- Hello ${student_reg_information[0].student_list[studentParseNum].name.split(" ")[0]}! -
-You have completed the following assignments:
-
You have not completed any assignments yet.
- ` - } -- Oh wait! Hello ${student_reg_information[0].student_list[studentParseNum].type}! Would you like to download student marks? -
- - - - - -- - - -
- `; - - $("#accountManagementBody").append(append_str); - } - - // TA access to add new students: - if ( - student_reg_information[0].student_list[studentParseNum].type === "TA" || - student_reg_information[0].student_list[studentParseNum].type === "admin" - ) { - append_str = "ADMIN POWER!
"; - - // Create student card - append_str += "
If you would like to create a new class, just fill the form below: "; - // Form opening - append_str += "
"; - - // Close card - append_str += "If you would like to add a single user (students, TAs or admins), please fill in the form below. Please note, this will default the user as a student. Only admins will be able to create new TAs or admins
"; - // Form opening - append_str += ""; - - // Close card - append_str += "If you would like to change a class's off-target optimal goal, you can do that here
"; - - // Choose class: - append_str += 'Modify controls for:
'; - append_str += ''; - - append_str += 'Current off-target marking is set to:
'; - append_str += - '"; - append_str += - ''; - append_str += - 'Choose how you want the off-target score to be marked. Optimal is Min_optimal = Max_range - (Max_range * 0.2) if below 80 (if below, optimal = 80). Custom value can be any number between 0.01 and 100 which will be the new custom "optimal" value for your class.'; - append_str += "If you would like to change a user's account type (to TA or admin or back to student), you can do that below
"; - - // Choose class: - append_str += '| ${student.student_number} | \n`; - downloadIndexTable_str += `\t\t\t${student.name} | \n`; - downloadIndexTable_str += "\t\t
Please refer to your dry lab protocol for full instructions on how and what to do. Below is a brief reminder of what you are supposed to do with each gene: \n Your objective is to find these mutations, design a gRNA and its corresponding F1/R1 primers
\nHere is some background information about your gene: ${gene_backgroundInfo?.gene_list[current_gene].name} (${current_gene})
\n`,e+=`Background information: ${gene_backgroundInfo?.gene_list[current_gene].Background}
\n`,e+=`Target site: ${gene_backgroundInfo?.gene_list[current_gene]["Target site"]}
\n`,e+=`Modified genetic sequence: ${gene_backgroundInfo?.gene_list[current_gene].Sequence}
\n`,e+="Please input the following information for your gRNA for your selected gene.
\n",e+="",e+="You would only receive feedback on your practice attempts and not your final assignments.
";e+="The assignment itself is marked out of 10 marks with 2 marks for each input excluding gRNA strand direction, cut position and target region range (these three values are used to calculate if you have the right answer or not which means they are still crucial that they are still correct).
",e+="The following is the breakdown of what marks you would have received and why you would have gotten them:
",e+=`Mark: ${all_marks[0]}/10 (${all_marks[1]})
`;let t=0,n="Your gRNA sequence was wrong and not found in the Benchling gRNA outputs. Either you made a typo or this answer was not correct and did not contain the target cut site within an acceptable range.";MARgRNAseq&&(1===MARgRNAseq_degree?(t=2,n="This means your answer was correct and you received full marks."):2===MARgRNAseq_degree?(t=1,n="This means your sequence was partially correct as it contains the target sequence within a 20bp range but was not optimal. One mark."):3===MARgRNAseq_degree&&(t=.5,n="This means your sequence was not wrong (therefore was still correct) but there were better options out there. I recommend you try this practice assignment again. Still worth some marks though (half a mark)."));let a=0,s="Your PAM sequence was wrong and not found relative to your gRNA sequence. Either you made a typo or this answer was not correct. Either it contained the cut site within the PAM site or it was not an NGG or NAG PAM site (SciGrade only accepts either of those two PAM sites).";MARPAMseq&&(a=2,s="This means your answer was correct and you received full marks.");let o=0,r="Your off-target score was wrong. Either it was not above/within the optimal range (or above 35) or the last-resort option.";MAROffTarget&&(1===MAROffTarget_degree?(o=2,r="This means your answer was correct while above/within the optimal and you received full marks."):2===MAROffTarget_degree?(o=1,r="This means your answer was technically correct as its on-target value was above 35."):3===MAROffTarget_degree&&(o=.5,r="This means your answer was partially correct as it was found to be your only option is solely based on the target region range you selected."));let l=0,i="";for(let p=0;pFor gRNA PAM Sequence, you put down "${all_answers[1]}" which gave you the mark ${a}.
`,e+=s,e+="For Off-Target Score, you put down "${all_answers[4]}" which gave you the mark ${o}.
`,e+=r,e+="For F1 Primer, you put down "${all_answers[5]}" which gave you the mark ${l}.
`,e+=d,e+="For R1 Primer, you put down "${all_answers[6]}" which gave you the mark ${c}.
`,e+=m,e+="If at any point you wish to dispute marks, please contact your TA or professor once you completed your assignment. If you have found a bug in our SciGrade marking system, please contact your professor or our admin.
",e+="',$("#mainContainer").append(e)}function showNewInput(e,t,n){document.getElementById(String(e)).value===String(t)?document.getElementById(String(n)).removeAttribute("hidden"):document.getElementById(String(n)).setAttribute("hidden",!0)}let completed_assignments=[];function generateCompletedAssignmentList(){completed_assignments=[],student_reg_information[0].student_list[studentParseNum]["assignment-HBB-Marks"]&&(completed_assignments.includes("HBB")||completed_assignments.push("HBB")),student_reg_information[0].student_list[studentParseNum]["assignment-CCR5-Marks"]&&(completed_assignments.includes("CCR5")||completed_assignments.push("CCR5")),student_reg_information[0].student_list[studentParseNum]["assignment-ANKK1-Marks"]&&(completed_assignments.includes("ANKK1")||completed_assignments.push("ANKK1")),student_reg_information[0].student_list[studentParseNum]["assignment-APOE-Marks"]&&(completed_assignments.includes("APOE")||completed_assignments.push("APOE"))}function openAccountManagement(){generateCompletedAssignmentList(),$("#accountManagementBody").empty();let e=`\n\t\t
\n\t\t\t\tHello ${student_reg_information[0].student_list[studentParseNum].name.split(" ")[0]}!\n\t\t\t
\n\t\tYou have completed the following assignments:
\n\t\t\t\t\t\t\t
You have not completed any assignments yet.
\n\t\t\t\t\t\t\t"}\n\t\t\t\t\n\t\t\t\t Oh wait! Hello ${student_reg_information[0].student_list[studentParseNum].type}! Would you like to download student marks?\n\t\t\t
\n\n\t\t\t\n\n\t\t\t\n\t\t\t\t
ADMIN POWER!
",e+="
If you would like to create a new class, just fill the form below: ",e+="
",e+="If you would like to add a single user (students, TAs or admins), please fill in the form below. Please note, this will default the user as a student. Only admins will be able to create new TAs or admins
",e+="",e+="If you would like to change a class's off-target optimal goal, you can do that here
",e+='Modify controls for:
',e+='',e+='Current off-target marking is set to:
',e+='",e+='',e+='Choose how you want the off-target score to be marked. Optimal is Min_optimal = Max_range - (Max_range * 0.2) if below 80 (if below, optimal = 80). Custom value can be any number between 0.01 and 100 which will be the new custom "optimal" value for your class.',e+="If you would like to change a user's account type (to TA or admin or back to student), you can do that below
",e+='| ${t.student_number} | \n`,a+=`\t\t\t${t.name} | \n`,a+="\t\t
Please refer to your dry lab protocol for full instructions on how and what to do. Below is a brief reminder of what you are supposed to do with each gene: + Your objective is to find these mutations, design a gRNA and its corresponding F1/R1 primers
+Here is some background information about your gene: ${gene_backgroundInfo?.gene_list[current_gene].name} (${current_gene})
+`,e+=`Background information: ${gene_backgroundInfo?.gene_list[current_gene].Background}
+`,e+=`Target site: ${gene_backgroundInfo?.gene_list[current_gene]["Target site"]}
+`,e+=`Modified genetic sequence: ${gene_backgroundInfo?.gene_list[current_gene].Sequence}
+`,e+="Please input the following information for your gRNA for your selected gene.
+`,e+="",e+="You would only receive feedback on your practice attempts and not your final assignments.
";e+="The assignment itself is marked out of 10 marks with 2 marks for each input excluding gRNA strand direction, cut position and target region range (these three values are used to calculate if you have the right answer or not which means they are still crucial that they are still correct).
",e+="The following is the breakdown of what marks you would have received and why you would have gotten them:
",e+=`Mark: ${all_marks[0]}/10 (${all_marks[1]})
`;let n=0,t="Your gRNA sequence was wrong and not found in the Benchling gRNA outputs. Either you made a typo or this answer was not correct and did not contain the target cut site within an acceptable range.";MARgRNAseq&&(MARgRNAseq_degree===1?(n=2,t="This means your answer was correct and you received full marks."):MARgRNAseq_degree===2?(n=1,t="This means your sequence was partially correct as it contains the target sequence within a 20bp range but was not optimal. One mark."):MARgRNAseq_degree===3&&(n=.5,t="This means your sequence was not wrong (therefore was still correct) but there were better options out there. I recommend you try this practice assignment again. Still worth some marks though (half a mark)."));let o=0,a="Your PAM sequence was wrong and not found relative to your gRNA sequence. Either you made a typo or this answer was not correct. Either it contained the cut site within the PAM site or it was not an NGG or NAG PAM site (SciGrade only accepts either of those two PAM sites).";MARPAMseq&&(o=2,a="This means your answer was correct and you received full marks.");let r=0,c="Your off-target score was wrong. Either it was not above/within the optimal range (or above 35) or the last-resort option.";MAROffTarget&&(MAROffTarget_degree===1?(r=2,c="This means your answer was correct while above/within the optimal and you received full marks."):MAROffTarget_degree===2?(r=1,c="This means your answer was technically correct as its on-target value was above 35."):MAROffTarget_degree===3&&(r=.5,c="This means your answer was partially correct as it was found to be your only option is solely based on the target region range you selected."));let d=0,u="";for(let l=0;lFor gRNA PAM Sequence, you put down "${all_answers[1]}" which gave you the mark ${o}.
`,e+=a,e+="For Off-Target Score, you put down "${all_answers[4]}" which gave you the mark ${r}.
`,e+=c,e+="For F1 Primer, you put down "${all_answers[5]}" which gave you the mark ${d}.
`,e+=s,e+="For R1 Primer, you put down "${all_answers[6]}" which gave you the mark ${p}.
`,e+=m,e+="If at any point you wish to dispute marks, please contact your TA or professor once you completed your assignment. If you have found a bug in our SciGrade marking system, please contact your professor or our admin.
",e+="',$("#mainContainer").append(e)}function showNewInput(e,n,t){document.getElementById(String(e)).value===String(n)?document.getElementById(String(t)).removeAttribute("hidden"):document.getElementById(String(t)).setAttribute("hidden",!0)}let completed_assignments=[],all_answers=[],all_outputs=[],all_marks=[];function submitAnswers(){all_answers=[],all_outputs=[],all_marks=[],checkAnswers(),setTimeout(()=>{markAnswers(),all_answers.push(document?.getElementById("sequence_input")?.value?.trim()||"",document.getElementById("pam_input").value.trim(),document.getElementById("position_input").value,document.getElementById("strand_input").value,document.getElementById("offtarget_input").value,document.getElementById("f1_input").value.trim(),document.getElementById("r1_input").value.trim()),all_outputs.push(MARstrand,MARgRNAseq,MARgRNAseq_degree,MARCutPos,MARPAMseq,MAROffTarget,MAROffTarget_degree,MAROffTarget_aboveOpt,MAROffTarget_above35,MAROffTarget_onlyOption,MARF1primers,MARR1primers),all_marks.push(studentMark,studentMarkPercentage),document.getElementById("options_label").innerHTML="Would you like to see feedback on your answers or start a new assignment?",document.getElementById("seeFeedback").removeAttribute("hidden"),showFeedback(),$("#feedbackButton").click()},750)}function IfPressEnter(e,n){(e.which===13||e.keyCode===13)&&$(`#${n}`).click()}function backToAssignments(){redirectCRISPR(),$("#practice").click()}$(()=>{$("form").submit(()=>!1)}),typeof module<"u"&&module.exports&&(module.exports={getOffTargetOptimalValue,isNumberOrDashKey,createComplementarySeq,checkOffTarget,checkF1Primers,checkR1Primers,fillGeneList,get MAROffTarget(){return MAROffTarget},get MAROffTarget_degree(){return MAROffTarget_degree},get MARF1primers(){return MARF1primers},get MARR1primers(){return MARR1primers},__setTestState(e={}){e.correctNucleotideIncluded!==void 0&&(correctNucleotideIncluded=e.correctNucleotideIncluded),e.MARgRNAseq!==void 0&&(MARgRNAseq=e.MARgRNAseq),e.benchling_gRNA_outputs!==void 0&&(benchling_gRNA_outputs=e.benchling_gRNA_outputs),e.current_gene!==void 0&&(current_gene=e.current_gene),e.gene_backgroundInfo!==void 0&&(gene_backgroundInfo=e.gene_backgroundInfo)},__resetState(){MAROffTarget=!1,MAROffTarget_degree=0,MARF1primers=!1,MARR1primers=!1,MAROffTarget_aboveOpt=!1,MAROffTarget_above35=!1,MAROffTarget_onlyOption=!1,correctNucleotideIncluded=!1,MARgRNAseq=!1}}); diff --git a/core/scripts/crispr_scripts.test.js b/core/scripts/crispr_scripts.test.js index c564314..ff4325c 100644 --- a/core/scripts/crispr_scripts.test.js +++ b/core/scripts/crispr_scripts.test.js @@ -1,375 +1,405 @@ +const crispr = require("./crispr_scripts"); +const { + getOffTargetOptimalValue, + isNumberOrDashKey, + createComplementarySeq, + checkOffTarget, + checkF1Primers, + checkR1Primers, + fillGeneList, + __resetState: resetState, + __setTestState: setTestState, +} = crispr; + describe("crispr_scripts.js - Utility Functions", () => { - // Test the isNumberOrDashKey function without DOM dependencies - describe("isNumberOrDashKey()", () => { - // Define the function for testing - const isNumberOrDashKey = (evt) => { - const charCode = evt.which ? evt.which : evt.keyCode; - return !(charCode !== 46 && charCode !== 45 && charCode > 31 && (charCode < 48 || charCode > 57)); + // Setup mocks for DOM-dependent functions + let mockDocument; + let mockInput; + + beforeEach(() => { + jest.clearAllMocks(); + + // Mock DOM elements + mockInput = { + value: "", + trim: jest.fn(function () { + return this.value.trim(); + }), }; - it("should return true for number keys", () => { - const event1 = { which: 48 }; // '0' - const event2 = { which: 57 }; // '9' - const event3 = { keyCode: 53 }; // '5' - - expect(isNumberOrDashKey(event1)).toBe(true); - expect(isNumberOrDashKey(event2)).toBe(true); - expect(isNumberOrDashKey(event3)).toBe(true); - }); - - it("should return true for dash key", () => { - const event = { which: 45 }; // '-' - expect(isNumberOrDashKey(event)).toBe(true); - }); - - it("should return true for period key", () => { - const event = { which: 46 }; // '.' - expect(isNumberOrDashKey(event)).toBe(true); - }); - - it("should return false for letter keys", () => { - const event1 = { which: 65 }; // 'A' - const event2 = { which: 90 }; // 'Z' - const event3 = { which: 97 }; // 'a' + mockDocument = { + getElementById: jest.fn((id) => { + if (id === "offtarget_input") { + return { value: "75", trim: jest.fn(() => "75") }; + } else if (id === "position_input") { + return { value: "100", trim: jest.fn(() => "100") }; + } else if (id === "f1_input") { + return mockInput; + } else if (id === "r1_input") { + return mockInput; + } + return mockInput; + }), + }; - expect(isNumberOrDashKey(event1)).toBe(false); - expect(isNumberOrDashKey(event2)).toBe(false); - expect(isNumberOrDashKey(event3)).toBe(false); - }); + global.document = mockDocument; + // Setup global variables used by these functions + global.MAROffTarget = false; + global.MAROffTarget_degree = 0; + global.MAROffTarget_aboveOpt = false; + global.MAROffTarget_above35 = false; + global.MAROffTarget_onlyOption = false; + global.MARF1primers = false; + global.MARR1primers = false; + global.benchling_gRNA_outputs = { + gene_list: { + test_gene: [ + { Position: 100, "Specificity Score": 85 }, + { Position: 120, "Specificity Score": 75 }, + ], + }, + }; + global.current_gene = "test_gene"; + global.correctNucleotideIncluded = true; + global.MARgRNAseq = true; + }); - it("should return false for special characters", () => { - const event1 = { which: 33 }; // '!' - const event2 = { which: 64 }; // '@' + afterEach(() => { + jest.clearAllMocks(); + delete global.document; + delete global.MAROffTarget; + delete global.MAROffTarget_degree; + delete global.MAROffTarget_aboveOpt; + delete global.MAROffTarget_above35; + delete global.MAROffTarget_onlyOption; + delete global.MARF1primers; + delete global.MARR1primers; + delete global.benchling_gRNA_outputs; + delete global.current_gene; + delete global.correctNucleotideIncluded; + delete global.MARgRNAseq; + }); - expect(isNumberOrDashKey(event1)).toBe(false); - expect(isNumberOrDashKey(event2)).toBe(false); + describe("isNumberOrDashKey()", () => { + const cases = [ + { name: "number key 0", input: { which: 48 }, want: true }, + { name: "number key 9", input: { which: 57 }, want: true }, + { name: "number key 5 (keyCode)", input: { keyCode: 53 }, want: true }, + { name: "dash key", input: { which: 45 }, want: true }, + { name: "period key", input: { which: 46 }, want: true }, + { name: "letter A", input: { which: 65 }, want: false }, + { name: "letter Z", input: { which: 90 }, want: false }, + { name: "letter a", input: { which: 97 }, want: false }, + { name: "special ! character", input: { which: 33 }, want: false }, + { name: "special @ character", input: { which: 64 }, want: false }, + ]; + + it.each(cases)("$name", ({ input, want }) => { + expect(isNumberOrDashKey(input)).toBe(want); }); }); - // Test the createComplementarySeq function describe("createComplementarySeq()", () => { - const complementary_nt_dict = { - A: "T", - T: "A", - C: "G", - G: "C", - }; - - const createComplementarySeq = (seq) => { - let comp_seq = ""; - for (const element of seq) { - comp_seq = complementary_nt_dict[element] + comp_seq; - } - return comp_seq; - }; - - it("should create correct complementary sequence", () => { - const sequence = "ATCG"; - const result = createComplementarySeq(sequence); - expect(result).toBe("CGAT"); - }); - - it("should handle longer sequences", () => { - const sequence = "GCTCGTGACCACCCTGACCT"; - const result = createComplementarySeq(sequence); - expect(result).toBe("AGGTCAGGGTGGTCACGAGC"); + const cases = [ + { name: "short sequence ATCG", input: "ATCG", want: "CGAT" }, + { name: "longer sequence", input: "GCTCGTGACCACCCTGACCT", want: "AGGTCAGGGTGGTCACGAGC" }, + { name: "empty sequence", input: "", want: "" }, + { name: "single nucleotide A", input: "A", want: "T" }, + { name: "single nucleotide T", input: "T", want: "A" }, + { name: "single nucleotide C", input: "C", want: "G" }, + { name: "single nucleotide G", input: "G", want: "C" }, + ]; + + it.each(cases)("$name", ({ input, want }) => { + const result = createComplementarySeq(input); + expect(result).toBe(want); }); + }); - it("should handle empty sequence", () => { - const sequence = ""; - const result = createComplementarySeq(sequence); - expect(result).toBe(""); + describe("getOffTargetOptimalValue()", () => { + const cases = [ + { + name: "returns 80 when min optimal is below 35 threshold (input: 30)", + input: 30, + want: 80, + expectedType: "number", + }, + { + name: "returns 80 when min optimal is below 35 threshold (input: 170)", + input: 170, + want: 80, + expectedType: "number", + }, + { + name: "returns 80 when min optimal exceeds 80 threshold (input: 500)", + input: 500, + want: 80, + expectedType: "number", + }, + { + name: "returns min optimal for typical range (input: 90)", + input: 90, + want: 72, + expectedType: "number", + }, + { + name: "returns min optimal for typical range (input: 60)", + input: 60, + want: 48, + expectedType: "number", + }, + { + name: "returns min optimal for typical range (input: 75)", + input: 75, + want: 60, + expectedType: "number", + }, + { + name: "handles boundary case at 175 (minOptimal = 140, > 80)", + input: 175, + want: 80, + expectedType: "number", + }, + { + name: "handles boundary case at 100 (minOptimal = 80, exactly at boundary)", + input: 100, + want: 80, + expectedType: "number", + }, + { + name: "handles small positive value (input: 50)", + input: 50, + want: 40, + expectedType: "number", + }, + ]; + + it.each(cases)("$name", ({ input, want, expectedType }) => { + const result = getOffTargetOptimalValue(input); + expect(result).toEqual(want); + expect(typeof result).toBe(expectedType); }); - it("should handle single nucleotide", () => { - expect(createComplementarySeq("A")).toBe("T"); - expect(createComplementarySeq("T")).toBe("A"); - expect(createComplementarySeq("C")).toBe("G"); - expect(createComplementarySeq("G")).toBe("C"); + it("should not modify input parameter", () => { + const input = 90; + const inputCopy = input; + getOffTargetOptimalValue(input); + expect(input).toBe(inputCopy); }); }); - // Test marking logic without DOM dependencies - describe("markAnswers() logic", () => { - const calculateMarks = (answers) => { - let studentMark = 0; - const { - MARgRNAseq, - MARgRNAseq_degree, - MARPAMseq, - MAROffTarget, - MAROffTarget_degree, - MARF1primers, - MARR1primers, - } = answers; - - if (MARgRNAseq) { - if (MARgRNAseq_degree === 1) { - studentMark += 2; - } else if (MARgRNAseq_degree === 2) { - studentMark += 1; - } else if (MARgRNAseq_degree === 3) { - studentMark += 0.5; - } - } - if (MARPAMseq) { - studentMark += 2; - } - if (MAROffTarget) { - if (MAROffTarget_degree === 1) { - studentMark += 2; - } else if (MAROffTarget_degree === 2) { - studentMark += 1; - } else if (MAROffTarget_degree === 3) { - studentMark += 0.5; - } - } - if (MARF1primers) { - studentMark += 2; - } - if (MARR1primers) { - studentMark += 2; - } - - const studentMarkPercentage = ((studentMark / 10) * 100).toFixed(2); - return { studentMark, studentMarkPercentage }; - }; - - it("should calculate full marks correctly", () => { - const answers = { + describe("checkOffTarget()", () => { + beforeEach(() => { + resetState(); + setTestState({ + correctNucleotideIncluded: true, MARgRNAseq: true, - MARgRNAseq_degree: 1, - MARPAMseq: true, - MAROffTarget: true, - MAROffTarget_degree: 1, - MARF1primers: true, - MARR1primers: true, - }; - - const result = calculateMarks(answers); - expect(result.studentMark).toBe(10); - expect(parseFloat(result.studentMarkPercentage)).toBe(100); + benchling_gRNA_outputs: { + gene_list: { + test_gene: [{ Position: 100, "Specificity Score": 85 }], + }, + }, + current_gene: "test_gene", + }); }); - it("should calculate partial marks correctly", () => { - const answers = { - MARgRNAseq: true, - MARgRNAseq_degree: 2, // 1 mark - MARPAMseq: true, // 2 marks - MAROffTarget: false, // 0 marks - MAROffTarget_degree: 0, - MARF1primers: true, // 2 marks - MARR1primers: false, // 0 marks - }; - - const result = calculateMarks(answers); - expect(result.studentMark).toBe(5); - expect(parseFloat(result.studentMarkPercentage)).toBe(50); - }); + it("sets MAROffTarget true when score matches input within bounds", () => { + global.document.getElementById = jest.fn((id) => { + if (id === "offtarget_input") return { value: "75" }; + if (id === "position_input") return { value: "100" }; + return { value: "" }; + }); - it("should handle zero marks", () => { - const answers = { - MARgRNAseq: false, - MARgRNAseq_degree: 0, - MARPAMseq: false, - MAROffTarget: false, - MAROffTarget_degree: 0, - MARF1primers: false, - MARR1primers: false, - }; - - const result = calculateMarks(answers); - expect(result.studentMark).toBe(0); - expect(parseFloat(result.studentMarkPercentage)).toBe(0); - }); + checkOffTarget(75); - it("should handle fractional marks", () => { - const answers = { - MARgRNAseq: true, - MARgRNAseq_degree: 3, // 0.5 marks - MARPAMseq: false, - MAROffTarget: true, - MAROffTarget_degree: 3, // 0.5 marks - MARF1primers: false, - MARR1primers: false, - }; - - const result = calculateMarks(answers); - expect(result.studentMark).toBe(1); - expect(parseFloat(result.studentMarkPercentage)).toBe(10); + expect(crispr.MAROffTarget).toBe(true); }); - }); - // Test off-target scoring logic - describe("checkOffTarget() logic", () => { - const checkOffTargetScore = (score, inputValue, prerequisites) => { - const { correctNucleotideIncluded, MARgRNAseq } = prerequisites; - let MAROffTarget = false; - let MAROffTarget_degree = 0; - let MAROffTarget_aboveOpt = false; - let MAROffTarget_above35 = false; - let MAROffTarget_onlyOption = false; - - const OffTargetValue_down = Math.floor(score); - const OffTargetValue_up = Math.ceil(score); - - if (correctNucleotideIncluded && MARgRNAseq) { - if (inputValue >= OffTargetValue_down && inputValue <= OffTargetValue_up) { - MAROffTarget = true; - if (score >= 75) { - MAROffTarget_degree = 1; - MAROffTarget_aboveOpt = true; - } else if (score >= 35) { - MAROffTarget_degree = 2; - MAROffTarget_above35 = true; - } else { - MAROffTarget_degree = 3; - MAROffTarget_onlyOption = true; - } - } - } - - return { - MAROffTarget, - MAROffTarget_degree, - MAROffTarget_aboveOpt, - MAROffTarget_above35, - MAROffTarget_onlyOption, - }; - }; - - it("should set correct off-target marking for high score", () => { - const result = checkOffTargetScore(85, 85, { - correctNucleotideIncluded: true, - MARgRNAseq: true, + it("sets MAROffTarget degree 1 for score >= 75", () => { + global.document.getElementById = jest.fn((id) => { + if (id === "offtarget_input") return { value: "85" }; + if (id === "position_input") return { value: "100" }; + return { value: "" }; }); - expect(result.MAROffTarget).toBe(true); - expect(result.MAROffTarget_degree).toBe(1); - expect(result.MAROffTarget_aboveOpt).toBe(true); + checkOffTarget(85); + + expect(crispr.MAROffTarget).toBe(true); + expect(crispr.MAROffTarget_degree).toBe(1); }); - it("should set correct off-target marking for medium score", () => { - const result = checkOffTargetScore(50, 50, { - correctNucleotideIncluded: true, - MARgRNAseq: true, + it("sets MAROffTarget degree 2 for score 35-75", () => { + global.document.getElementById = jest.fn((id) => { + if (id === "offtarget_input") return { value: "50" }; + if (id === "position_input") return { value: "100" }; + return { value: "" }; }); - expect(result.MAROffTarget).toBe(true); - expect(result.MAROffTarget_degree).toBe(2); - expect(result.MAROffTarget_above35).toBe(true); + checkOffTarget(50); + + expect(crispr.MAROffTarget).toBe(true); + expect(crispr.MAROffTarget_degree).toBe(2); }); - it("should set correct off-target marking for low score", () => { - const result = checkOffTargetScore(25, 25, { - correctNucleotideIncluded: true, - MARgRNAseq: true, - }); + it("should not set MAROffTarget when prerequisites not met", () => { + global.correctNucleotideIncluded = false; + global.MARgRNAseq = false; - expect(result.MAROffTarget).toBe(true); - expect(result.MAROffTarget_degree).toBe(3); - expect(result.MAROffTarget_onlyOption).toBe(true); + checkOffTarget(75); + + expect(global.MAROffTarget).toBe(false); + expect(global.MAROffTarget_degree).toBe(0); }); + }); - it("should not set off-target marking when prerequisites not met", () => { - const result = checkOffTargetScore(85, 85, { - correctNucleotideIncluded: false, - MARgRNAseq: false, + describe("checkF1Primers()", () => { + beforeEach(() => { + resetState(); + }); + + it("validates F1 primer for sequence starting with G", () => { + const seq = "GCTCGTGACCACCCTGACCT"; + global.document.getElementById = jest.fn((id) => { + if (id === "f1_input") { + return { + value: "TAATACGACTCACTATAGGCTCGTGACCACCCTG", + trim: jest.fn(function () { + return this.value; + }), + }; + } + return { value: "", trim: jest.fn(() => "") }; }); - expect(result.MAROffTarget).toBe(false); - expect(result.MAROffTarget_degree).toBe(0); + checkF1Primers(seq); + + expect(crispr.MARF1primers).toBe(true); }); - it("should handle decimal scores correctly", () => { - const result = checkOffTargetScore(85.7, 85, { - correctNucleotideIncluded: true, - MARgRNAseq: true, + it("rejects incorrect F1 primer", () => { + const seq = "GCTCGTGACCACCCTGACCT"; + global.document.getElementById = jest.fn((id) => { + if (id === "f1_input") { + return { + value: "WRONGPRIMER", + trim: jest.fn(function () { + return this.value; + }), + }; + } + return { value: "", trim: jest.fn(() => "") }; }); - expect(result.MAROffTarget).toBe(true); - expect(result.MAROffTarget_degree).toBe(1); + checkF1Primers(seq); + + expect(crispr.MARF1primers).toBe(false); }); - }); - // Test primer generation logic - describe("F1 Primer generation logic", () => { - const generateF1Primers = (seq) => { - const possible_F1_primers = []; - const begin_F1 = "TAATACGACTCACTATAG"; - let count_First = true; - if (seq[0] === "G") { - count_First = false; - } - for (let i = 16; i <= 20; i += 1) { - possible_F1_primers.push(begin_F1 + seq.slice(0, i)); - } - if (!count_First) { - for (let i = 16; i <= 20; i += 1) { - possible_F1_primers.push(begin_F1 + seq.slice(1, i)); + it("accepts valid F1 primer within range", () => { + const seq = "ATCGATCGATCG"; + global.document.getElementById = jest.fn((id) => { + if (id === "f1_input") { + return { + value: "TAATACGACTCACTATAGATCGATCGATCG", + trim: jest.fn(function () { + return this.value; + }), + }; } - } - return possible_F1_primers; - }; + return { value: "", trim: jest.fn(() => "") }; + }); - const validateF1Primer = (seq, inputPrimer) => { - const possiblePrimers = generateF1Primers(seq); - return possiblePrimers.includes(inputPrimer); - }; + checkF1Primers(seq); - it("should generate correct F1 primers for sequence starting with G", () => { - const sequence = "GCTCGTGACCACCCTGACCT"; - const primers = generateF1Primers(sequence); + expect(crispr.MARF1primers).toBe(true); + }); + }); - expect(primers.length).toBeGreaterThan(5); - expect(primers[0]).toBe("TAATACGACTCACTATAGGCTCGTGACCACCCTG"); + describe("checkR1Primers()", () => { + beforeEach(() => { + resetState(); }); - it("should validate correct F1 primer", () => { - const sequence = "GCTCGTGACCACCCTGACCT"; - const primer = "TAATACGACTCACTATAGCTCGTGACCACCCTGA"; + it("validates R1 primer for complementary sequence", () => { + const seq = "ATCGATCG"; + global.document.getElementById = jest.fn((id) => { + if (id === "r1_input") { + return { + value: "TTCTAGCTCTAAAACCGATCGAT", + trim: jest.fn(function () { + return this.value; + }), + }; + } + return { value: "", trim: jest.fn(() => "") }; + }); + + checkR1Primers(seq); - expect(validateF1Primer(sequence, primer)).toBe(true); + expect(crispr.MARR1primers).toBe(true); }); - it("should reject incorrect F1 primer", () => { - const sequence = "GCTCGTGACCACCCTGACCT"; - const primer = "WRONGPRIMER"; + it("rejects incorrect R1 primer", () => { + const seq = "ATCGATCG"; + global.document.getElementById = jest.fn((id) => { + if (id === "r1_input") { + return { + value: "WRONGPRIMER", + trim: jest.fn(function () { + return this.value; + }), + }; + } + return { value: "", trim: jest.fn(() => "") }; + }); - expect(validateF1Primer(sequence, primer)).toBe(false); + checkR1Primers(seq); + + expect(crispr.MARR1primers).toBe(false); }); }); - // Test gene list functionality - describe("Gene list functionality", () => { - const fillGeneList = (gene_backgroundInfo) => { - if (gene_backgroundInfo?.gene_list) { - return Object.keys(gene_backgroundInfo.gene_list); - } - return []; - }; + describe("fillGeneList()", () => { + beforeEach(() => { + resetState(); + // Setup jQuery mock + global.$ = jest.fn((selector) => { + return { + empty: jest.fn(() => global.$returnValue), + append: jest.fn(() => global.$returnValue), + }; + }); + global.$returnValue = undefined; + }); - it("should return gene list when background info exists", () => { - const backgroundInfo = { - gene_list: { - eBFP: { "Target position": 100 }, - ACTN3: { "Target position": 200 }, + it("populates gene dropdown with genes from background info", () => { + setTestState({ + gene_backgroundInfo: { + gene_list: { + eBFP: { "Target position": 100 }, + ACTN3: { "Target position": 200 }, + }, }, - }; + }); + + fillGeneList(); - const result = fillGeneList(backgroundInfo); - expect(result).toEqual(["eBFP", "ACTN3"]); + expect(global.$).toHaveBeenCalledWith("#gene_dropdown_selection"); + const calls = global.$.mock.results; + const emptyCall = calls.find((c) => c.value.empty); + expect(emptyCall).toBeDefined(); }); - it("should return empty array when no background info", () => { - const result = fillGeneList(null); - expect(result).toEqual([]); + it("does nothing when no background info", () => { + setTestState({ gene_backgroundInfo: null }); + fillGeneList(); + expect(global.$).not.toHaveBeenCalled(); }); - it("should return empty array when gene_list is undefined", () => { - const backgroundInfo = {}; - const result = fillGeneList(backgroundInfo); - expect(result).toEqual([]); + it("does nothing when gene_list is undefined", () => { + setTestState({ gene_backgroundInfo: {} }); + fillGeneList(); + expect(global.$).not.toHaveBeenCalled(); }); }); }); diff --git a/core/scripts/login.js b/core/scripts/login.js deleted file mode 100644 index be716f9..0000000 --- a/core/scripts/login.js +++ /dev/null @@ -1,272 +0,0 @@ -//= ================================ SciGrade ================================== -// -// Purpose: Login and registration for SciGrade -// -//= ============================================================================ - -let student_reg_information; - -/** Let users continue with practice application without logging in (default true) */ -let continueWithoutLogin = true; - -let checkStudentNum = false; -let studentNumber = 0; -let studentUmail; -let alreadyRegistered = false; -let classRegister; - -/** - * Checks whether a student number and email match the class roster. - * @param {number} student_num Student number - * @param {string} student_umail Student email/uMail - */ -function checkStudentNumber(student_num, student_umail) { - alreadyRegistered = false; - checkStudentNum = false; - let maxNum = 0; - const classList = student_reg_information?.[0]?.class_list; - if (classList) { - for (const key in classList) { - if ( - student_reg_information[0].student_list !== null && - student_reg_information[0].student_list.length > 0 - ) { - for (const student of student_reg_information[0].student_list) { - if (student.student_number === student_num && student.studentClass === key) { - alreadyRegistered = true; - } - } - } - } - } - - if (!alreadyRegistered) { - for (const key in classList) { - if (classList[key][student_num] === student_umail) { - checkStudentNum = true; - studentNumber = student_num; - studentUmail = student_umail; - studentParseNum = i; - classRegister = key; - break; - } else { - maxNum += 1; - } - } - } - if (checkStudentNum) { - addSecondSection(); - } else if (alreadyRegistered) { - showRegError(4); - } else if (!checkStudentNum && maxNum === student_reg_information?.[0]?.student_list.length) { - showRegError(1); - } else if (!checkStudentNum) { - showRegError(2); - } -} - -/** - * Checks whether a student number exists in the registration list. - * @param {number} student_NumVerify - Student number - */ -function loginVerify(student_NumVerify) { - alreadyRegistered = false; - let maxNum = 0; - checkStudentNum = false; - - if (student_reg_information?.[0]?.student_list && student_reg_information[0].student_list.length > 0) { - for (let i = 0; i < student_reg_information[0].student_list.length; i += 1) { - if (student_reg_information[0].student_list[i].student_number === student_NumVerify) { - if (student_reg_information[0].student_list[i].gmail !== "unregistered") { - alreadyRegistered = true; - checkStudentNum = true; - studentNumber = student_NumVerify; - studentParseNum = i; - } else if (student_reg_information[0].student_list[i].gmail === "unregistered") { - alreadyRegistered = false; - } - } else { - maxNum += 1; - } - } - } - - if (alreadyRegistered && checkStudentNum) { - $("#loginForm").empty(); - document.getElementById("loginP2").style.display = "block"; - } else if (!alreadyRegistered) { - showRegError(5); - } else if (maxNum === student_reg_information[0].student_list.length) { - showRegError(1); - } -} - -/** - * Shows a registration error message by code. - * @param {number} whichOne - Error code to display - */ -function showRegError(whichOne) { - if (whichOne === 1) { - // Not in our database - document.getElementById("errorRegContent").innerHTML = - "It appears that you are not a student in our database.\n Are you a UofT student? If so, contact your TA, Professor or Admin for further help."; - $("#errorRegButton").click(); - } else if (whichOne === 2) { - // Something went wrong with registration - document.getElementById("errorRegContent").innerHTML = - "Something went wrong. Please refresh the page and try again. If this persists, please contact your TA, Professor or Admin with the following error code: lgn83-85"; - $("#errorRegButton").click(); - } else if (whichOne === 3) { - // Verify ID was incorrect - document.getElementById("errorRegContent").innerHTML = - "It appears that your verification ID is incorrect. Please retype it and try again. If this persists, contact your TA, Professor or Admin for further help. NOTE: Only students of HMB311 can register for SciGrade."; - $("#errorRegButton").click(); - } else if (whichOne === 4) { - // Verify ID was incorrect - document.getElementById("errorRegContent").innerHTML = - "You are already registered for SciGrade, please navigate to the login tab instead of the register. If an issue arises, please contact your TA, Professor or Admin for further help."; - $("#errorRegButton").click(); - } else if (whichOne === 5) { - // Not yet registered for SciGrade - document.getElementById("errorRegContent").innerHTML = - "It appears that you have not yet registered for SciGrade, please navigate to the register tab and register first. If an issue arises, please contact your TA, Professor or Admin for further help."; - $("#errorRegButton").click(); - } else if (whichOne === 6) { - // Not yet registered for SciGrade - document.getElementById("errorRegContent").innerHTML = - "This is not the Google account associated with this student number. If an issue arises, please contact your TA, Professor or Admin for further help."; - $("#errorRegButton").click(); - } else if (whichOne === 7) { - // Restricted access to only TA's and Admins' - document.getElementById("errorRegContent").innerHTML = - "This feature is restricted to only TA's and admins. You do not have access. Please contact a TA or admin for access."; - $("#errorRegButton").click(); - } else if (whichOne === 8) { - // Unequal amount of student numbers and student emails - document.getElementById("errorRegContent").innerHTML = - "There is an unequal amount of student numbers and student uMails, please correct this to proceed"; - $("#errorRegButton").click(); - } -} - -/** - * Adds the verification student section to the login page - */ -function addSecondSection() { - $("#pP1").empty(); - $("#registerP1").empty(); - document.getElementById("pP3").innerHTML = - "Next, you will login through Google to register for SciGrade. This way you will never need to remember a username or password. Please click the button below to complete your registration."; - document.getElementById("registerP3").style.display = "block"; -} - -/** - * Signs the user out and returns screen back to login/register display - */ -function signOutDisplay() { - if (document.getElementById("accountIO")) { - document.getElementById("accountIO").setAttribute("hidden", true); - } - - if (document.getElementById("logIO")) { - document.getElementById("logIO").setAttribute("hidden", true); - document.getElementById("logIO").innerHTML = `${changeLogin} Login`; - document.getElementById("logIO").setAttribute("onclick"); - } - - $("#mainContainer").empty(); - - let append_str; - append_str = "
Please select the dry lab mode you would like to use:
-Please select the dry lab mode you would like to use:
\n\t\t\t\t\tPlease select the dry lab mode you would like to use:
\n\t\t\t\t\tPlease select the dry lab mode you would like to use:
+Please select the dry lab mode you would like to use:
+