_affects_onset", - "motif_affects_penetrance", - "maternal_expansion" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:29939203", - "pmid:40503331", - "pmid:29507423", - "omim:601068", - "pmid:38467784", - "pmid:39569876", - "pmid:38876750", - "pmid:39349043" - ], - "additional_literature": [ - "pmid:41874439", - "pmid:41850906", - "pmid:41426430", - "pmid:41219789", - "pmid:38961870", - "pmid:38467733", - "pmid:38059543", - "pmid:37592133", - "pmid:36740228", - "pmid:36622139", - "pmid:36092952", - "pmid:33791773", - "pmid:33721773", - "pmid:33681653", - "pmid:33501421", - "pmid:33040085", - "pmid:32973343", - "pmid:32203200", - "pmid:32194077", - "pmid:32174879", - "pmid:31664039", - "pmid:31483537", - "pmid:30559482", - "pmid:30351492", - "pmid:30194086" - ] - }, - { - "id": "XLID_SOX3", - "disease_id": "XLID, PHPX", - "gene": "SOX3", - "evidence": [ - "Limited" - ], - "chrom": "chrX", - "start_hg38": 140504316, - "stop_hg38": 140504361, - "start_hg19": 139586481, - "stop_hg19": 139586526, - "start_t2t": 138816203, - "stop_t2t": 138816248, - "disease": "X-linked intellectual developmental disorder with isolated growth hormone deficiency; X-linked panhypopituitarism (PHPX)", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "X-linked isolated growth hormone deficiency (GHD) or combined pituitary hormone deficiency (CPHD) patients with or without intellectual disability [@pmid:24346842].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "3 families reported, however they were distributed across the world [@omim:300123].", - "age_onset": "Typical: 0-3 (small sample size) [@pmid:19654509; @pmid:21289259]; range: 0-9 [@pmid:19654509].", - "age_onset_min": 0, - "age_onset_max": 9, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Expansion to 22-26 repeats or contraction to 8 repeats can cause disease, as reported in 3 families [@genereviews:NBK535148]. There is phenotypic and allelic overlap between XLID and PHPX, with the pathogenic threshold for XLID estimated at 26 motifs and the pathogenic threshold for PHPX estimated at 22 motifs [@pmid:15800844, @pmid:12428212].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansions leading to aggresome formation and impaired transcriptional activity [@pmid:17127446].", - "year": "2002 [@pmid:12428212]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "NGC" - ], - "pathogenic_motif_reference_orientation": [ - "NGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 22, - "pathogenic_max": 26, - "motif_len": 3, - "ref_copies": 15, - "novel": "ref", - "gard": [], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "PNH005", - "INT405" - ], - "medgen": [ - "394771" - ], - "mondo": [ - "0010252" - ], - "omim": [ - "300123", - "312000" - ], - "orphanet": [ - "67045" - ], - "gnomad": [ - "SOX3" - ], - "stripy": [ - "SOX3" - ], - "tr_atlas": [ - "TR173479" - ], - "webstr_hg38": [], - "webstr_hg19": [ - "STR_1597784" - ], - "locus_tags": [ - "contraction" - ], - "disease_tags": [], - "references": [ - "pmid:19654509", - "pmid:21289259", - "pmid:17127446", - "genereviews:NBK535148", - "pmid:15800844", - "pmid:12428212", - "omim:300123", - "pmid:24346842" - ], - "additional_literature": [] - }, - { - "id": "FAME2_STARD7", - "disease_id": "FAME2", - "gene": "STARD7", - "evidence": [ - "Strong" - ], - "chrom": "chr2", - "start_hg38": 96197066, - "stop_hg38": 96197124, - "start_hg19": 96862804, - "stop_hg19": 96862862, - "start_t2t": 96703674, - "stop_t2t": 96703732, - "disease": "Familial adult myoclonic epilepsy 2", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Finger, hand tremor with later-onset myoclonus and generalised tonic-clonic seizures [@pmid:39349043].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "This repeat expansion is typically found in individuals of European ancestry [@pmid:38876750].", - "age_onset": "Typical: 12-30; Range: 4-60 [@pmid:31664034].", - "age_onset_min": 4, - "age_onset_max": 60, - "typ_age_onset_min": 12, - "typ_age_onset_max": 30, - "details": "Disease caused by novel insertion of pathogenic motif (not found in any controls); size of pathogenic motif observed in two probands ranged from ~274-558 repeats, while the expanded reference motif ranged from 340-390 [@pmid:31664034].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity theorized [@pmid:31664034; @pmid:38467784].", - "year": "2019 [@pmid:31664034]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "AAAAT" - ], - "pathogenic_motif_reference_orientation": [ - "AAATG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "AAAAA", - "AAAAC", - "AAACC", - "AAACG", - "AAACT", - "AACTC", - "AACTG", - "AATAC", - "AATAG", - "ATAAC" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "TTTTT", - "GTTTT", - "GGTTT", - "CGTTT", - "AGTTT", - "AGTTG", - "AGTTC", - "ATTGT", - "ATTCT", - "ATGTT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "AAATG", - "count": null, - "type": "pathogenic_repeat" - }, - { - "motif": "AAAAT", - "count": 11, - "type": "internal_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 274, - "pathogenic_max": 558, - "motif_len": 5, - "ref_copies": 11.6, - "novel": "novel", - "gard": [ - "18083" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "EPL203" - ], - "medgen": [ - "375031" - ], - "mondo": [ - "0011930" - ], - "omim": [ - "607876" - ], - "orphanet": [ - "86814" - ], - "gnomad": [ - "STARD7" - ], - "stripy": [ - "STARD7" - ], - "tr_atlas": [ - "TR19329" - ], - "webstr_hg38": [ - "286156" - ], - "webstr_hg19": [ - "STR_754470" - ], - "locus_tags": [ - "somatic_instability", - "motif_affects_instability", - "motif_affects_penetrance" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:31664034", - "pmid:38467784", - "pmid:38876750", - "pmid:39349043" - ], - "additional_literature": [ - "pmid:41219789", - "pmid:33040085" - ] - }, - { - "id": "XDP_TAF1", - "disease_id": "XDP", - "gene": "TAF1", - "evidence": [ - "Definitive" - ], - "chrom": "chrX", - "start_hg38": 71453054, - "stop_hg38": 71453131, - "start_hg19": 70672904, - "stop_hg19": 70672981, - "start_t2t": 69887153, - "stop_t2t": 69887230, - "disease": "X-linked dystonia-parkinsonism (XDP) a.k.a. Dystonia 3, torsion, X-linked (DYT3)", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "X-linked dystonia-parkinsonism (XDP) associated with antisense insertion of a SINE-VNTR-Alu (SVA)-type retrotransposon within an intron of TAF1. Clinical features include focal and generalised dystonia, parkinsonism, cognitive dysfunction. XX individuals who are heterozygous carriers usually do not develop the full syndrome, although some patients have non-progressive focal dystonia with parkinsonism. Disease severity is associated with number of hexanucleotide repeats within the SVA. (Adapted) [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Philippines overall 0.34:100,000. Panay Islands 5.24:100,000. Capiz province 18.9:100,000. To date, all known cases to date are of Filipino descent [@pmid:38876750].", - "age_onset": "Average age of onset for XDP is 39.7 years in males, 52 years in females, range 12-79 years. ~99% of cases are male [@pmid:29229810; @pmid:38876750; @pmid:15596620].", - "age_onset_min": 12, - "age_onset_max": 79, - "typ_age_onset_min": 39.7, - "typ_age_onset_max": 39.7, - "details": "Strong inverse relationship between age of onset and insertion length, which varied between 35-52 repeats [@pmid:29229810].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Altered splicing with intron retention, haploinsufficiency [@pmid:38876750].", - "year": "2017 [@pmid:29229810]", - "location_in_gene": "Intron 32", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "AGAGGG" - ], - "pathogenic_motif_reference_orientation": [ - "AGAGGG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGAGGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 35, - "pathogenic_max": 52, - "motif_len": 6, - "ref_copies": 4, - "novel": "ref", - "gard": [ - "10533" - ], - "genereviews": [ - "NBK1489" - ], - "malacard": [ - "DYS064" - ], - "medgen": [ - "326820" - ], - "mondo": [ - "0010747" - ], - "omim": [ - "314250" - ], - "orphanet": [ - "53351" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [ - "TR592600" - ], - "webstr_hg38": [ - "861907" - ], - "webstr_hg19": [ - "STR_1564408" - ], - "locus_tags": [ - "length_affects_onset" - ], - "disease_tags": [], - "references": [ - "pmid:29229810", - "pmid:38876750", - "pmid:15596620" - ], - "additional_literature": [ - "pmid:41443196", - "pmid:40463055", - "pmid:38834915", - "pmid:38616406", - "pmid:37234925", - "pmid:35971992", - "pmid:38835911", - "pmid:35868859", - "pmid:35481544", - "pmid:35395816", - "pmid:38835428", - "pmid:34250228", - "pmid:34111553", - "pmid:32533168", - "pmid:32152096", - "pmid:27806289", - "pmid:18952144", - "pmid:18713817", - "pmid:17273961", - "pmid:7668293", - "pmid:7829058", - "pmid:1518853" - ] - }, - { - "id": "OPDM_TBC1D7", - "disease_id": "OPDM", - "gene": "TBC1D7", - "evidence": [ - "Provisional" - ], - "chrom": "chr6", - "start_hg38": 13328476, - "stop_hg38": 13328603, - "start_hg19": 13328708, - "stop_hg19": 13328835, - "start_t2t": 13201716, - "stop_t2t": 13201843, - "disease": "Oculopharyngodistal myopathy", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "This is a newly proposed locus for OPDM, only having been reported in one paper [@pmid:41959811]. Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, leg and arm weakness, as well as muscle wasting in the face and in the legs and arms. Many people have respiratory problems due to respiratory muscle weakness. In rare cases, there is also hearing loss, as well as severe weakness in muscles of the forearms and thighs. As the disease progresses, other muscles may be affected. A blood exam may show an increased creatine kinase level and an abnormal EMG [@mondo:0025193].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in 3 families (7 total patients) of European ancestry [@pmid:41959811].", - "age_onset": "2nd to 6th decade (3/5 patients had onset in 2nd decade). Referred to as adult onset, so assuming high end of 2nd decade [@pmid:41959811]", - "age_onset_min": 18, - "age_onset_max": 59, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Benign range (0-60) estimated from population data and pathogenic range (83-148) gathered from 7 patients from 3 unrelated families [@pmid:41959811]. The hg38 coordinates reported in the paper (chr6:13328476-13328603) [@pmid:41959811] contain multiple annotated TRs and interruptions, so the true coordinates are likely more narrow.", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Gain of Function apparent, but mechanism is unknown. Methylation and RAN translation have been oberserved [@pmid:41959811].", - "year": "2026 [@pmid:41959811]", - "location_in_gene": "5' UTR", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 0, - "benign_max": 60, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 83, - "pathogenic_max": 148, - "motif_len": 3, - "ref_copies": null, - "novel": "ref", - "gard": [ - "12592" - ], - "genereviews": [], - "malacard": [], - "medgen": [ - "320250" - ], - "mondo": [], - "omim": [ - "612655" - ], - "orphanet": [ - "98897" - ], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [ - "oculopharyngodistal_myopathy" - ], - "references": [ - "pmid:41959811", - "mondo:0025193" - ], - "additional_literature": [] - }, - { - "id": "SCA17_TBP", - "disease_id": "SCA17", - "gene": "TBP", - "evidence": [ - "Definitive" - ], - "chrom": "chr6", - "start_hg38": 170561906, - "stop_hg38": 170562017, - "start_hg19": 170870994, - "stop_hg19": 170871105, - "start_t2t": 171935458, - "stop_t2t": 171935569, - "disease": "Spinocerebellar ataxia type 17", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by a variable clinical picture which can include dementia, psychiatric disorders, parkinsonism, dystonia, chorea, spasticity, and epilepsy [@mondo:0011781].", - "hpo_terms": null, - "prevalence": "0.2/100000", - "prevalence_details": "Unknown (global), <100 families, 0.47:1,000,000 (Japanese), 0.16/100,000 (England) [@genereviews:NBK1438; @pmid:29100084]: 0.2/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1438].", - "age_onset": "Typical: 19-48; Range: 3-62, has second variant to delay onset [@omim:607136].", - "age_onset_min": 3, - "age_onset_max": 62, - "typ_age_onset_min": 19, - "typ_age_onset_max": 48, - "details": "Benign range is 25-40 repeats, pathogenic range is 49+ repeats (largest to date 66 motifs, with mild correlation between size and age of onset), and intermediate alleles (41-48 repeats) are associated with reduced penetrance and potentially milder phenotypes [@genereviews:NBK1438]. Huntington's disease-like phenotype [@pmid:12805114]. CAA CAG CAA interruption is seen in all alleles stably transmitted across generations [@genereviews:NBK1438;@pmid:35245110].", - "detection": "Short-read sequencing is reported to detect expansions but cannot size alleles beyond 250 bp. PCR amplification may detect expansions of ≤66 repeats [@pmid:37906407; @genereviews:NBK1438].", - "mechanism": "LoF/GoF", - "mechanism_detail": "Polyglutamine expansion leading to transcriptional dysregulation [@pmid:35053321].", - "year": "1999 [@pmid:10484774]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "CAA" - ], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AAC" - ], - "locus_structure": [], - "benign_min": 25, - "benign_max": 40, - "intermediate_min": 41, - "intermediate_max": 48, - "pathogenic_min": 49, - "pathogenic_max": 66, - "motif_len": 3, - "ref_copies": 37, - "novel": "ref", - "gard": [ - "10469" - ], - "genereviews": [ - "NBK1438" - ], - "malacard": [ - "SPN296" - ], - "medgen": [ - "337637" - ], - "mondo": [ - "0011781" - ], - "omim": [ - "607136" - ], - "orphanet": [ - "98759" - ], - "gnomad": [ - "TBP" - ], - "stripy": [ - "TBP" - ], - "tr_atlas": [ - "TR72502" - ], - "webstr_hg38": [ - "83566" - ], - "webstr_hg19": [], - "locus_tags": [ - "somatic_instability", - "anticipation", - "paternal_expansion", - "length_affects_onset", - "length_affects_penetrance", - "length_affects_phenotype", - "motif_affects_instability" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "omim:607136,@pmid:35053321,@genereviews:NBK1438,@pmid:12805114,@genereviews:NBK1438", - "pmid:35245110,@genereviews:NBK1438,@pmid:29100084,@pmid:10484774,@mondo:0011781" - ], - "additional_literature": [ - "pmid:42196324", - "pmid:42038259", - "pmid:41843312", - "pmid:41762523", - "pmid:41612618", - "pmid:41009775", - "pmid:40488180", - "pmid:40478462", - "pmid:39950762", - "pmid:39820777", - "pmid:39680235", - "pmid:39456985", - "pmid:39125760", - "pmid:38973070", - "pmid:38961870", - "pmid:38494459", - "pmid:37855597", - "pmid:37632648", - "pmid:37146135", - "pmid:36599645", - "pmid:36476347", - "pmid:36422518", - "pmid:35926480", - "pmid:35868859", - "pmid:35493319", - "pmid:35482253", - "pmid:35275350", - "pmid:35182509", - "pmid:34906452", - "pmid:34600502", - "pmid:34565721", - "pmid:34256333", - "pmid:34235484", - "pmid:33502644", - "pmid:33377399", - "pmid:32675418", - "pmid:32533168", - "pmid:32386547", - "pmid:31940111", - "pmid:31919387", - "pmid:31522753", - "pmid:30920184", - "pmid:30891880", - "pmid:30617627", - "pmid:30615214", - "pmid:30532692", - "pmid:30314815", - "pmid:30120431", - "pmid:29801887", - "pmid:29564144", - "pmid:29249939", - "pmid:29057148", - "pmid:28821675", - "pmid:28585930", - "pmid:28444220", - "pmid:28153533", - "pmid:27865706", - "pmid:27400454", - "pmid:27172828", - "pmid:26476771", - "pmid:26387956", - "pmid:26374734", - "pmid:26267067", - "pmid:26077168", - "pmid:25672822", - "pmid:24972706", - "pmid:24677642", - "pmid:24534762", - "pmid:23665119", - "pmid:23475385", - "pmid:21710129", - "pmid:21562248", - "pmid:21437269", - "pmid:20587494", - "pmid:20199210", - "pmid:20004653", - "pmid:19595623", - "pmid:19566714", - "pmid:18218637", - "pmid:18043721", - "pmid:17961920", - "pmid:17420317", - "pmid:17273961", - "pmid:17033685", - "pmid:16858508", - "pmid:16626296", - "pmid:16223509", - "pmid:16054804", - "pmid:15850778", - "pmid:15533937", - "pmid:15503103", - "pmid:15381080", - "pmid:15365789", - "pmid:15225551", - "pmid:15193429", - "pmid:14985389", - "pmid:14967767", - "pmid:12953269", - "pmid:12891385", - "pmid:12853230", - "pmid:12758065", - "pmid:11939898", - "pmid:11571212", - "pmid:11313753", - "pmid:9399691", - "pmid:8886170", - "pmid:7892196", - "pmid:8503450" - ] - }, - { - "id": "TOF_TBX1", - "disease_id": "TOF", - "gene": "TBX1", - "evidence": [ - "Limited" - ], - "chrom": "chr22", - "start_hg38": 19766762, - "stop_hg38": 19766807, - "start_hg19": 19754285, - "stop_hg19": 19754330, - "start_t2t": 20143615, - "stop_t2t": 20143660, - "disease": "Tetralogy of Fallot", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Tetralogy of Fallot is a congenital cardiac malformation that consists of an interventricular communication, also known as a ventricular septal defect, obstruction of the right ventricular outflow tract, override of the ventricular septum by the aortic root, and right ventricular hypertrophy [@mondo:0008542].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in one Turkish individual [@genereviews:NBK535148].", - "age_onset": "0", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Found in one Turkish individual with Tetralogy of Fallot who had 25 repeats rather than 15 [@genereviews:NBK535148].", - "detection": null, - "mechanism": "LoF/GoF", - "mechanism_detail": "Polyalanine expansion, leading to cytoplasmic aggregation [@omim:187500; @pmid:19948535].", - "year": "2010 [@pmid:19948535]", - "location_in_gene": "Coding Exon 9", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 25, - "pathogenic_max": 25, - "motif_len": 3, - "ref_copies": 15, - "novel": "ref", - "gard": [ - "2245" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "TTR001" - ], - "medgen": [ - "21498" - ], - "mondo": [ - "0008542" - ], - "omim": [ - "187500" - ], - "orphanet": [ - "3303" - ], - "gnomad": [ - "TBX1" - ], - "stripy": [ - "TBX1" - ], - "tr_atlas": [ - "TR163862" - ], - "webstr_hg38": [ - "4900984" - ], - "webstr_hg19": [ - "STR_889797" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "omim:187500", - "pmid:19948535", - "genereviews:NBK535148", - "mondo:0008542" - ], - "additional_literature": [ - "pmid:41607489", - "pmid:24797903", - "pmid:16141220", - "pmid:10440825" - ] - }, - { - "id": "FECD3_TCF4", - "disease_id": "FECD3", - "gene": "TCF4", - "evidence": [ - "Definitive" - ], - "chrom": "chr18", - "start_hg38": 55586153, - "stop_hg38": 55586229, - "start_hg19": 53253384, - "stop_hg19": 53253460, - "start_t2t": 55789233, - "stop_t2t": 55789288, - "disease": "Fuchs endothelial corneal dystrophy 3", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Late-onset Fuchs endothelial corneal dystrophy (FECD) is a degenerative disorder ... distinguished from other corneal disorders by the progressive formation of guttae [@omim:613267]. Studies suggest that disease severity increases in women with greater lifetime exposure to oestrogen [@pmid:40374208].", - "hpo_terms": null, - "prevalence": "4.5/100", - "prevalence_details": "~4/100 (over 40) [@omim:613267]; 5/100 [@pmid:20825314]. Predominantly in women (~75%) [@pmid:16769829]. In one study of two cohorts (Dallas Heart Study and 1000 Genomes Project), expanded allele carrier rates were 3.1% (African American), 8.1% (European American), and 3.3% (Latinos)in DHS, and 2.7% (AFR), 9.5% (EUR), 5.2% (East Asians), 7.2% (South Asians), and 5.2% (admixed Americans) in 1KGP [@pmid:39669694]. The highest carrier prevalence (12.1%–12.5%) occurred in EUR and admixed American subpopulations, while rates were 0%–1.9% in West Africans vs 6.2% in a Kenyan subpopulation.", - "age_onset": "Typical: 40-59 [@pmid:1676829]; Range: 32 [@pmid:21245398] - 79 [@pmid:39998965].", - "age_onset_min": 32, - "age_onset_max": 79, - "typ_age_onset_min": 40, - "typ_age_onset_max": 59, - "details": "Most controls have <40 repeats while majority of patients have >50 repeats; penetrance is <100%, as unaffected individuals have been documented with >80 repeats and alleles of affected individuals range from 12-2600 [@genereviews:NBK535148; @pmid:25168903]. Expansions are causative in approximately 70% of disease cases [@genereviews:NBK535148].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Sequestration of MBNL1 in RNA foci, similar to the mechanism underlying myotonic dystrophy-1 [@pmid:25593321]. Variation in RAN translation [@pmid:38467784].", - "year": "2012 [@pmid:23185296]", - "location_in_gene": "Intron 1", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CTG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 39, - "intermediate_min": 40, - "intermediate_max": 50, - "pathogenic_min": 51, - "pathogenic_max": 2600, - "motif_len": 3, - "ref_copies": 25.3, - "novel": "ref", - "gard": [ - "10018" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "FCH001", - "CRN120" - ], - "medgen": [ - "442479" - ], - "mondo": [ - "0013203" - ], - "omim": [ - "613267" - ], - "orphanet": [ - "98974" - ], - "gnomad": [ - "TCF4" - ], - "stripy": [ - "TCF4" - ], - "tr_atlas": [ - "TR151784" - ], - "webstr_hg38": [ - "6247607", - "463325" - ], - "webstr_hg19": [], - "locus_tags": [ - "length_affects_penetrance" - ], - "disease_tags": [], - "references": [ - "pmid:1676829", - "pmid:21245398", - "pmid:39998965", - "pmid:25593321", - "pmid:38467784", - "genereviews:NBK535148", - "pmid:25168903", - "omim:613267", - "pmid:20825314", - "pmid:16769829", - "pmid:39669694", - "pmid:23185296", - "pmid:40374208" - ], - "additional_literature": [ - "pmid:42180433", - "pmid:42010886", - "pmid:41944554", - "pmid:41944537", - "pmid:41865104", - "pmid:41736702", - "pmid:41713739", - "pmid:41562921", - "pmid:41533935", - "pmid:41501457", - "pmid:41373515", - "pmid:41344296", - "pmid:41298634", - "pmid:41074692", - "pmid:40961119", - "pmid:40852795", - "pmid:40767442", - "pmid:40720054", - "pmid:40585427", - "pmid:40268158", - "pmid:40081749", - "pmid:40048186", - "pmid:39651202", - "pmid:39332053", - "pmid:39288343", - "pmid:39278108", - "pmid:39231626", - "pmid:38713708", - "pmid:38704483", - "pmid:38300219", - "pmid:37747538", - "pmid:37204786", - "pmid:37169279", - "pmid:36883248", - "pmid:36773096", - "pmid:36701310", - "pmid:36275201", - "pmid:36250467", - "pmid:34946954", - "pmid:34946867", - "pmid:34855896", - "pmid:34698281", - "pmid:34644448", - "pmid:33782268", - "pmid:36246012", - "pmid:33116252", - "pmid:32934897", - "pmid:32639312", - "pmid:31554942", - "pmid:31469403", - "pmid:31276570", - "pmid:30973406", - "pmid:30811544", - "pmid:30733599", - "pmid:30267097", - "pmid:30122888", - "pmid:30098193", - "pmid:29966009", - "pmid:29799290", - "pmid:29526280", - "pmid:29325021", - "pmid:29196769", - "pmid:29044056", - "pmid:28886202", - "pmid:28832669", - "pmid:28608272", - "pmid:28118661", - "pmid:27755191", - "pmid:26401622", - "pmid:26218914", - "pmid:26200491", - "pmid:25722209", - "pmid:25298419", - "pmid:24255041", - "pmid:20960280", - "pmid:11526470", - "pmid:10712198", - "pmid:10395212" - ] - }, - { - "id": "SCA_THAP11", - "disease_id": "SCA51", - "gene": "THAP11", - "evidence": [ - "Strong" - ], - "chrom": "chr16", - "start_hg38": 67842862, - "stop_hg38": 67842950, - "start_hg19": 67876765, - "stop_hg19": 67876853, - "start_t2t": 73638636, - "stop_t2t": 73638724, - "disease": "Spinocerebellar ataxia 51", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "THAP11-caused SCA involves symptoms including gait ataxia, dysarthria, dysphagia, slow saccades, ptosis, and/or nystagmus [@pmid:37148549].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Has been observed in Chinese families [@pmid:37148549; @pmid:24677642]. Interruptions predisposing to expansion/disease appear to vary by ancestry [@pmid:39651830].", - "age_onset": "Typical: 8-40 (small sample size); Range: 4-51 [@pmid:37148549].", - "age_onset_min": 4, - "age_onset_max": 51, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Expansion (45-100 repeats) found in affected individuals from 2 families and not in 500 controls (benign range: 20-38 repeats) [@pmid:37148549]. Longer alleles were associated with earlier age of onset. For example, an individual with 100 repeats had age of onset at 4 years. CAA interruptions can reduce toxicity [@pmid:37148549; @pmid:37148549].", - "detection": null, - "mechanism": "GoF", - "mechanism_detail": "Polyglutamine expansion leading to gain of function toxicity [@pmid:37148549; @pmid:38467784].", - "year": "2023 [@pmid:37148549]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "CAG" - ], - "pathogenic_motif_reference_orientation": [ - "CAG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [ - "CAA" - ], - "pathogenic_motif_gene_orientation": [ - "AGC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [ - "AAC" - ], - "locus_structure": [], - "benign_min": 20, - "benign_max": 38, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 45, - "pathogenic_max": 100, - "motif_len": 3, - "ref_copies": 29.3, - "novel": "ref", - "gard": [ - "10748" - ], - "genereviews": [], - "malacard": [], - "medgen": [ - "431598" - ], - "mondo": [], - "omim": [ - "620947" - ], - "orphanet": [], - "gnomad": [ - "THAP11" - ], - "stripy": [], - "tr_atlas": [ - "TR142069" - ], - "webstr_hg38": [ - "814002", - "5973136" - ], - "webstr_hg19": [ - "STR_540982" - ], - "locus_tags": [ - "anticipation", - "length_affects_onset", - "length_affects_severity", - "motif_affects_onset", - "motif_affects_severity" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "pmid:37148549", - "pmid:38467784", - "pmid:24677642", - "pmid:39651830" - ], - "additional_literature": [ - "pmid:40886825", - "pmid:40488180", - "pmid:15368101" - ] - }, - { - "id": "FAME6_TNRC6A", - "disease_id": "FAME6", - "gene": "TNRC6A", - "evidence": [ - "Limited" - ], - "chrom": "chr16", - "start_hg38": 24613438, - "stop_hg38": 24613532, - "start_hg19": 24624759, - "stop_hg19": 24624853, - "start_t2t": 24890366, - "stop_t2t": 24890430, - "disease": "Familial adult myoclonic epilepsy type 6", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Limited clinical details from one family, 'early 20s to 70s'", - "age_onset_min": 23, - "age_onset_max": 74, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Novel, reported pathogenic alleles: (TTTTA)22 (TTTCA)exp (TTTTA)exp, but only the TTTCA is specific to affected individuals (size: 1100 repeats). Non-pathogenic reference TTTTA repeat was expanded in nine healthy subjects 40-120 repeats and in two individuals was potentially even longer [@pmid:29507423].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity hypothesized [@pmid:29507423; @pmid:38467784].", - "year": "2018 [@pmid:29507423]", - "location_in_gene": "Intron 1/23", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "TTTTA" - ], - "pathogenic_motif_reference_orientation": [ - "TTTCA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "TTTTT" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "TTTTT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "TTTTA", - "count": 10, - "type": "internal_repeat" - }, - { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 1100, - "pathogenic_max": 1100, - "motif_len": 3, - "ref_copies": 18.8, - "novel": "novel", - "gard": [ - "16758" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "EPL227" - ], - "medgen": [ - "1648448" - ], - "mondo": [ - "0054846" - ], - "omim": [ - "618074" - ], - "orphanet": [ - "86814" - ], - "gnomad": [ - "TNRC6A" - ], - "stripy": [ - "TNRC6A" - ], - "tr_atlas": [ - "TR139999" - ], - "webstr_hg38": [ - "5951520" - ], - "webstr_hg19": [ - "STR_519979" - ], - "locus_tags": [ - "motif_affects_penetrance" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:29507423", - "pmid:38467784", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:41219789", - "pmid:36092952", - "pmid:33040085", - "pmid:31483537", - "pmid:30351492", - "pmid:23042244" - ] - }, - { - "id": "CPUM_TYMS", - "disease_id": "CPUM", - "gene": "TYMS", - "evidence": [ - "Limited" - ], - "chrom": "chr18", - "start_hg38": 666891, - "stop_hg38": 667632, - "start_hg19": 666891, - "stop_hg19": 667632, - "start_t2t": 821235, - "stop_t2t": 821905, - "disease": "Congenital Progressive Universal Melanosis", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "CPUM is characterized by progressive widespread hyperpigmentation beginning at birth without accompanying symptoms. Studied children with CPUM have been born to unaffected parents. The children studied have been born with diffuse, universal, and progressive hyperpigmentation at 15 years of age. At this time the hyperpigmentation had fully progressed [@pmid:40589716]. It is not entirely clear that this is a distinct disease as it shares features with acquired universal melanosis (most similar), erythema dyschromicum perstans, lichen planus pigmentosus, and familial progressive hypigmentation.", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in two monozygotic twins in Thailand [@pmid:40589716].", - "age_onset": "0 (birth) [@pmid:40589716]", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "A study has identified an intronic GATGGT hexanucleotide tandem repeat in the TYMS gene. Both parents were found to be heterozygous carriers of the expansion, suggesting a recessive inheritance pattern. Evidence is limited, only a single family with monozygotic twins have been reported and no change in expression of the gene has been observed [@pmid:40589716].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Proposed mechanism involves repeat expansions in non-coding regions of the gene, reducing expression in melanocytes or keratinocytes, leading to a disruption in nucleotide balance in DNA repair and hyperpigmentation. Missense mutations disrupt nucleotide metabolism, resulting in loss-of-function and genome instability [@pmid:40589716].", - "year": "2025 [@pmid:40589716]", - "location_in_gene": "Intron 3", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GATGGT" - ], - "pathogenic_motif_reference_orientation": [ - "GATGGT" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ACCATC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 42, - "benign_max": 172, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 210, - "pathogenic_max": 259, - "motif_len": 6, - "ref_copies": null, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": [], - "medgen": [], - "mondo": [], - "omim": [], - "orphanet": [], - "gnomad": [], - "stripy": [], - "tr_atlas": [], - "webstr_hg38": [], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:40589716" - ], - "additional_literature": [ - "pmid:41507280", - "pmid:41181325", - "pmid:41074680", - "pmid:41024012", - "pmid:40890629", - "pmid:40589716", - "pmid:40195828", - "pmid:38625071", - "pmid:38411001", - "pmid:38379425", - "pmid:38311638", - "pmid:38280392", - "pmid:38134936", - "pmid:36398398", - "pmid:36209056", - "pmid:35608245", - "pmid:35233526", - "pmid:35055435", - "pmid:34650802", - "pmid:34526668", - "pmid:34197619", - "pmid:34149004", - "pmid:33805940", - "pmid:33086767", - "pmid:32813677", - "pmid:32695278", - "pmid:32612964", - "pmid:32110891", - "pmid:31817852", - "pmid:31370354", - "pmid:31161452", - "pmid:30838312", - "pmid:30823845", - "pmid:30533396", - "pmid:30464574", - "pmid:30122542", - "pmid:29995270", - "pmid:29660633", - "pmid:29394274", - "pmid:29321350", - "pmid:29162511", - "pmid:28895423", - "pmid:28349270", - "pmid:28280649", - "pmid:28074308", - "pmid:28074022", - "pmid:27995989", - "pmid:27868347", - "pmid:27864985", - "pmid:27685916", - "pmid:27375073", - "pmid:29767611", - "pmid:26745074", - "pmid:26621114", - "pmid:26277606", - "pmid:26196219", - "pmid:26189437", - "pmid:25955097", - "pmid:25648260", - "pmid:25536611", - "pmid:25366766", - "pmid:25341694", - "pmid:25294632", - "pmid:25279663", - "pmid:25258183", - "pmid:25246386", - "pmid:25028118", - "pmid:25007187", - "pmid:24726028", - "pmid:24686188", - "pmid:24641398", - "pmid:24596472", - "pmid:24554028", - "pmid:24422758", - "pmid:24415354", - "pmid:24302747", - "pmid:24137384", - "pmid:23968134", - "pmid:23571497", - "pmid:23481061", - "pmid:23232805", - "pmid:23226765", - "pmid:23148637", - "pmid:22799365", - "pmid:22763757", - "pmid:22576918", - "pmid:22086855", - "pmid:22044939", - "pmid:21630057", - "pmid:21449681", - "pmid:21269855", - "pmid:21196216", - "pmid:21075014", - "pmid:20966539", - "pmid:20962453", - "pmid:20932673", - "pmid:20880668", - "pmid:20824655", - "pmid:20651387", - "pmid:20645403", - "pmid:20570968", - "pmid:20531375", - "pmid:20372856", - "pmid:20005374", - "pmid:19998340", - "pmid:19917450", - "pmid:19798689", - "pmid:19632929", - "pmid:19349389", - "pmid:19306093", - "pmid:19200948", - "pmid:19082493", - "pmid:18843018", - "pmid:18728661", - "pmid:18704422", - "pmid:18661526", - "pmid:18406541", - "pmid:18273818", - "pmid:18267032", - "pmid:18203297", - "pmid:18095031", - "pmid:17508355", - "pmid:17396161", - "pmid:17278107", - "pmid:17273745", - "pmid:17220568", - "pmid:17201138", - "pmid:17187508", - "pmid:17047490", - "pmid:17018589", - "pmid:16929515", - "pmid:16818689", - "pmid:16596248", - "pmid:16456808", - "pmid:16334126", - "pmid:16333305", - "pmid:16234002", - "pmid:16182121", - "pmid:15897576", - "pmid:15817609", - "pmid:15749593", - "pmid:15646842", - "pmid:15579479", - "pmid:15571262", - "pmid:15510613", - "pmid:15457444", - "pmid:15386371", - "pmid:15284183", - "pmid:15115918", - "pmid:14522928", - "pmid:12684695", - "pmid:12604405", - "pmid:12460463", - "pmid:12232785", - "pmid:12215845", - "pmid:12039668", - "pmid:11913730", - "pmid:11867566", - "pmid:11751507", - "pmid:11529907", - "pmid:11445856", - "pmid:10652619", - "pmid:10636923", - "pmid:10625460", - "pmid:8751943", - "pmid:3002689" - ] - }, - { - "id": "HMNR7_VWA1", - "disease_id": "HMNR7", - "gene": "VWA1", - "evidence": [ - "Definitive" - ], - "chrom": "chr1", - "start_hg38": 1435798, - "stop_hg38": 1435818, - "start_hg19": 1371178, - "stop_hg19": 1371198, - "start_t2t": 870158, - "stop_t2t": 870178, - "disease": "Neuronopathy, distal hereditary motor, autosomal recessive 7", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Autosomal recessive distal hereditary motor neuronopathy-7 (HMNR7) is characterized by onset of lower leg weakness in the first decade. Affected individuals have difficulty climbing stairs and problems standing on their heels... Most patients have foot deformities, and some may have leg muscle atrophy. The disorder is slowly progressive and often involves the upper limbs [@omim:619216].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Biallelic variants found in 0.01% of 100 KGP participants; enriched in those with motor disease. 80% of VWA1 pathogenic variants are expansions/contractions [@genereviews:NBK535148]. The repeat expansion was found in several ethnicities; founder mutation 7,000 years prior [@pmid:33559681].", - "age_onset": "Typical: 1-3 [@pmid:33559681]; Range: 0-10 [@omim:619216].", - "age_onset_min": 0, - "age_onset_max": 10, - "typ_age_onset_min": 1, - "typ_age_onset_max": 3, - "details": "Any deviation from 2 motifs is thought to be pathogenic [@genereviews:NBK535148].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Loss of function [@pmid:38467784].", - "year": "2021 [@pmid:33559681]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GGCGCGGAGC" - ], - "pathogenic_motif_reference_orientation": [ - "GGCGCGGAGC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "AGCGGCGCGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 2, - "benign_max": 2, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 1, - "pathogenic_max": 3, - "motif_len": 10, - "ref_copies": null, - "novel": null, - "gard": [ - "18444" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "NRN074" - ], - "medgen": [ - "1786836" - ], - "mondo": [ - "0030977" - ], - "omim": [ - "619216" - ], - "orphanet": [ - "314485" - ], - "gnomad": [ - "VWA1" - ], - "stripy": [], - "tr_atlas": [ - "TR32" - ], - "webstr_hg38": [ - "1099767" - ], - "webstr_hg19": [], - "locus_tags": [ - "contraction" - ], - "disease_tags": [], - "references": [ - "pmid:33559681", - "omim:619216", - "pmid:38467784", - "genereviews:NBK535148" - ], - "additional_literature": [ - "pmid:42003611" - ] - }, - { - "id": "DBQD2_XYLT1", - "disease_id": "DBQD2, BSS", - "gene": "XYLT1", - "evidence": [ - "Moderate" - ], - "chrom": "chr16", - "start_hg38": 17470907, - "stop_hg38": 17470922, - "start_hg19": 17564764, - "stop_hg19": 17564779, - "start_t2t": 17477909, - "stop_t2t": 17478002, - "disease": "Baratela-Scott Syndrome/Desbuquois dysplasia 2", - "inheritance": [ - "AR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Desbuquois dysplasia, which belongs to the multiple dislocation group of disorders, is characterized by dislocations of large joints, severe pre- and postnatal growth retardation, joint laxity, and flat face with prominent eyes. Radiologic features include short long bones with an exaggerated trochanter that gives a 'monkey wrench' appearance to the proximal femur, and advanced carpal and tarsal ossification [@pmid:24581741].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "<1/1,000,000 births [@orphanet:1425]; repeat expansions comprise half of DBQD variants [@genereviews:NBK535148]. <50 DBQD cases. Has been found in Belgian, Emirati families", - "age_onset": "0 (birth)", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": 0, - "typ_age_onset_max": 0, - "details": "Benign range (0-20) taken from primary literature of unaffected individuals and gnomAD data [@pmid:30554721; @gnomad:XYLT1]. Minimum repeat size to cause disease thought to range between 72 and 110 repeats [@pmid:30554721]. Repeat is within a 238bp sequence which is missing from hg38 but present in T2T-CHM13", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Methylation [@pmid:30554721].", - "year": "2019 [@pmid:30554721]", - "location_in_gene": "5' promoter region. Note, it can also be annotated coding or introntic depending on the reference, due to missing sequences in some reference genomes.", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "GCC", - "count": 0, - "type": "internal_repeat" - }, - { - "motif": "TCGGCTCGCCGCTGCTCCTCCTCC", - "count": 0, - "type": "interruption" - }, - { - "motif": "GCC", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": 0, - "benign_max": 20, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 72, - "pathogenic_max": 110, - "motif_len": 3, - "ref_copies": 0, - "novel": "ref", - "gard": [ - "16466" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "DSB005" - ], - "medgen": [ - "862731" - ], - "mondo": [ - "0014343" - ], - "omim": [ - "615777" - ], - "orphanet": [ - "1425" - ], - "gnomad": [ - "XYLT1" - ], - "stripy": [ - "XYLT1" - ], - "tr_atlas": [ - "TR139509" - ], - "webstr_hg38": [ - "793606" - ], - "webstr_hg19": [], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:30554721", - "gnomad:XYLT1", - "orphanet:1425", - "genereviews:NBK535148", - "pmid:24581741" - ], - "additional_literature": [] - }, - { - "id": "FAME4_YEATS2", - "disease_id": "FAME4", - "gene": "YEATS2", - "evidence": [ - "Limited" - ], - "chrom": "chr3", - "start_hg38": 183712187, - "stop_hg38": 183712226, - "start_hg19": 183429975, - "stop_hg19": 183430014, - "start_t2t": 186521667, - "stop_t2t": 186521706, - "disease": "Familial adult myoclonic epilepsy 4", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", - "age_onset": "Typical: 20-25 [@pmid:22713812]; Range: 10-33 [@pmid:31539032].", - "age_onset_min": 10, - "age_onset_max": 33, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Novel insertion of ~1000 repeats observed to cause disease [@pmid:31539032].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "RNA toxicity hypothesized [@pmid:31539032].", - "year": "2019 [@pmid:31539032]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "TTTTA" - ], - "pathogenic_motif_reference_orientation": [ - "TTTCA" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [ - "TTTTT", - "TGTTA" - ], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "ATTTC" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [ - "TTTTT", - "ATGTT" - ], - "interruption_gene_orientation": [], - "locus_structure": [ - { - "motif": "TTTTA", - "count": 7, - "type": "internal_repeat" - }, - { - "motif": "TTTCA", - "count": null, - "type": "pathogenic_repeat" - } - ], - "benign_min": null, - "benign_max": null, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 1000, - "pathogenic_max": 1000, - "motif_len": 5, - "ref_copies": 7.8, - "novel": "novel", - "gard": [ - "16758" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "EPL107" - ], - "medgen": [ - "767474" - ], - "mondo": [ - "0014055" - ], - "omim": [ - "615127" - ], - "orphanet": [ - "86814" - ], - "gnomad": [ - "YEATS2" - ], - "stripy": [ - "YEATS2" - ], - "tr_atlas": [ - "TR38932" - ], - "webstr_hg38": [ - "5034940", - "769177" - ], - "webstr_hg19": [ - "STR_1006941" - ], - "locus_tags": [ - "motif_affects_penetrance" - ], - "disease_tags": [ - "familial_adult_myoclonic_epilepsy" - ], - "references": [ - "pmid:22713812", - "pmid:31539032", - "pmid:38876750" - ], - "additional_literature": [ - "pmid:41874439", - "pmid:41219789", - "pmid:38128822" - ] - }, - { - "id": "SCA4_ZFHX3", - "disease_id": "SCA4", - "gene": "ZFHX3", - "evidence": [ - "Definitive" - ], - "chrom": "chr16", - "start_hg38": 72787694, - "stop_hg38": 72787758, - "start_hg19": 72821593, - "stop_hg19": 72821657, - "start_t2t": 78605502, - "stop_t2t": 78605569, - "disease": "Spinocerebellar ataxia 4", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Spinocerebellar ataxia type 4 (SCA4) is a very rare progressive subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by ataxia with sensory neuropathy (adapted from Mondo) [@mondo:0010847].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Observed in Swedish individuals: 2 original kindreds and 3 additional families [@omim:600223]; common ancestral allele has been identified [@pmid:39635987].", - "age_onset": "Typical: 37- 56; Range: 12 - 65 [@pmid:39666847; @pmid:38973251].", - "age_onset_min": 12, - "age_onset_max": 65, - "typ_age_onset_min": 37, - "typ_age_onset_max": 56, - "details": "Disease-causing expansions range from 46 repeats [@pmid:38973251] to 74 repeats [@pmid:38035881]. Possible anticipation in disease [@pmid:38197134; @pmid:38035881]; intermediate alleles may correspond to premutations [@pmid:38973251]. Most unaffected individuals had 21 motifs, but benign alleles range from 14-26 repeats [@pmid:38035881].", - "detection": null, - "mechanism": "GoF?", - "mechanism_detail": "Potential RNA-mediated gain of function mechanism theorized [@pmid:38467784]", - "year": "2023 [@pmid:38035881]", - "location_in_gene": "Coding, Last Exon (exon number is transcript dependent)", - "gene_strand": "-", - "reference_motif_reference_orientation": [ - "GCC" - ], - "pathogenic_motif_reference_orientation": [ - "GCC" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 14, - "benign_max": 26, - "intermediate_min": 27, - "intermediate_max": 45, - "pathogenic_min": 46, - "pathogenic_max": 74, - "motif_len": 3, - "ref_copies": 21.3, - "novel": "ref", - "gard": [ - "9970" - ], - "genereviews": [], - "malacard": [ - "SPN105" - ], - "medgen": [ - "199815" - ], - "mondo": [ - "0010847" - ], - "omim": [ - "600223" - ], - "orphanet": [ - "98765" - ], - "gnomad": [ - "ZFHX3" - ], - "stripy": [], - "tr_atlas": [ - "TR142346" - ], - "webstr_hg38": [ - "5977326" - ], - "webstr_hg19": [ - "STR_545217" - ], - "locus_tags": [ - "length_affects_onset" - ], - "disease_tags": [ - "spinocerebellar_ataxia" - ], - "references": [ - "pmid:39666847", - "pmid:38973251", - "pmid:38467784", - "pmid:38035881", - "pmid:38197134", - "omim:600223", - "pmid:39635987", - "mondo:0010847" - ], - "additional_literature": [ - "pmid:40898875", - "pmid:40594369", - "pmid:40488180", - "pmid:40459184", - "pmid:40166539", - "pmid:39095619", - "pmid:38684900", - "pmid:38472396", - "pmid:38145611", - "pmid:20586826", - "pmid:10855793" - ] - }, - { - "id": "HPE5_ZIC2", - "disease_id": "HPE5", - "gene": "ZIC2", - "evidence": [ - "Definitive" - ], - "chrom": "chr13", - "start_hg38": 99985448, - "stop_hg38": 99985494, - "start_hg19": 100637702, - "stop_hg19": 100637748, - "start_t2t": 99196358, - "stop_t2t": 99196404, - "disease": "Holoprosencephaly-5", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "Holoprosencephaly associated with mutations in the ZIC2 gene [@mondo:0012322].", - "hpo_terms": null, - "prevalence": "1.4/1000000", - "prevalence_details": "0.05-0.23/100,000; math done by 40% of pathogenic variants in ZIC2 are expansion [@genereviews:NBK1530]; 5% of non-syndromic HPE are ZIC2 gene [@genereviews:NBK1530], and nonsyndromic HPE is 25-50% of HPE, which affects 1/10,000 newborns [@url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/] - ZIC2 is 9.2% of HPE cases, which occur in 1/16,000 live births [@pmid:17274816]. Holoprosencephaly has worldwide distribution [@orphanet:2162], but STR-specific distribution is unknown.", - "age_onset": "0", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": 0, - "typ_age_onset_max": 0, - "details": "The benign allele of 15 repeats expands to 25 repeats to cause disease [@genereviews:NBK51932], although the expansion can potentially present with a mild phenotype [@doi:10.1016/j.gimo.2024.101607]", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Polyalanine expansion interfering with DNA binding and transcriptional activation [@pmid:19177455; @pmid:15590697].", - "year": "2001 [@pmid:11285244]", - "location_in_gene": "Coding Exon 3", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 15, - "benign_max": 15, - "intermediate_min": null, - "intermediate_max": null, - "pathogenic_min": 25, - "pathogenic_max": 25, - "motif_len": 3, - "ref_copies": 15.3, - "novel": "ref", - "gard": [ - "6665" - ], - "genereviews": [ - "NBK51932" - ], - "malacard": [ - "HLP028" - ], - "medgen": [ - "355304" - ], - "mondo": [ - "0012322" - ], - "omim": [ - "609637" - ], - "orphanet": [ - "2162" - ], - "gnomad": [ - "ZIC2" - ], - "stripy": [ - "ZIC2" - ], - "tr_atlas": [ - "TR127312" - ], - "webstr_hg38": [ - "5374719" - ], - "webstr_hg19": [ - "STR_395661" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:19177455", - "pmid:15590697", - "genereviews:NBK51932", - "doi:10.1016/j.gimo.2024.101607", - "genereviews:NBK1530", - "url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/", - "pmid:17274816", - "orphanet:2162", - "pmid:11285244", - "mondo:0012322" - ], - "additional_literature": [ - "pmid:40033291" - ] - }, + "motif": "GCC", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": 0, + "benign_max": 20, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 72, + "pathogenic_max": 110, + "motif_len": 3, + "ref_copies": 0.0, + "novel": "ref", + "gard": ["16466"], + "genereviews": ["NBK535148"], + "malacard": ["DSB005"], + "medgen": ["862731"], + "mondo": ["0014343"], + "omim": ["615777"], + "orphanet": ["1425"], + "gnomad": ["XYLT1"], + "stripy": ["XYLT1"], + "tr_atlas": ["TR139509"], + "webstr_hg38": ["793606"], + "webstr_hg19": [], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:30554721", "gnomad:XYLT1", "orphanet:1425", "genereviews:NBK535148", "pmid:24581741"], + "additional_literature": [] +}, +{ + "id": "FAME4_YEATS2", + "disease_id": "FAME4", + "gene": "YEATS2", + "evidence": ["Limited"], + "chrom": "chr3", + "start_hg38": 183712187, + "stop_hg38": 183712226, + "start_hg19": 183429975, + "stop_hg19": 183430014, + "start_t2t": 186521667, + "stop_t2t": 186521706, + "disease": "Familial adult myoclonic epilepsy 4", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Cortical tremor, seizures with generalised motor (tonic-clonic) onset [@pmid:38876750].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "FAME overall is 1/35,000 in Japan. This repeat expansion is typically found in individuals of East Asian ancestry [@pmid:38876750].", + "age_onset": "Typical: 20-25 [@pmid:22713812]; Range: 10-33 [@pmid:31539032].", + "age_onset_min": 10.0, + "age_onset_max": 33.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Novel insertion of ~1000 repeats observed to cause disease [@pmid:31539032].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "RNA toxicity hypothesized [@pmid:31539032].", + "year": "2019 [@pmid:31539032]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["TTTTA"], + "pathogenic_motif_reference_orientation": ["TTTCA"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": ["TTTTT", "TGTTA"], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["ATTTC"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": ["TTTTT", "ATGTT"], + "interruption_gene_orientation": [], + "locus_structure": [ { - "id": "VACTERLX_ZIC3", - "disease_id": "VACTERLX", - "gene": "ZIC3", - "evidence": [ - "Limited" - ], - "chrom": "chrX", - "start_hg38": 137566826, - "stop_hg38": 137566856, - "start_hg19": 136648985, - "stop_hg19": 136649015, - "start_t2t": 135876774, - "stop_t2t": 135876804, - "disease": "X-linked VACTERL syndrome", - "inheritance": [ - "XR" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "VACTERL is an acronym for vertebral anomalies (similar to those of spondylocostal dysplasia), anal atresia, cardiac malformations, tracheoesophageal fistula, renal anomalies (urethral atresia with hydronephrosis), and limb anomalies [@omim:314390].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "Found in one patient [@genereviews:NBK535148] with European ancestry [@pmid:20452998].", - "age_onset": "0", - "age_onset_min": 0, - "age_onset_max": 0, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "Frequently genotyped as (NGC)*, although locus structure has been reported as (GCC)8(GCT)(GCC) [@pmid:38467784]. 1 patient with VACTERL died at birth with 12 repeats [@pmid:20452998]. 8 patients with X-linked oculo-auriculo-vertebral spectrum (OAVS) had 11 repeats (intermediate allele size); 1 individual in OAVS cohort with 12 repeats; likely phenotypic spectrum [@pmid:32639022].", - "detection": null, - "mechanism": "Unknown", - "mechanism_detail": "Polyalanine expansion with unknown mechanism [@pmid:17581576].", - "year": "2010 [@pmid:20452998]", - "location_in_gene": "Coding Exon 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCN" - ], - "pathogenic_motif_reference_orientation": [ - "GCN" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CNG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 10, - "benign_max": 10, - "intermediate_min": 11, - "intermediate_max": 11, - "pathogenic_min": 12, - "pathogenic_max": 12, - "motif_len": 3, - "ref_copies": 9, - "novel": "ref", - "gard": [ - "15309" - ], - "genereviews": [ - "NBK535148" - ], - "malacard": [ - "VCT005" - ], - "medgen": [ - "419019" - ], - "mondo": [ - "0010752" - ], - "omim": [ - "314390" - ], - "orphanet": [], - "gnomad": [ - "ZIC3" - ], - "stripy": [ - "ZIC3" - ], - "tr_atlas": [ - "TR173313" - ], - "webstr_hg38": [ - "883856" - ], - "webstr_hg19": [ - "STR_1596381" - ], - "locus_tags": [], - "disease_tags": [ - "phenotypic_spectrum" - ], - "references": [ - "pmid:17581576", - "pmid:38467784", - "pmid:20452998", - "pmid:32639022", - "genereviews:NBK535148", - "omim:314390" - ], - "additional_literature": [ - "pmid:40585427" - ] + "motif": "TTTTA", + "count": 7, + "type": "internal_repeat" }, { - "id": "FRA7A_ZNF713", - "disease_id": "FRA7A", - "gene": "ZNF713", - "evidence": [ - "Limited" - ], - "chrom": "chr7", - "start_hg38": 55887600, - "stop_hg38": 55887639, - "start_hg19": 55955293, - "stop_hg19": 55955332, - "start_t2t": 56047900, - "stop_t2t": 56047939, - "disease": "Autism spectrum disorder associated with fragile site FRA7A", - "inheritance": [ - "AD" - ], - "association_type": [ - "Mendelian" - ], - "disease_description": "A spectrum of developmental disorders that includes autism, and Asperger syndrome. Signs and symptoms include poor communication skills, defective social interactions, and repetitive behaviors [@mondo:0005258].", - "hpo_terms": null, - "prevalence": null, - "prevalence_details": "1 proband reported alongside 3 individuals with premutations, found in 2 families without discussion of ancestry/ethnicity [@pmid:25196122].", - "age_onset": "2-3 (four individuals) [@pmid:25196122].", - "age_onset_min": 2, - "age_onset_max": 3, - "typ_age_onset_min": null, - "typ_age_onset_max": null, - "details": "176 controls were used to establish the benign range (5-22 repeats), whereas a singular proband was identified with ~450 repeats [@pmid:25196122]. The observed intermediate alleles were presumed to function as premutations, with variable amounts of methylation [@pmid:25196122].", - "detection": null, - "mechanism": "LoF", - "mechanism_detail": "Methylation, evidence of transcriptional misregulation [@omim:616181; @pmid:25196122].", - "year": "2014 [@pmid:25196122]", - "location_in_gene": "Intron 1", - "gene_strand": "+", - "reference_motif_reference_orientation": [ - "GCG" - ], - "pathogenic_motif_reference_orientation": [ - "GCG" - ], - "benign_motif_reference_orientation": [], - "unknown_motif_reference_orientation": [], - "interruption_reference_orientation": [], - "pathogenic_motif_gene_orientation": [ - "CGG" - ], - "benign_motif_gene_orientation": [], - "unknown_motif_gene_orientation": [], - "interruption_gene_orientation": [], - "locus_structure": [], - "benign_min": 5, - "benign_max": 22, - "intermediate_min": 42, - "intermediate_max": 85, - "pathogenic_min": 450, - "pathogenic_max": 450, - "motif_len": 3, - "ref_copies": 13, - "novel": "ref", - "gard": [], - "genereviews": [], - "malacard": [ - "ATS007" - ], - "medgen": [], - "mondo": [], - "omim": [ - "616181" - ], - "orphanet": [], - "gnomad": [ - "ZNF713" - ], - "stripy": [], - "tr_atlas": [ - "TR300995" - ], - "webstr_hg38": [ - "1380240", - "5696269" - ], - "webstr_hg19": [ - "STR_1325788" - ], - "locus_tags": [], - "disease_tags": [], - "references": [ - "pmid:25196122", - "omim:616181", - "mondo:0005258" - ], - "additional_literature": [] - } -] \ No newline at end of file + "motif": "TTTCA", + "count": null, + "type": "pathogenic_repeat" + }], + "benign_min": null, + "benign_max": null, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 1000, + "pathogenic_max": 1000, + "motif_len": 5, + "ref_copies": 7.8, + "novel": "novel", + "gard": ["16758"], + "genereviews": ["NBK535148"], + "malacard": ["EPL107"], + "medgen": ["767474"], + "mondo": ["0014055"], + "omim": ["615127"], + "orphanet": ["86814"], + "gnomad": ["YEATS2"], + "stripy": ["YEATS2"], + "tr_atlas": ["TR38932"], + "webstr_hg38": ["5034940", "769177"], + "webstr_hg19": ["STR_1006941"], + "locus_tags": ["motif_affects_penetrance"], + "disease_tags": ["familial_adult_myoclonic_epilepsy"], + "references": ["pmid:22713812", "pmid:31539032", "pmid:38876750"], + "additional_literature": ["pmid:41874439", "pmid:41219789", "pmid:38128822"] +}, +{ + "id": "SCA4_ZFHX3", + "disease_id": "SCA4", + "gene": "ZFHX3", + "evidence": ["Definitive"], + "chrom": "chr16", + "start_hg38": 72787694, + "stop_hg38": 72787758, + "start_hg19": 72821593, + "stop_hg19": 72821657, + "start_t2t": 78605502, + "stop_t2t": 78605569, + "disease": "Spinocerebellar ataxia 4", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Spinocerebellar ataxia type 4 (SCA4) is a very rare progressive subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by ataxia with sensory neuropathy (adapted from Mondo) [@mondo:0010847].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Observed in Swedish individuals: 2 original kindreds and 3 additional families [@omim:600223]; common ancestral allele has been identified [@pmid:39635987].", + "age_onset": "Typical: 37- 56; Range: 12 - 65 [@pmid:39666847; @pmid:38973251].", + "age_onset_min": 12.0, + "age_onset_max": 65.0, + "typ_age_onset_min": 37.0, + "typ_age_onset_max": 56.0, + "details": "Disease-causing expansions range from 46 repeats [@pmid:38973251] to 74 repeats [@pmid:38035881]. Possible anticipation in disease [@pmid:38197134; @pmid:38035881]; intermediate alleles may correspond to premutations [@pmid:38973251]. Most unaffected individuals had 21 motifs, but benign alleles range from 14-26 repeats [@pmid:38035881].", + "detection": null, + "mechanism": "GoF?", + "mechanism_detail": "Potential RNA-mediated gain of function mechanism theorized [@pmid:38467784]", + "year": "2023 [@pmid:38035881]", + "location_in_gene": "Coding, Last Exon (exon number is transcript dependent)", + "gene_strand": "-", + "reference_motif_reference_orientation": ["GCC"], + "pathogenic_motif_reference_orientation": ["GCC"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 14, + "benign_max": 26, + "intermediate_min": 27, + "intermediate_max": 45, + "pathogenic_min": 46, + "pathogenic_max": 74, + "motif_len": 3, + "ref_copies": 21.3, + "novel": "ref", + "gard": ["9970"], + "genereviews": [], + "malacard": ["SPN105"], + "medgen": ["199815"], + "mondo": ["0010847"], + "omim": ["600223"], + "orphanet": ["98765"], + "gnomad": ["ZFHX3"], + "stripy": [], + "tr_atlas": ["TR142346"], + "webstr_hg38": ["5977326"], + "webstr_hg19": ["STR_545217"], + "locus_tags": ["length_affects_onset"], + "disease_tags": ["spinocerebellar_ataxia"], + "references": ["pmid:39666847", "pmid:38973251", "pmid:38467784", "pmid:38035881", "pmid:38197134", "omim:600223", "pmid:39635987", "mondo:0010847"], + "additional_literature": ["pmid:40898875", "pmid:40594369", "pmid:40488180", "pmid:40459184", "pmid:40166539", "pmid:39095619", "pmid:38684900", "pmid:38472396", "pmid:38145611", "pmid:20586826", "pmid:10855793"] +}, +{ + "id": "HPE5_ZIC2", + "disease_id": "HPE5", + "gene": "ZIC2", + "evidence": ["Definitive"], + "chrom": "chr13", + "start_hg38": 99985448, + "stop_hg38": 99985494, + "start_hg19": 100637702, + "stop_hg19": 100637748, + "start_t2t": 99196358, + "stop_t2t": 99196404, + "disease": "Holoprosencephaly-5", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "Holoprosencephaly associated with mutations in the ZIC2 gene [@mondo:0012322].", + "hpo_terms": null, + "prevalence": "1.4/1000000", + "prevalence_details": "0.05-0.23/100,000; math done by 40% of pathogenic variants in ZIC2 are expansion [@genereviews:NBK1530]; 5% of non-syndromic HPE are ZIC2 gene [@genereviews:NBK1530], and nonsyndromic HPE is 25-50% of HPE, which affects 1/10,000 newborns [@url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/] - ZIC2 is 9.2% of HPE cases, which occur in 1/16,000 live births [@pmid:17274816]. Holoprosencephaly has worldwide distribution [@orphanet:2162], but STR-specific distribution is unknown.", + "age_onset": "0", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": 0.0, + "typ_age_onset_max": 0.0, + "details": "The benign allele of 15 repeats expands to 25 repeats to cause disease [@genereviews:NBK51932], although the expansion can potentially present with a mild phenotype [@doi:10.1016/j.gimo.2024.101607]", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Polyalanine expansion interfering with DNA binding and transcriptional activation [@pmid:19177455; @pmid:15590697].", + "year": "2001 [@pmid:11285244]", + "location_in_gene": "Coding Exon 3", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 15, + "benign_max": 15, + "intermediate_min": null, + "intermediate_max": null, + "pathogenic_min": 25, + "pathogenic_max": 25, + "motif_len": 3, + "ref_copies": 15.3, + "novel": "ref", + "gard": ["6665"], + "genereviews": ["NBK51932"], + "malacard": ["HLP028"], + "medgen": ["355304"], + "mondo": ["0012322"], + "omim": ["609637"], + "orphanet": ["2162"], + "gnomad": ["ZIC2"], + "stripy": ["ZIC2"], + "tr_atlas": ["TR127312"], + "webstr_hg38": ["5374719"], + "webstr_hg19": ["STR_395661"], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:19177455", "pmid:15590697", "genereviews:NBK51932", "doi:10.1016/j.gimo.2024.101607", "genereviews:NBK1530", "url:medlineplus.gov/genetics/condition/nonsyndromic-holoprosencephaly/", "pmid:17274816", "orphanet:2162", "pmid:11285244", "mondo:0012322"], + "additional_literature": ["pmid:40033291"] +}, +{ + "id": "VACTERLX_ZIC3", + "disease_id": "VACTERLX", + "gene": "ZIC3", + "evidence": ["Limited"], + "chrom": "chrX", + "start_hg38": 137566826, + "stop_hg38": 137566856, + "start_hg19": 136648985, + "stop_hg19": 136649015, + "start_t2t": 135876774, + "stop_t2t": 135876804, + "disease": "X-linked VACTERL syndrome", + "inheritance": ["XR"], + "association_type": ["Mendelian"], + "disease_description": "VACTERL is an acronym for vertebral anomalies (similar to those of spondylocostal dysplasia), anal atresia, cardiac malformations, tracheoesophageal fistula, renal anomalies (urethral atresia with hydronephrosis), and limb anomalies [@omim:314390].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "Found in one patient [@genereviews:NBK535148] with European ancestry [@pmid:20452998].", + "age_onset": "0", + "age_onset_min": 0.0, + "age_onset_max": 0.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "Frequently genotyped as (NGC)*, although locus structure has been reported as (GCC)8(GCT)(GCC) [@pmid:38467784]. 1 patient with VACTERL died at birth with 12 repeats [@pmid:20452998]. 8 patients with X-linked oculo-auriculo-vertebral spectrum (OAVS) had 11 repeats (intermediate allele size); 1 individual in OAVS cohort with 12 repeats; likely phenotypic spectrum [@pmid:32639022].", + "detection": null, + "mechanism": "Unknown", + "mechanism_detail": "Polyalanine expansion with unknown mechanism [@pmid:17581576].", + "year": "2010 [@pmid:20452998]", + "location_in_gene": "Coding Exon 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCN"], + "pathogenic_motif_reference_orientation": ["GCN"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CNG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 10, + "benign_max": 10, + "intermediate_min": 11, + "intermediate_max": 11, + "pathogenic_min": 12, + "pathogenic_max": 12, + "motif_len": 3, + "ref_copies": 9.0, + "novel": "ref", + "gard": ["15309"], + "genereviews": ["NBK535148"], + "malacard": ["VCT005"], + "medgen": ["419019"], + "mondo": ["0010752"], + "omim": ["314390"], + "orphanet": [], + "gnomad": ["ZIC3"], + "stripy": ["ZIC3"], + "tr_atlas": ["TR173313"], + "webstr_hg38": ["883856"], + "webstr_hg19": ["STR_1596381"], + "locus_tags": [], + "disease_tags": ["phenotypic_spectrum"], + "references": ["pmid:17581576", "pmid:38467784", "pmid:20452998", "pmid:32639022", "genereviews:NBK535148", "omim:314390"], + "additional_literature": ["pmid:40585427"] +}, +{ + "id": "FRA7A_ZNF713", + "disease_id": "FRA7A", + "gene": "ZNF713", + "evidence": ["Limited"], + "chrom": "chr7", + "start_hg38": 55887600, + "stop_hg38": 55887639, + "start_hg19": 55955293, + "stop_hg19": 55955332, + "start_t2t": 56047900, + "stop_t2t": 56047939, + "disease": "Autism spectrum disorder associated with fragile site FRA7A", + "inheritance": ["AD"], + "association_type": ["Mendelian"], + "disease_description": "A spectrum of developmental disorders that includes autism, and Asperger syndrome. Signs and symptoms include poor communication skills, defective social interactions, and repetitive behaviors [@mondo:0005258].", + "hpo_terms": null, + "prevalence": null, + "prevalence_details": "1 proband reported alongside 3 individuals with premutations, found in 2 families without discussion of ancestry/ethnicity [@pmid:25196122].", + "age_onset": "2-3 (four individuals) [@pmid:25196122].", + "age_onset_min": 2.0, + "age_onset_max": 3.0, + "typ_age_onset_min": null, + "typ_age_onset_max": null, + "details": "176 controls were used to establish the benign range (5-22 repeats), whereas a singular proband was identified with ~450 repeats [@pmid:25196122]. The observed intermediate alleles were presumed to function as premutations, with variable amounts of methylation [@pmid:25196122].", + "detection": null, + "mechanism": "LoF", + "mechanism_detail": "Methylation, evidence of transcriptional misregulation [@omim:616181; @pmid:25196122].", + "year": "2014 [@pmid:25196122]", + "location_in_gene": "Intron 1", + "gene_strand": "+", + "reference_motif_reference_orientation": ["GCG"], + "pathogenic_motif_reference_orientation": ["GCG"], + "benign_motif_reference_orientation": [], + "unknown_motif_reference_orientation": [], + "interruption_reference_orientation": [], + "pathogenic_motif_gene_orientation": ["CGG"], + "benign_motif_gene_orientation": [], + "unknown_motif_gene_orientation": [], + "interruption_gene_orientation": [], + "locus_structure": [], + "benign_min": 5, + "benign_max": 22, + "intermediate_min": 42, + "intermediate_max": 85, + "pathogenic_min": 450, + "pathogenic_max": 450, + "motif_len": 3, + "ref_copies": 13.0, + "novel": "ref", + "gard": [], + "genereviews": [], + "malacard": ["ATS007"], + "medgen": [], + "mondo": [], + "omim": ["616181"], + "orphanet": [], + "gnomad": ["ZNF713"], + "stripy": [], + "tr_atlas": ["TR300995"], + "webstr_hg38": ["1380240", "5696269"], + "webstr_hg19": ["STR_1325788"], + "locus_tags": [], + "disease_tags": [], + "references": ["pmid:25196122", "omim:616181", "mondo:0005258"], + "additional_literature": [] +}] diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed index 03c1911e..c69dd9d0 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed @@ -68,7 +68,7 @@ chr20 2683189 2683230 SCA36_NOP56 NOP56 GGCCTG GGCCTG 650 AD Spinocerebellar ata chr20 4738633 4738705 CJD_PRNP PRNP GGTGGTGGCTGGGGGCAGCCTCAT CCTCATGGTGGTGGCTGGGGGCAG 5 AD Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome chr21 42132054 42132091 EPM1_CSTB CSTB CGCGGGGCGGGG CGCGGGGCGGGG 30 AR Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD) chr22 20143615 20143660 TOF_TBX1 TBX1 GCN GCN 25 AD Tetralogy of Fallot -chr22 38781587 38781680 EPM_CSNK1E CSNK1E CCG CCG 745 AR Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy +chr22 38781587 38781680 EPM_CSNK1E CSNK1E CCG CCG 366 AD Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy chr22 46280059 46280134 SCA10_ATXN10 ATXN10 ATTCT ATTCT 800 AD Spinocerebellar ataxia type 10 chrX 24597766 24597802 PRTS_ARX ARX NGC NGC 20 XR Partington syndrome chrX 24597886 24597934 EIEE1_ARX ARX NGC NGC 17 XR Early-infantile epileptic encephalopathy diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json index cd667006..56f8d7cd 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json @@ -916,11 +916,11 @@ "VariantId": ["EPM_CSNK1E"], "PathologicRegion": "chr22:38781587-38781680", "HGNCId": null, - "InheritanceMode": ["AR"], + "InheritanceMode": ["AD"], "DisplayRU": "CCG", "Disease": "EPM, DEE", "NormalMax": 48, - "PathologicMin": 745, + "PathologicMin": 366, "Gene": "CSNK1E" }, { diff --git a/data/catalogs/STRchive-disease-loci.hg19.general.bed b/data/catalogs/STRchive-disease-loci.hg19.general.bed index 97bbd950..5e0ff2ce 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.general.bed @@ -68,7 +68,7 @@ chr20 2633378 2633403 SCA36_NOP56 NOP56 GGCCTG GGCCTG 650 AD Spinocerebellar ata chr20 4680043 4680139 CJD_PRNP PRNP GGTGGTGGCTGGGGGCAGCCTCAT CCTCATGGTGGTGGCTGGGGGCAG 5 AD Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome chr21 45196323 45196360 EPM1_CSTB CSTB CGCGGGGCGGGG CGCGGGGCGGGG 30 AR Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD) chr22 19754285 19754330 TOF_TBX1 TBX1 GCN GCN 25 AD Tetralogy of Fallot -chr22 38713287 38713380 EPM_CSNK1E CSNK1E CCG CCG 745 AR Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy +chr22 38713287 38713380 EPM_CSNK1E CSNK1E CCG CCG 366 AD Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy chr22 46191234 46191304 SCA10_ATXN10 ATXN10 ATTCT ATTCT 800 AD Spinocerebellar ataxia type 10 chrX 25031646 25031682 PRTS_ARX ARX NGC NGC 20 XR Partington syndrome chrX 25031766 25031814 EIEE1_ARX ARX NGC NGC 17 XR Early-infantile epileptic encephalopathy diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json index c1dd1fd7..f692af4c 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg19.stranger.json @@ -916,11 +916,11 @@ "VariantId": ["EPM_CSNK1E"], "PathologicRegion": "chr22:38713287-38713380", "HGNCId": null, - "InheritanceMode": ["AR"], + "InheritanceMode": ["AD"], "DisplayRU": "CCG", "Disease": "EPM, DEE", "NormalMax": 48, - "PathologicMin": 745, + "PathologicMin": 366, "Gene": "CSNK1E" }, { diff --git a/data/catalogs/STRchive-disease-loci.hg38.general.bed b/data/catalogs/STRchive-disease-loci.hg38.general.bed index 39d87c24..a8022c12 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.general.bed @@ -68,7 +68,7 @@ chr20 2652732 2652757 SCA36_NOP56 NOP56 GGCCTG GGCCTG 650 AD Spinocerebellar ata chr20 4699397 4699493 CJD_PRNP PRNP GGTGGTGGCTGGGGGCAGCCTCAT CCTCATGGTGGTGGCTGGGGGCAG 5 AD Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome chr21 43776442 43776479 EPM1_CSTB CSTB CGCGGGGCGGGG CGCGGGGCGGGG 30 AR Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD) chr22 19766762 19766807 TOF_TBX1 TBX1 GCN GCN 25 AD Tetralogy of Fallot -chr22 38317282 38317375 EPM_CSNK1E CSNK1E CCG CCG 745 AR Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy +chr22 38317282 38317375 EPM_CSNK1E CSNK1E CCG CCG 366 AD Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy chr22 45795354 45795424 SCA10_ATXN10 ATXN10 ATTCT ATTCT 800 AD Spinocerebellar ataxia type 10 chrX 25013529 25013565 PRTS_ARX ARX NGC NGC 20 XR Partington syndrome chrX 25013649 25013697 EIEE1_ARX ARX NGC NGC 17 XR Early-infantile epileptic encephalopathy diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json index 0702fe80..c9ba2d36 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg38.stranger.json @@ -916,11 +916,11 @@ "VariantId": ["EPM_CSNK1E"], "PathologicRegion": "chr22:38317282-38317375", "HGNCId": null, - "InheritanceMode": ["AR"], + "InheritanceMode": ["AD"], "DisplayRU": "CCG", "Disease": "EPM, DEE", "NormalMax": 48, - "PathologicMin": 745, + "PathologicMin": 366, "Gene": "CSNK1E" }, { diff --git a/data/plots/age-onset.json b/data/plots/age-onset.json index 749b62da..5184dbe2 100644 --- a/data/plots/age-onset.json +++ b/data/plots/age-onset.json @@ -1,7 +1,7 @@ { "data": [ { - "base": [49.0, 32.0, 31.0, 28.0, 25.0, 23.0, 22.0, 21.0, 20.0, 20.0, 0, 18.0, 18.0, 18.0, 16.0, 16.0, 15.0, 0, 12.0, 12.0, 11.0, 11.0, 10.0, 10.0, 10.0, 10.0, 10.0, 8.0, 8.0, 8.0, 0, 7.0, 7.0, 6.0, 0, 0, 4.0, 4.0, 3.0, 3.0, 3.0, 2.0, 2.0, 0, 0, 2.0, 1.0, 1.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0], + "base": [49.0, 32.0, 31.0, 28.0, 25.0, 23.0, 22.0, 21.0, 20.0, 20.0, 0, 18.0, 18.0, 18.0, 16.0, 16.0, 15.0, 0, 12.0, 12.0, 11.0, 11.0, 10.0, 10.0, 10.0, 10.0, 10.0, 8.0, 8.0, 8.0, 0, 7.0, 7.0, 6.0, 0, 0, 4.0, 4.0, 3.0, 3.0, 3.0, 2.0, 2.0, 0, 0, 2.0, 1.0, 1.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range onset: %{base} - %{x} years", "legendgroup": "AD", "marker": @@ -12,12 +12,12 @@ "offset": -0.1, "orientation": "h", "width": 0.2, - "x": [2.0, 47.0, 32.0, 39.0, 52.0, 51.0, 44.0, 66.0, 71.0, 59.0, 0, 41.0, 19.0, 46.0, 54.0, 57.0, 25.0, 0, 53.0, 54.0, 6.0, 72.0, 40.0, 23.0, 68.0, 40.0, 20.0, 75.0, 54.0, 60.0, 0, 61.0, 59.0, 57.0, 0, 0, 47.0, 56.0, 59.0, 10.0, 70.0, 84.0, 68.0, 0, 0, 1.0, 84.0, 6.0, 0, 0, 73.0, 76.0, 72.0, 74.0, 0, 0, 65.0, 0, 0, 3.0, 36.0, 0, 0], + "x": [2.0, 47.0, 32.0, 39.0, 52.0, 51.0, 44.0, 66.0, 71.0, 59.0, 0, 41.0, 19.0, 46.0, 54.0, 57.0, 25.0, 0, 53.0, 54.0, 6.0, 72.0, 40.0, 23.0, 68.0, 40.0, 20.0, 75.0, 54.0, 60.0, 0, 61.0, 59.0, 57.0, 0, 0, 47.0, 56.0, 59.0, 10.0, 70.0, 84.0, 68.0, 0, 0, 1.0, 84.0, 6.0, 0, 0, 73.0, 76.0, 72.0, 74.0, 10.0, 0, 65.0, 0, 0, 3.0, 36.0, 0, 0], "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { - "base": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 19.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.0, 0, 0, 0, 0, 0, 0, 0, 0, 2.0, 2.0, 0, 0, 0, 0, 1.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0.0], + "base": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 19.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.0, 0, 0, 0, 0, 0, 0, 0, 0, 2.0, 2.0, 0, 0, 0, 0, 1.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range onset: %{base} - %{x} years", "legendgroup": "AR", "marker": @@ -28,7 +28,7 @@ "offset": -0.1, "orientation": "h", "width": 0.2, - "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 57.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 2.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 10.0, 0, 0, 0, 0, 0, 0, 0, 10.0], + "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 57.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 2.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10.0], "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, diff --git a/data/plots/path-size.json b/data/plots/path-size.json index c290dc3b..ea518dc4 100644 --- a/data/plots/path-size.json +++ b/data/plots/path-size.json @@ -1,7 +1,7 @@ { "data": [ { - "base": [0, 50, 18, 2871, 0, 0, 1, 15, 1, 0, 15, 252, 10, 24, 9, 18, 12, 15, 1, 0, 0, 9, 0, 24, 18, 9, 15, 44, 0, 20, 39, 1, 1, 1, 45, 0, 21, 12, 33, 48, 15, 1, 18, 30, 15, 75, 18, 42, 60, 18, 96, 18, 27, 12, 18, 42, 27, 45, 45, 42, 24, 45, 45, 12, 36, 12, 36, 21, 30, 42, 0, 30, 30, 18, 15, 16, 20, 30], + "base": [0, 50, 18, 2871, 0, 0, 15, 1, 0, 15, 252, 1, 10, 24, 9, 18, 12, 15, 1, 0, 0, 9, 0, 24, 18, 9, 15, 44, 0, 20, 39, 1, 1, 1, 45, 0, 21, 12, 33, 48, 15, 1, 18, 30, 15, 75, 18, 42, 60, 18, 96, 18, 27, 12, 18, 42, 27, 45, 45, 42, 24, 45, 45, 12, 36, 12, 36, 21, 30, 42, 0, 30, 30, 18, 15, 16, 20, 30], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Benign", "marker": @@ -12,12 +12,12 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 110, 66, 198, 0, 0, 143, 99, 54, 0, 51, 780, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 110, 66, 198, 0, 0, 99, 54, 0, 51, 780, 143, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { - "base": [0, 165, 90, 0, 0, 0, 147, 0, 55, 0, 126, 0, 0, 540, 0, 417, 120, 135, 474, 0, 0, 0, 0, 0, 0, 0, 240, 108, 0, 260, 0, 0, 0, 0, 150, 0, 114, 144, 135, 0, 102, 0, 120, 120, 105, 123, 108, 81, 0, 87, 0, 108, 108, 84, 81, 87, 63, 0, 0, 0, 0, 0, 0, 57, 0, 0, 0, 0, 0, 0, 0, 33, 33, 0, 0, 0, 0, 0], + "base": [0, 165, 90, 0, 0, 0, 0, 55, 0, 126, 0, 147, 0, 540, 0, 417, 120, 135, 474, 0, 0, 0, 0, 0, 0, 0, 240, 108, 0, 260, 0, 0, 0, 0, 150, 0, 114, 144, 135, 0, 102, 0, 120, 120, 105, 123, 108, 81, 0, 87, 0, 108, 108, 84, 81, 87, 63, 0, 0, 0, 0, 0, 0, 57, 0, 0, 0, 0, 0, 0, 0, 33, 33, 0, 0, 0, 0, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Intermediate", "marker": @@ -28,12 +28,12 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 4085, 3804, 0, 0, 0, 246, 0, 945, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 4085, 3804, 0, 0, 0, 0, 945, 0, 129, 0, 246, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { - "base": [5000, 4000, 3900, 3663, 3300, 3250, 2235, 2040, 2000, 1370, 1350, 1260, 1000, 960, 900, 819, 603, 603, 582, 550, 525, 483, 380, 360, 360, 354, 303, 300, 300, 280, 255, 249, 219, 216, 213, 210, 198, 186, 180, 177, 168, 155, 153, 153, 150, 147, 144, 138, 135, 120, 120, 117, 114, 111, 108, 105, 78, 75, 75, 66, 66, 66, 66, 63, 60, 60, 54, 54, 51, 45, 45, 36, 36, 33, 18, 12, 10, 0], + "base": [5000, 4000, 3900, 3663, 3300, 3250, 2040, 2000, 1370, 1350, 1260, 1098, 1000, 960, 900, 819, 603, 603, 582, 550, 525, 483, 380, 360, 360, 354, 303, 300, 300, 280, 255, 249, 219, 216, 213, 210, 198, 186, 180, 177, 168, 155, 153, 153, 150, 147, 144, 138, 135, 120, 120, 117, 114, 111, 108, 105, 78, 75, 75, 66, 66, 66, 66, 63, 60, 60, 54, 54, 51, 45, 45, 36, 36, 33, 18, 12, 10, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Pathogenic", "marker": @@ -44,8 +44,8 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 18500, 11100, 1287, 0, 1925, 705, 2460, 11750, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 20, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 18500, 11100, 1287, 0, 1925, 2460, 11750, 1420, 0, 294, 1842, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 20, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { @@ -109,8 +109,8 @@ }, "mode": "lines", "showlegend": false, - "x": [144, 147], - "y": ["EPM, DEE", "EPM, DEE"], + "x": [114, 2040], + "y": ["GDPAG", "GDPAG"], "type": "scatter" }, { @@ -122,8 +122,8 @@ }, "mode": "lines", "showlegend": false, - "x": [393, 2235], - "y": ["EPM, DEE", "EPM, DEE"], + "x": [1000, 2000], + "y": ["CANVAS", "CANVAS"], "type": "scatter" }, { @@ -135,8 +135,8 @@ }, "mode": "lines", "showlegend": false, - "x": [114, 2040], - "y": ["GDPAG", "GDPAG"], + "x": [66, 126], + "y": ["FRA7A", "FRA7A"], "type": "scatter" }, { @@ -148,8 +148,8 @@ }, "mode": "lines", "showlegend": false, - "x": [1000, 2000], - "y": ["CANVAS", "CANVAS"], + "x": [255, 1350], + "y": ["FRA7A", "FRA7A"], "type": "scatter" }, { @@ -161,8 +161,8 @@ }, "mode": "lines", "showlegend": false, - "x": [66, 126], - "y": ["FRA7A", "FRA7A"], + "x": [1032, 1260], + "y": ["CPUM", "CPUM"], "type": "scatter" }, { @@ -174,8 +174,8 @@ }, "mode": "lines", "showlegend": false, - "x": [255, 1350], - "y": ["FRA7A", "FRA7A"], + "x": [144, 147], + "y": ["EPM, DEE", "EPM, DEE"], "type": "scatter" }, { @@ -187,8 +187,8 @@ }, "mode": "lines", "showlegend": false, - "x": [1032, 1260], - "y": ["CPUM", "CPUM"], + "x": [393, 1098], + "y": ["EPM, DEE", "EPM, DEE"], "type": "scatter" }, { @@ -1934,7 +1934,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "tickvals": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "title": { "text": "Disease" From 251874f1cbf1e036b83685d63b9414e2e275f564 Mon Sep 17 00:00:00 2001 From: Harriet Dashnow Date: Thu, 25 Jun 2026 14:12:10 +1000 Subject: [PATCH 3/4] change EPM_CSNK1E to AD in criTRia --- data/criTRia-curations.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/data/criTRia-curations.json b/data/criTRia-curations.json index 18ccc4cb..28e3d415 100644 --- a/data/criTRia-curations.json +++ b/data/criTRia-curations.json @@ -1719,7 +1719,7 @@ "Disease_ID": "EPM", "Gene": "CSNK1E", "Locus_ID": "EPM_CSNK1E", - "Inheritance": "AR", + "Inheritance": "AD", "Curator": "Macayla Weiner", "Date": "03/09/2025", "Description": "A heterozygous CGG repeat expansion in exon 1/5'UTR of CSNK1E at the FRA22A locus was reported in one Azerbaijani proband with progressive myoclonic epilepsy, ataxia, cognitive decline, and early death after exome and long-read analyses excluded other plausible causes. The expanded allele showed increased methylation, and prior FRA22A work demonstrated CSNK1E methylation and reduced expression in a CGG-expansion carrier. Unaffected relatives carried expanded or intermediate alleles, supporting incomplete penetrance and the need for careful interpretation of inheritance and penetrance.", From 3f670aebb388f1d7842b0f71d6cdef86aa54cc92 Mon Sep 17 00:00:00 2001 From: hdashnow <3794821+hdashnow@users.noreply.github.com> Date: Thu, 25 Jun 2026 04:21:41 +0000 Subject: [PATCH 4/4] Update data --- data/criTRia-curations.tsv | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/data/criTRia-curations.tsv b/data/criTRia-curations.tsv index 60fa9cff..009aa485 100644 --- a/data/criTRia-curations.tsv +++ b/data/criTRia-curations.tsv @@ -13,7 +13,7 @@ BEAN1 SCA31 AD 08/11/2025 Definitive 12.0 9.0 3.0 4 13.33 SCA31 is an autosomal CACNA1A SCA6 AD 08/12/2025 Definitive 18 12 6 5 28.25 Spinocerebellar ataxia type 6 (SCA6) is an autosomal dominant, late-onset, slowly progressive cerebellar ataxia caused by expansion of a CAG repeat in CACNA1A, encoding an expanded polyglutamine tract in the alpha1A/P/Q-type calcium-channel gene product/alpha1ACT. Expanded alleles were initially observed in unrelated ataxia cases and absent from controls, segregate or share disease haplotypes in families, and repeat-unit number influences age at onset and threshold interpretation. Functional evidence supports Purkinje-cell vulnerability and a toxic gain-of-function mechanism involving CACNA1A C-terminal/alpha1ACT biology, with rescue of model phenotypes by reducing IRES-driven alpha1ACTSCA6 translation. CBL JBS AD 08/12/2025 Definitive 14.5 12.0 2.5 3 5.17 Jacobsen syndrome (JBS) is a contiguous-gene disorder caused by partial deletion of the distal long arm of chromosome 11. The FRA11B CCG repeat/fragile site at 11q23.3, located at the 5' end/immediately upstream of CBL/CBL2, has been implicated as a breakage-prone locus in a subset of JBS cases. The uploaded evidence supports a mechanism in which CCG repeat expansion and associated fragile-site instability can lead to downstream 11q deletion, rather than a CBL coding-variant mechanism. CNBP DM2 AD 07/21/2025 Definitive 14.5 8.5 6 5 15.99 Myotonic dystrophy type 2 (DM2) is an autosomal dominant multisystem disorder caused by a CCTG repeat expansion in intron 1 of CNBP (formerly ZNF9). Genetic evidence includes genetically confirmed DM2 families with the expansion, allele-level differences between interrupted normal alleles and uninterrupted expanded alleles, and linkage/segregation support across European-origin kindreds. Experimental evidence supports toxic expanded CCUG RNA effects, including RNA foci, MBNL-dependent mis-splicing, disrupted Drosophila retinal morphology/apoptosis with partial molecular rescue by PKR inhibition, and altered CNBP/ZNF9 expression and splicing in DM2 patient muscle. -CSNK1E EPM AR 03/09/2025 Limited 4.5 2.0 2.5 3 6.67 A heterozygous CGG repeat expansion in exon 1/5'UTR of CSNK1E at the FRA22A locus was reported in one Azerbaijani proband with progressive myoclonic epilepsy, ataxia, cognitive decline, and early death after exome and long-read analyses excluded other plausible causes. The expanded allele showed increased methylation, and prior FRA22A work demonstrated CSNK1E methylation and reduced expression in a CGG-expansion carrier. Unaffected relatives carried expanded or intermediate alleles, supporting incomplete penetrance and the need for careful interpretation of inheritance and penetrance. +CSNK1E EPM AD 03/09/2025 Limited 4.5 2.0 2.5 3 6.67 A heterozygous CGG repeat expansion in exon 1/5'UTR of CSNK1E at the FRA22A locus was reported in one Azerbaijani proband with progressive myoclonic epilepsy, ataxia, cognitive decline, and early death after exome and long-read analyses excluded other plausible causes. The expanded allele showed increased methylation, and prior FRA22A work demonstrated CSNK1E methylation and reduced expression in a CGG-expansion carrier. Unaffected relatives carried expanded or intermediate alleles, supporting incomplete penetrance and the need for careful interpretation of inheritance and penetrance. DAB1 SCA37 AD 08/18/2025 Strong 13.0 8.5 4.5 2 0.99 Spinocerebellar ataxia type 37 (SCA37) is an autosomal dominant, generally pure cerebellar ataxia associated with an unstable intronic ATTTC pentanucleotide insertion in the non-coding/regulatory region of DAB1. Reported pathogenic alleles place an ATTTC insertion within a polymorphic ATTTT tract, whereas ATTTT-only alleles are non-pathogenic. Available evidence includes familial segregation and shared haplotypes in Portuguese and Spanish kindreds, absence of the ATTTC mutation from control/healthy relatives, repeat-size effects on age at onset, DAB1 transcript dysregulation/RNA switch in SCA37 cerebellum, AUUUC RNA aggregation in transfected human cells, and AUUUC repeat toxicity in zebrafish embryos. DIP2B FRA12A AD 05/20/2026 Disputed 10.5 9.5 1.0 6 19.32 FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. The DIP2B CGG repeat expansion causes this folate-sensitive site and is associated with a broad phenotypic range, including intellectual disability, ataxia/movement disorder, and epilepsy; cardiovascular associations have also been reported but were not scored and are noted for completeness. For this curation, the neurodevelopmental and neurologic presentations (intellectual disability, ataxia/movement disorder, and epilepsy) were lumped as a single phenotypic spectrum, which supports the current score. If these phenotypes are treated as distinct entities, the evidence strength and resulting score may differ. Patients across multiple independent families and cohorts provide inheritance and functional support. Mechanistically, repeat expansions are associated with promoter hypermethylation, altered regulatory activity, and changes in DIP2B expression. Case-control studies report enrichment of DIP2B expansions in ataxia cohorts (OR = 2.8) and cardiovascular disease populations (OR = 2.7), and computational analyses support biological relevance through conservation and a predicted interaction with the DMAP1 methylation complex. DMD DMD XR 05/14/2025 Refuted 0 0 0 2 8.65 A GAA repeat expansion in DMD intron 62 was proposed as a possible contributor to Duchenne/Becker-like dystrophinopathy based on a single three-generation family in which affected female relatives carried expanded alleles and population controls in that study had smaller alleles [@pmid:27417533]. However, large population analyses found the proposed pathogenic genotype at frequencies far exceeding expectations for a highly penetrant early-onset X-linked disorder, supporting refutation of the DMD repeat expansion as a pathogenic disease-causing locus [@pmid:40140942].