diff --git a/data/STRchive-loci.json b/data/STRchive-loci.json index 065429f7..7dc7b775 100644 --- a/data/STRchive-loci.json +++ b/data/STRchive-loci.json @@ -1392,7 +1392,7 @@ "start_t2t": 38781587, "stop_t2t": 38781680, "disease": "Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy", - "inheritance": ["AR"], + "inheritance": ["AD"], "association_type": ["Mendelian"], "disease_description": "Progressive myoclonic epilepsy is a heterogeneous neurodegenerative disorder characterized by early-onset myoclonus, epilepsy, generalized tonic-clonic seizures, and progressive neurological deterioration [@pmid:40751262]. It has also been proposed that this locus is also associated with developmental and epileptic encephalopathies [@pmid:39107278]. We hypothesize that the two diseases may make up an expressivity or phenotypic spectrum and/or that hypermethylation causes changes in onset and severity.", "hpo_terms": ["HP:0001336 Myoclonous", "HP:0001251 Ataxia", "HP:0002080 Intention Tremor", "HP:0007000 Morning Myoclonic Jerks", "HP:0001260 Dysarthia", "HP:0001249 Intellectual Disability", "HP:0002392 EEG with Polyspike Wave Complexes", "HP:0002070 Limb Ataxia", "HP:0000726 Dementia", "HP:0000992 Cutaneous Photosensitivity"], @@ -1429,7 +1429,7 @@ "benign_max": 48, "intermediate_min": 49, "intermediate_max": 131, - "pathogenic_min": 745, + "pathogenic_min": 366, "pathogenic_max": 980, "motif_len": 3, "ref_copies": null, diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed index 03c1911e..c69dd9d0 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.general.bed @@ -68,7 +68,7 @@ chr20 2683189 2683230 SCA36_NOP56 NOP56 GGCCTG GGCCTG 650 AD Spinocerebellar ata chr20 4738633 4738705 CJD_PRNP PRNP GGTGGTGGCTGGGGGCAGCCTCAT CCTCATGGTGGTGGCTGGGGGCAG 5 AD Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome chr21 42132054 42132091 EPM1_CSTB CSTB CGCGGGGCGGGG CGCGGGGCGGGG 30 AR Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD) chr22 20143615 20143660 TOF_TBX1 TBX1 GCN GCN 25 AD Tetralogy of Fallot -chr22 38781587 38781680 EPM_CSNK1E CSNK1E CCG CCG 745 AR Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy +chr22 38781587 38781680 EPM_CSNK1E CSNK1E CCG CCG 366 AD Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy chr22 46280059 46280134 SCA10_ATXN10 ATXN10 ATTCT ATTCT 800 AD Spinocerebellar ataxia type 10 chrX 24597766 24597802 PRTS_ARX ARX NGC NGC 20 XR Partington syndrome chrX 24597886 24597934 EIEE1_ARX ARX NGC NGC 17 XR Early-infantile epileptic encephalopathy diff --git a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json index cd667006..56f8d7cd 100644 --- a/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json +++ b/data/catalogs/STRchive-disease-loci.T2T-chm13.stranger.json @@ -916,11 +916,11 @@ "VariantId": ["EPM_CSNK1E"], "PathologicRegion": "chr22:38781587-38781680", "HGNCId": null, - "InheritanceMode": ["AR"], + "InheritanceMode": ["AD"], "DisplayRU": "CCG", "Disease": "EPM, DEE", "NormalMax": 48, - "PathologicMin": 745, + "PathologicMin": 366, "Gene": "CSNK1E" }, { diff --git a/data/catalogs/STRchive-disease-loci.hg19.general.bed b/data/catalogs/STRchive-disease-loci.hg19.general.bed index 97bbd950..5e0ff2ce 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg19.general.bed @@ -68,7 +68,7 @@ chr20 2633378 2633403 SCA36_NOP56 NOP56 GGCCTG GGCCTG 650 AD Spinocerebellar ata chr20 4680043 4680139 CJD_PRNP PRNP GGTGGTGGCTGGGGGCAGCCTCAT CCTCATGGTGGTGGCTGGGGGCAG 5 AD Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome chr21 45196323 45196360 EPM1_CSTB CSTB CGCGGGGCGGGG CGCGGGGCGGGG 30 AR Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD) chr22 19754285 19754330 TOF_TBX1 TBX1 GCN GCN 25 AD Tetralogy of Fallot -chr22 38713287 38713380 EPM_CSNK1E CSNK1E CCG CCG 745 AR Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy +chr22 38713287 38713380 EPM_CSNK1E CSNK1E CCG CCG 366 AD Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy chr22 46191234 46191304 SCA10_ATXN10 ATXN10 ATTCT ATTCT 800 AD Spinocerebellar ataxia type 10 chrX 25031646 25031682 PRTS_ARX ARX NGC NGC 20 XR Partington syndrome chrX 25031766 25031814 EIEE1_ARX ARX NGC NGC 17 XR Early-infantile epileptic encephalopathy diff --git a/data/catalogs/STRchive-disease-loci.hg19.stranger.json b/data/catalogs/STRchive-disease-loci.hg19.stranger.json index c1dd1fd7..f692af4c 100644 --- a/data/catalogs/STRchive-disease-loci.hg19.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg19.stranger.json @@ -916,11 +916,11 @@ "VariantId": ["EPM_CSNK1E"], "PathologicRegion": "chr22:38713287-38713380", "HGNCId": null, - "InheritanceMode": ["AR"], + "InheritanceMode": ["AD"], "DisplayRU": "CCG", "Disease": "EPM, DEE", "NormalMax": 48, - "PathologicMin": 745, + "PathologicMin": 366, "Gene": "CSNK1E" }, { diff --git a/data/catalogs/STRchive-disease-loci.hg38.general.bed b/data/catalogs/STRchive-disease-loci.hg38.general.bed index 39d87c24..a8022c12 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.general.bed +++ b/data/catalogs/STRchive-disease-loci.hg38.general.bed @@ -68,7 +68,7 @@ chr20 2652732 2652757 SCA36_NOP56 NOP56 GGCCTG GGCCTG 650 AD Spinocerebellar ata chr20 4699397 4699493 CJD_PRNP PRNP GGTGGTGGCTGGGGGCAGCCTCAT CCTCATGGTGGTGGCTGGGGGCAG 5 AD Creutzfeldt-Jakob disease and Gerstmann-Straussler-Schneiker syndrome chr21 43776442 43776479 EPM1_CSTB CSTB CGCGGGGCGGGG CGCGGGGCGGGG 30 AR Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a Unverricht-Lundborg Disease (ULD) chr22 19766762 19766807 TOF_TBX1 TBX1 GCN GCN 25 AD Tetralogy of Fallot -chr22 38317282 38317375 EPM_CSNK1E CSNK1E CCG CCG 745 AR Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy +chr22 38317282 38317375 EPM_CSNK1E CSNK1E CCG CCG 366 AD Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy chr22 45795354 45795424 SCA10_ATXN10 ATXN10 ATTCT ATTCT 800 AD Spinocerebellar ataxia type 10 chrX 25013529 25013565 PRTS_ARX ARX NGC NGC 20 XR Partington syndrome chrX 25013649 25013697 EIEE1_ARX ARX NGC NGC 17 XR Early-infantile epileptic encephalopathy diff --git a/data/catalogs/STRchive-disease-loci.hg38.stranger.json b/data/catalogs/STRchive-disease-loci.hg38.stranger.json index 0702fe80..c9ba2d36 100644 --- a/data/catalogs/STRchive-disease-loci.hg38.stranger.json +++ b/data/catalogs/STRchive-disease-loci.hg38.stranger.json @@ -916,11 +916,11 @@ "VariantId": ["EPM_CSNK1E"], "PathologicRegion": "chr22:38317282-38317375", "HGNCId": null, - "InheritanceMode": ["AR"], + "InheritanceMode": ["AD"], "DisplayRU": "CCG", "Disease": "EPM, DEE", "NormalMax": 48, - "PathologicMin": 745, + "PathologicMin": 366, "Gene": "CSNK1E" }, { diff --git a/data/criTRia-curations.json b/data/criTRia-curations.json index 18ccc4cb..28e3d415 100644 --- a/data/criTRia-curations.json +++ b/data/criTRia-curations.json @@ -1719,7 +1719,7 @@ "Disease_ID": "EPM", "Gene": "CSNK1E", "Locus_ID": "EPM_CSNK1E", - "Inheritance": "AR", + "Inheritance": "AD", "Curator": "Macayla Weiner", "Date": "03/09/2025", "Description": "A heterozygous CGG repeat expansion in exon 1/5'UTR of CSNK1E at the FRA22A locus was reported in one Azerbaijani proband with progressive myoclonic epilepsy, ataxia, cognitive decline, and early death after exome and long-read analyses excluded other plausible causes. The expanded allele showed increased methylation, and prior FRA22A work demonstrated CSNK1E methylation and reduced expression in a CGG-expansion carrier. Unaffected relatives carried expanded or intermediate alleles, supporting incomplete penetrance and the need for careful interpretation of inheritance and penetrance.", diff --git a/data/criTRia-curations.tsv b/data/criTRia-curations.tsv index 60fa9cff..009aa485 100644 --- a/data/criTRia-curations.tsv +++ b/data/criTRia-curations.tsv @@ -13,7 +13,7 @@ BEAN1 SCA31 AD 08/11/2025 Definitive 12.0 9.0 3.0 4 13.33 SCA31 is an autosomal CACNA1A SCA6 AD 08/12/2025 Definitive 18 12 6 5 28.25 Spinocerebellar ataxia type 6 (SCA6) is an autosomal dominant, late-onset, slowly progressive cerebellar ataxia caused by expansion of a CAG repeat in CACNA1A, encoding an expanded polyglutamine tract in the alpha1A/P/Q-type calcium-channel gene product/alpha1ACT. Expanded alleles were initially observed in unrelated ataxia cases and absent from controls, segregate or share disease haplotypes in families, and repeat-unit number influences age at onset and threshold interpretation. Functional evidence supports Purkinje-cell vulnerability and a toxic gain-of-function mechanism involving CACNA1A C-terminal/alpha1ACT biology, with rescue of model phenotypes by reducing IRES-driven alpha1ACTSCA6 translation. CBL JBS AD 08/12/2025 Definitive 14.5 12.0 2.5 3 5.17 Jacobsen syndrome (JBS) is a contiguous-gene disorder caused by partial deletion of the distal long arm of chromosome 11. The FRA11B CCG repeat/fragile site at 11q23.3, located at the 5' end/immediately upstream of CBL/CBL2, has been implicated as a breakage-prone locus in a subset of JBS cases. The uploaded evidence supports a mechanism in which CCG repeat expansion and associated fragile-site instability can lead to downstream 11q deletion, rather than a CBL coding-variant mechanism. CNBP DM2 AD 07/21/2025 Definitive 14.5 8.5 6 5 15.99 Myotonic dystrophy type 2 (DM2) is an autosomal dominant multisystem disorder caused by a CCTG repeat expansion in intron 1 of CNBP (formerly ZNF9). Genetic evidence includes genetically confirmed DM2 families with the expansion, allele-level differences between interrupted normal alleles and uninterrupted expanded alleles, and linkage/segregation support across European-origin kindreds. Experimental evidence supports toxic expanded CCUG RNA effects, including RNA foci, MBNL-dependent mis-splicing, disrupted Drosophila retinal morphology/apoptosis with partial molecular rescue by PKR inhibition, and altered CNBP/ZNF9 expression and splicing in DM2 patient muscle. -CSNK1E EPM AR 03/09/2025 Limited 4.5 2.0 2.5 3 6.67 A heterozygous CGG repeat expansion in exon 1/5'UTR of CSNK1E at the FRA22A locus was reported in one Azerbaijani proband with progressive myoclonic epilepsy, ataxia, cognitive decline, and early death after exome and long-read analyses excluded other plausible causes. The expanded allele showed increased methylation, and prior FRA22A work demonstrated CSNK1E methylation and reduced expression in a CGG-expansion carrier. Unaffected relatives carried expanded or intermediate alleles, supporting incomplete penetrance and the need for careful interpretation of inheritance and penetrance. +CSNK1E EPM AD 03/09/2025 Limited 4.5 2.0 2.5 3 6.67 A heterozygous CGG repeat expansion in exon 1/5'UTR of CSNK1E at the FRA22A locus was reported in one Azerbaijani proband with progressive myoclonic epilepsy, ataxia, cognitive decline, and early death after exome and long-read analyses excluded other plausible causes. The expanded allele showed increased methylation, and prior FRA22A work demonstrated CSNK1E methylation and reduced expression in a CGG-expansion carrier. Unaffected relatives carried expanded or intermediate alleles, supporting incomplete penetrance and the need for careful interpretation of inheritance and penetrance. DAB1 SCA37 AD 08/18/2025 Strong 13.0 8.5 4.5 2 0.99 Spinocerebellar ataxia type 37 (SCA37) is an autosomal dominant, generally pure cerebellar ataxia associated with an unstable intronic ATTTC pentanucleotide insertion in the non-coding/regulatory region of DAB1. Reported pathogenic alleles place an ATTTC insertion within a polymorphic ATTTT tract, whereas ATTTT-only alleles are non-pathogenic. Available evidence includes familial segregation and shared haplotypes in Portuguese and Spanish kindreds, absence of the ATTTC mutation from control/healthy relatives, repeat-size effects on age at onset, DAB1 transcript dysregulation/RNA switch in SCA37 cerebellum, AUUUC RNA aggregation in transfected human cells, and AUUUC repeat toxicity in zebrafish embryos. DIP2B FRA12A AD 05/20/2026 Disputed 10.5 9.5 1.0 6 19.32 FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. The DIP2B CGG repeat expansion causes this folate-sensitive site and is associated with a broad phenotypic range, including intellectual disability, ataxia/movement disorder, and epilepsy; cardiovascular associations have also been reported but were not scored and are noted for completeness. For this curation, the neurodevelopmental and neurologic presentations (intellectual disability, ataxia/movement disorder, and epilepsy) were lumped as a single phenotypic spectrum, which supports the current score. If these phenotypes are treated as distinct entities, the evidence strength and resulting score may differ. Patients across multiple independent families and cohorts provide inheritance and functional support. Mechanistically, repeat expansions are associated with promoter hypermethylation, altered regulatory activity, and changes in DIP2B expression. Case-control studies report enrichment of DIP2B expansions in ataxia cohorts (OR = 2.8) and cardiovascular disease populations (OR = 2.7), and computational analyses support biological relevance through conservation and a predicted interaction with the DMAP1 methylation complex. DMD DMD XR 05/14/2025 Refuted 0 0 0 2 8.65 A GAA repeat expansion in DMD intron 62 was proposed as a possible contributor to Duchenne/Becker-like dystrophinopathy based on a single three-generation family in which affected female relatives carried expanded alleles and population controls in that study had smaller alleles [@pmid:27417533]. However, large population analyses found the proposed pathogenic genotype at frequencies far exceeding expectations for a highly penetrant early-onset X-linked disorder, supporting refutation of the DMD repeat expansion as a pathogenic disease-causing locus [@pmid:40140942]. diff --git a/data/plots/age-onset.json b/data/plots/age-onset.json index 749b62da..5184dbe2 100644 --- a/data/plots/age-onset.json +++ b/data/plots/age-onset.json @@ -1,7 +1,7 @@ { "data": [ { - "base": [49.0, 32.0, 31.0, 28.0, 25.0, 23.0, 22.0, 21.0, 20.0, 20.0, 0, 18.0, 18.0, 18.0, 16.0, 16.0, 15.0, 0, 12.0, 12.0, 11.0, 11.0, 10.0, 10.0, 10.0, 10.0, 10.0, 8.0, 8.0, 8.0, 0, 7.0, 7.0, 6.0, 0, 0, 4.0, 4.0, 3.0, 3.0, 3.0, 2.0, 2.0, 0, 0, 2.0, 1.0, 1.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0], + "base": [49.0, 32.0, 31.0, 28.0, 25.0, 23.0, 22.0, 21.0, 20.0, 20.0, 0, 18.0, 18.0, 18.0, 16.0, 16.0, 15.0, 0, 12.0, 12.0, 11.0, 11.0, 10.0, 10.0, 10.0, 10.0, 10.0, 8.0, 8.0, 8.0, 0, 7.0, 7.0, 6.0, 0, 0, 4.0, 4.0, 3.0, 3.0, 3.0, 2.0, 2.0, 0, 0, 2.0, 1.0, 1.0, 0, 0, 0.0, 0.0, 0.0, 0.0, 0.0, 0, 0.0, 0, 0, 0.0, 0.0, 0, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range onset: %{base} - %{x} years", "legendgroup": "AD", "marker": @@ -12,12 +12,12 @@ "offset": -0.1, "orientation": "h", "width": 0.2, - "x": [2.0, 47.0, 32.0, 39.0, 52.0, 51.0, 44.0, 66.0, 71.0, 59.0, 0, 41.0, 19.0, 46.0, 54.0, 57.0, 25.0, 0, 53.0, 54.0, 6.0, 72.0, 40.0, 23.0, 68.0, 40.0, 20.0, 75.0, 54.0, 60.0, 0, 61.0, 59.0, 57.0, 0, 0, 47.0, 56.0, 59.0, 10.0, 70.0, 84.0, 68.0, 0, 0, 1.0, 84.0, 6.0, 0, 0, 73.0, 76.0, 72.0, 74.0, 0, 0, 65.0, 0, 0, 3.0, 36.0, 0, 0], + "x": [2.0, 47.0, 32.0, 39.0, 52.0, 51.0, 44.0, 66.0, 71.0, 59.0, 0, 41.0, 19.0, 46.0, 54.0, 57.0, 25.0, 0, 53.0, 54.0, 6.0, 72.0, 40.0, 23.0, 68.0, 40.0, 20.0, 75.0, 54.0, 60.0, 0, 61.0, 59.0, 57.0, 0, 0, 47.0, 56.0, 59.0, 10.0, 70.0, 84.0, 68.0, 0, 0, 1.0, 84.0, 6.0, 0, 0, 73.0, 76.0, 72.0, 74.0, 10.0, 0, 65.0, 0, 0, 3.0, 36.0, 0, 0], "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, { - "base": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 19.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.0, 0, 0, 0, 0, 0, 0, 0, 0, 2.0, 2.0, 0, 0, 0, 0, 1.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0.0], + "base": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 19.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 6.0, 0, 0, 0, 0, 0, 0, 0, 0, 2.0, 2.0, 0, 0, 0, 0, 1.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range onset: %{base} - %{x} years", "legendgroup": "AR", "marker": @@ -28,7 +28,7 @@ "offset": -0.1, "orientation": "h", "width": 0.2, - "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 57.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 2.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 10.0, 0, 0, 0, 0, 0, 0, 0, 10.0], + "x": [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 57.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 12.0, 0, 0, 0, 0, 0, 0, 0, 0, 78.0, 2.0, 0, 0, 0, 0, 0.0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 10.0], "y": ["OPDM", "FECD3", "CJD", "SCA36", "ALS1", "FAME6", "MRUPAV", "SCA27B", "FTDALS1", "OPMD", "CANVAS", "OPDM", "FAME7", "SCA37", "ADTKD", "SCA6", "OPML1", "XDP", "SCA4", "HDL2", "MODY8", "SCA10", "FAME3", "FAME4", "NIID", "OPDM5", "OPDM4", "SCA31", "SCA12", "FAME1", "SBMA", "FAME8", "OPDM1", "SCA1", "EPM1", "DMD", "SCA51", "FAME2", "SCA17", "EDM1, PSACH", "SCA3, MJD", "SCA2", "OPDM2", "FRDA", "GDPAG", "FRA7A", "HD", "FRA2A", "FRAXE", "NME", "DM2", "SCA8", "DRPLA", "DM1", "EPM, DEE", "XLID, PHPX", "SCA7", "EIEE1", "PRTS", "FRA12A", "CCHS", "FXS, FXTAS, POF1", "HMNR7"], "type": "bar" }, diff --git a/data/plots/path-size.json b/data/plots/path-size.json index c290dc3b..ea518dc4 100644 --- a/data/plots/path-size.json +++ b/data/plots/path-size.json @@ -1,7 +1,7 @@ { "data": [ { - "base": [0, 50, 18, 2871, 0, 0, 1, 15, 1, 0, 15, 252, 10, 24, 9, 18, 12, 15, 1, 0, 0, 9, 0, 24, 18, 9, 15, 44, 0, 20, 39, 1, 1, 1, 45, 0, 21, 12, 33, 48, 15, 1, 18, 30, 15, 75, 18, 42, 60, 18, 96, 18, 27, 12, 18, 42, 27, 45, 45, 42, 24, 45, 45, 12, 36, 12, 36, 21, 30, 42, 0, 30, 30, 18, 15, 16, 20, 30], + "base": [0, 50, 18, 2871, 0, 0, 15, 1, 0, 15, 252, 1, 10, 24, 9, 18, 12, 15, 1, 0, 0, 9, 0, 24, 18, 9, 15, 44, 0, 20, 39, 1, 1, 1, 45, 0, 21, 12, 33, 48, 15, 1, 18, 30, 15, 75, 18, 42, 60, 18, 96, 18, 27, 12, 18, 42, 27, 45, 45, 42, 24, 45, 45, 12, 36, 12, 36, 21, 30, 42, 0, 30, 30, 18, 15, 16, 20, 30], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Benign", "marker": @@ -12,12 +12,12 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 110, 66, 198, 0, 0, 143, 99, 54, 0, 51, 780, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 110, 66, 198, 0, 0, 99, 54, 0, 51, 780, 143, 25, 513, 51, 51, 105, 117, 149, 0, 0, 39, 0, 12, 30, 123, 222, 60, 0, 220, 96, 179, 95, 59, 105, 0, 90, 126, 99, 51, 84, 149, 78, 87, 87, 45, 87, 36, 54, 66, 0, 87, 75, 69, 60, 42, 33, 0, 0, 0, 30, 0, 0, 42, 0, 39, 0, 21, 18, 0, 0, 0, 0, 12, 0, 0, 0, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { - "base": [0, 165, 90, 0, 0, 0, 147, 0, 55, 0, 126, 0, 0, 540, 0, 417, 120, 135, 474, 0, 0, 0, 0, 0, 0, 0, 240, 108, 0, 260, 0, 0, 0, 0, 150, 0, 114, 144, 135, 0, 102, 0, 120, 120, 105, 123, 108, 81, 0, 87, 0, 108, 108, 84, 81, 87, 63, 0, 0, 0, 0, 0, 0, 57, 0, 0, 0, 0, 0, 0, 0, 33, 33, 0, 0, 0, 0, 0], + "base": [0, 165, 90, 0, 0, 0, 0, 55, 0, 126, 0, 147, 0, 540, 0, 417, 120, 135, 474, 0, 0, 0, 0, 0, 0, 0, 240, 108, 0, 260, 0, 0, 0, 0, 150, 0, 114, 144, 135, 0, 102, 0, 120, 120, 105, 123, 108, 81, 0, 87, 0, 108, 108, 84, 81, 87, 63, 0, 0, 0, 0, 0, 0, 57, 0, 0, 0, 0, 0, 0, 0, 33, 33, 0, 0, 0, 0, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Intermediate", "marker": @@ -28,12 +28,12 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 4085, 3804, 0, 0, 0, 246, 0, 945, 0, 129, 0, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 4085, 3804, 0, 0, 0, 0, 945, 0, 129, 0, 246, 0, 417, 0, 201, 480, 465, 0, 0, 0, 0, 0, 0, 0, 0, 60, 188, 0, 0, 0, 0, 0, 0, 60, 0, 81, 36, 42, 0, 63, 0, 27, 30, 42, 21, 33, 54, 0, 30, 0, 6, 3, 21, 24, 15, 12, 0, 0, 0, 0, 0, 0, 3, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { - "base": [5000, 4000, 3900, 3663, 3300, 3250, 2235, 2040, 2000, 1370, 1350, 1260, 1000, 960, 900, 819, 603, 603, 582, 550, 525, 483, 380, 360, 360, 354, 303, 300, 300, 280, 255, 249, 219, 216, 213, 210, 198, 186, 180, 177, 168, 155, 153, 153, 150, 147, 144, 138, 135, 120, 120, 117, 114, 111, 108, 105, 78, 75, 75, 66, 66, 66, 66, 63, 60, 60, 54, 54, 51, 45, 45, 36, 36, 33, 18, 12, 10, 0], + "base": [5000, 4000, 3900, 3663, 3300, 3250, 2040, 2000, 1370, 1350, 1260, 1098, 1000, 960, 900, 819, 603, 603, 582, 550, 525, 483, 380, 360, 360, 354, 303, 300, 300, 280, 255, 249, 219, 216, 213, 210, 198, 186, 180, 177, 168, 155, 153, 153, 150, 147, 144, 138, 135, 120, 120, 117, 114, 111, 108, 105, 78, 75, 75, 66, 66, 66, 66, 63, 60, 60, 54, 54, 51, 45, 45, 36, 36, 33, 18, 12, 10, 0], "hovertemplate": "Disease: %{y} \u003cbr\u003e Range: %{base} - %{x} bp", "legendgroup": "Pathogenic", "marker": @@ -44,8 +44,8 @@ "offset": -0.3, "orientation": "h", "width": 0.6, - "x": [0, 18500, 11100, 1287, 0, 1925, 705, 2460, 11750, 1420, 0, 294, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 20, 0], - "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "x": [0, 18500, 11100, 1287, 0, 1925, 2460, 11750, 1420, 0, 294, 1842, 0, 1851, 0, 99, 5397, 5397, 12, 3250, 17875, 1617, 820, 1140, 231, 1728, 597, 43700, 10700, 40, 612, 195, 273, 114, 3687, 102, 1353, 24342, 81, 69, 4932, 220, 81, 7647, 11850, 51, 135, 84, 165, 60, 264, 156, 90, 1269, 642, 1395, 21, 0, 0, 0, 30, 3, 12, 36, 0, 21, 0, 3, 30, 27, 1625, 18, 0, 135, 3, 0, 20, 0], + "y": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "type": "bar" }, { @@ -109,8 +109,8 @@ }, "mode": "lines", "showlegend": false, - "x": [144, 147], - "y": ["EPM, DEE", "EPM, DEE"], + "x": [114, 2040], + "y": ["GDPAG", "GDPAG"], "type": "scatter" }, { @@ -122,8 +122,8 @@ }, "mode": "lines", "showlegend": false, - "x": [393, 2235], - "y": ["EPM, DEE", "EPM, DEE"], + "x": [1000, 2000], + "y": ["CANVAS", "CANVAS"], "type": "scatter" }, { @@ -135,8 +135,8 @@ }, "mode": "lines", "showlegend": false, - "x": [114, 2040], - "y": ["GDPAG", "GDPAG"], + "x": [66, 126], + "y": ["FRA7A", "FRA7A"], "type": "scatter" }, { @@ -148,8 +148,8 @@ }, "mode": "lines", "showlegend": false, - "x": [1000, 2000], - "y": ["CANVAS", "CANVAS"], + "x": [255, 1350], + "y": ["FRA7A", "FRA7A"], "type": "scatter" }, { @@ -161,8 +161,8 @@ }, "mode": "lines", "showlegend": false, - "x": [66, 126], - "y": ["FRA7A", "FRA7A"], + "x": [1032, 1260], + "y": ["CPUM", "CPUM"], "type": "scatter" }, { @@ -174,8 +174,8 @@ }, "mode": "lines", "showlegend": false, - "x": [255, 1350], - "y": ["FRA7A", "FRA7A"], + "x": [144, 147], + "y": ["EPM, DEE", "EPM, DEE"], "type": "scatter" }, { @@ -187,8 +187,8 @@ }, "mode": "lines", "showlegend": false, - "x": [1032, 1260], - "y": ["CPUM", "CPUM"], + "x": [393, 1098], + "y": ["EPM, DEE", "EPM, DEE"], "type": "scatter" }, { @@ -1934,7 +1934,7 @@ "yaxis": { "tickmode": "array", - "tickvals": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "EPM, DEE", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], + "tickvals": ["FAME4", "SCA10", "SCA36", "MRUPAV", "FAME6", "FAME3", "GDPAG", "CANVAS", "FAME2", "FRA7A", "CPUM", "EPM, DEE", "NME", "SCA27B", "FRA2A", "FRA12A", "FRAXE", "FXS, FXTAS, POF1", "OPDM", "SCA31", "FAME1", "OPML1", "aFTLD-U", "EPM1", "OPDM4", "OPDM5", "JBS", "DM2", "FAME7", "RCPS", "OPDM1", "OPDM", "OPDM2", "DBQD2, BSS", "SCA8", "XDP", "NIID", "FTDALS1", "SCA3, MJD", "DMD", "FRDA", "SCA37", "SCA12", "FECD3", "DM1", "SCA17", "DRPLA", "SCA4", "SCA51", "HDL2", "CJD", "SCA1", "SBMA", "SCA7", "HD", "SCA2", "CCHS", "TOF", "HPE5", "HFG-I", "HFG-III", "SD5", "XLID, PHPX", "SCA6", "PRTS", "CCD", "HFG-II", "HSAN VIII", "EIEE1", "BPES", "FAME8", "OPMD", "VACTERLX", "ALS1", "EDM1, PSACH", "CHNG3", "HMNR7", "CPEO"], "title": { "text": "Disease"